ID: 900158248

View in Genome Browser
Species Human (GRCh38)
Location 1:1212026-1212048
Sequence CCGGGGGGCCCTGGGTCTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 552
Summary {0: 1, 1: 0, 2: 5, 3: 50, 4: 496}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900158230_900158248 29 Left 900158230 1:1211974-1211996 CCCTGTGAGGTTCTGGGCCAGGC 0: 1
1: 0
2: 2
3: 25
4: 259
Right 900158248 1:1212026-1212048 CCGGGGGGCCCTGGGTCTCCTGG 0: 1
1: 0
2: 5
3: 50
4: 496
900158235_900158248 12 Left 900158235 1:1211991-1212013 CCAGGCTTCAGTGGGCTGGACAG 0: 1
1: 0
2: 1
3: 13
4: 198
Right 900158248 1:1212026-1212048 CCGGGGGGCCCTGGGTCTCCTGG 0: 1
1: 0
2: 5
3: 50
4: 496
900158231_900158248 28 Left 900158231 1:1211975-1211997 CCTGTGAGGTTCTGGGCCAGGCT 0: 1
1: 0
2: 2
3: 21
4: 230
Right 900158248 1:1212026-1212048 CCGGGGGGCCCTGGGTCTCCTGG 0: 1
1: 0
2: 5
3: 50
4: 496

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900158248 Original CRISPR CCGGGGGGCCCTGGGTCTCC TGG Exonic
900158248 1:1212026-1212048 CCGGGGGGCCCTGGGTCTCCTGG + Exonic
900284156 1:1891264-1891286 CCGGGCCGCCGGGGGTCTCCCGG - Intergenic
900296877 1:1956319-1956341 TCGGGGGAGGCTGGGTCTCCTGG + Intronic
900387423 1:2416925-2416947 TGGGGGGGCCCTGGGGCTCTGGG + Intergenic
900762580 1:4482908-4482930 CCGTGTTGCACTGGGTCTCCAGG - Intergenic
900792984 1:4691825-4691847 CCAGGCGGTCCTGGGTCTGCAGG - Intronic
900795008 1:4702614-4702636 CTGGGGCGTCCTGGGGCTCCCGG + Intronic
901325697 1:8364026-8364048 CCCTGGGGCCATGGGGCTCCTGG - Intronic
901445975 1:9308347-9308369 TCCGGGGGCCCTGGGTATGCAGG - Intronic
902458497 1:16553678-16553700 CAGGGTGACCCTGGGCCTCCAGG + Intergenic
902476940 1:16693335-16693357 CAGGCGGGCCCAGGGTGTCCAGG + Intergenic
902493663 1:16854238-16854260 CAGGGTGACCCTGGGCCTCCAGG - Intronic
903151683 1:21414437-21414459 CAGGGCGACCCTGGGCCTCCAGG + Intergenic
903168954 1:21540392-21540414 CTGGGGGTCCCTGAGGCTCCAGG - Intronic
903193466 1:21669108-21669130 CGTGGGGGACCCGGGTCTCCAGG - Intronic
904001884 1:27343357-27343379 CAGAGGGGCCCTGTGGCTCCAGG + Intronic
904044928 1:27603302-27603324 CGGGGGGGGCCTGCGTCCCCCGG - Intronic
904276743 1:29389877-29389899 CTGCTGGGCTCTGGGTCTCCAGG + Intergenic
904603008 1:31683966-31683988 CCTGGGGGCCCTTGAACTCCTGG + Exonic
904885954 1:33738623-33738645 CTGGTTGGCCCTGAGTCTCCTGG + Intronic
905168697 1:36098134-36098156 CCAGGGGTCCCTGGCTCCCCTGG - Exonic
905909050 1:41641361-41641383 CCGGAGGACCCTGGGTCACCAGG - Intronic
906060569 1:42945800-42945822 CCGGGGGGGCCTGGGTGACTGGG + Intronic
907254876 1:53171500-53171522 CCAGGGGTCCCTGCGCCTCCTGG + Intergenic
913607145 1:120476683-120476705 CAGGGTGACCCTGGGCCTCCAGG - Intergenic
914209286 1:145563462-145563484 CAGGGTGACCCTGGGCCTCCAGG + Intergenic
914268206 1:146055830-146055852 CAGGGTGACCCTGGGCCTCCAGG + Intergenic
914446121 1:147751954-147751976 CCAGGCTGCCCTGGGACTCCTGG + Intergenic
914474444 1:148011731-148011753 CCGTGGGCCCATGGGTCTTCCGG + Intergenic
914584048 1:149045155-149045177 CAGGGTGACCCTGGGCCTCCAGG + Intronic
919764741 1:201119518-201119540 CTGTGGGTCCCTAGGTCTCCTGG + Intronic
920093657 1:203471936-203471958 CCTGGGGGGCCTGGGTTGCCTGG - Intergenic
920184482 1:204151714-204151736 TCGGGGGGCCCGGCGGCTCCCGG + Exonic
920211689 1:204333117-204333139 CTGGGGGCCTCTGGCTCTCCTGG - Intronic
920535034 1:206731740-206731762 CTGGGGAGCCTTGGGTCTCACGG + Intronic
924436396 1:244047984-244048006 CCCGGGTGCCCTGCCTCTCCAGG + Intergenic
924811850 1:247409919-247409941 TCGGGGGCCCCTGGGACTCTTGG + Intergenic
1062918959 10:1265609-1265631 GAGGGGGGCCCAGGCTCTCCCGG + Intronic
1062918980 10:1265677-1265699 GAGGGGGGCCCAGGCTCTCCCGG + Intronic
1062919003 10:1265745-1265767 GAGGGGGGCCCAGGCTCTCCCGG + Intronic
1062919027 10:1265813-1265835 GAGGGGGGCCCAGGGTCCCCCGG + Intronic
1062919053 10:1265881-1265903 GAGGGGGGCCCAGGGTCCCCCGG + Intronic
1062919100 10:1266017-1266039 GAGGGGGGCCCAGGGTCCCCCGG + Intronic
1063189244 10:3678511-3678533 CTGGGTGGTCCTGGGTCACCAGG - Intergenic
1063362024 10:5466904-5466926 CTGGGAGGCCCTGGCCCTCCCGG - Intergenic
1063663373 10:8048546-8048568 GCCGGCGTCCCTGGGTCTCCCGG - Intergenic
1064052297 10:12069153-12069175 CCAGGGCGCCCTGGGGCTCGCGG - Exonic
1064552882 10:16520812-16520834 CCGGGTGGCCCGGGCTCTCCGGG + Exonic
1065879359 10:30026231-30026253 CCGGGAGGCCTTGTGTCTCCTGG - Exonic
1066702297 10:38143077-38143099 CCAGGGGGACCTGGGACTCAAGG - Intergenic
1066990182 10:42505628-42505650 CCAGGGGGACCTGGGACTCAAGG + Intergenic
1067071954 10:43138692-43138714 GCGGGGGGCCCTGTCTCTCAGGG + Intronic
1067527924 10:47049512-47049534 CCTGGTGGTCCTGGGTTTCCTGG + Intergenic
1067696231 10:48537465-48537487 CAGGGGAGGCCTGGTTCTCCAGG + Intronic
1069034062 10:63630020-63630042 CCTGGGCCTCCTGGGTCTCCGGG - Intergenic
1069960999 10:72079393-72079415 CCTGGGGGCCCCCGTTCTCCAGG + Intronic
1070753655 10:78978255-78978277 CAGTGGGGCACTGGGTCTGCCGG - Intergenic
1070759917 10:79017675-79017697 CTGGGGGGCCCTGCATCTCCTGG - Intergenic
1070853198 10:79584307-79584329 CCAGGAGCCCCTGGGTTTCCTGG + Intergenic
1070954696 10:80455916-80455938 TCTGGTGGCCCTGGGTTTCCAGG - Intronic
1072032999 10:91539177-91539199 CCAAGGGGCCCTGGTTTTCCAGG - Intergenic
1072659848 10:97357077-97357099 CCCAGGGGCCCTGGGCCTCAGGG + Exonic
1073025203 10:100482585-100482607 CGGGCGGGCCCTGGGTCGCTGGG + Exonic
1073291824 10:102416930-102416952 CTGGGGGGCTCTGGGGCACCGGG + Exonic
1073293472 10:102424731-102424753 CCGAGGGGCCCAGGTCCTCCAGG + Exonic
1073510264 10:104038462-104038484 CCTGGGCCCCCTGGGCCTCCGGG - Exonic
1075022739 10:118963552-118963574 CCGGGGTGCCCAGTGTCTGCGGG - Intergenic
1075401454 10:122164006-122164028 CCGGGCCGCCCCGAGTCTCCCGG + Intronic
1076342579 10:129759823-129759845 CCAGGGAGCCCTGGGCCTCAGGG - Intronic
1076374516 10:129973975-129973997 CCGGGAGAACCTGGGACTCCTGG + Intergenic
1076721696 10:132396067-132396089 CCCGGCGGCGCTGGGTCGCCAGG + Intergenic
1076768633 10:132651255-132651277 TGGGGAGGCCCTGGGTCCCCCGG + Intronic
1076768654 10:132651301-132651323 TGGGGAGGCCCTGGGTCCCCCGG + Intronic
1076768674 10:132651347-132651369 TGGGGAGGCCCTGGGTCCCCCGG + Intronic
1076768695 10:132651393-132651415 TGGGGAGGCCCTGGGTCCCCCGG + Intronic
1076768716 10:132651439-132651461 TGGGGAGGCCCTGGGTCCCCCGG + Intronic
1076768736 10:132651485-132651507 TGGGGAGGCCCTGGGTCCCCCGG + Intronic
1076776474 10:132700605-132700627 CCGGGGAGCCATGGGAGTCCCGG + Intronic
1076836086 10:133021662-133021684 GCGGGAGACCTTGGGTCTCCGGG + Intergenic
1077021958 11:420898-420920 GCGGAGGGGCCTGGGGCTCCCGG + Intronic
1077053127 11:576616-576638 CCTGGGGGCCCTGCTCCTCCGGG + Intronic
1077102110 11:827029-827051 CGGGGGGTCCCTGGGTCTCTGGG + Intronic
1077360848 11:2139557-2139579 GCTGGGGGCCCTGGGGCCCCGGG + Intronic
1077865469 11:6218033-6218055 CTGGGTGGCTCTGAGTCTCCAGG - Exonic
1078196166 11:9138663-9138685 CCTGAGGGCCTGGGGTCTCCTGG - Intergenic
1080521016 11:33067830-33067852 CTGGGGGACCCAGGGTATCCAGG + Intronic
1080845181 11:36020751-36020773 CAGAGGTGCCCTGGGTATCCTGG - Intronic
1080881064 11:36321315-36321337 CAGGCAGGCCCTGGGTCTACTGG - Intronic
1083437585 11:62653206-62653228 CCAGGTGGCCCTGGGGCCCCGGG + Exonic
1083581255 11:63826944-63826966 CCGCGGGACACTGGATCTCCAGG + Exonic
1083623311 11:64059501-64059523 CCTGGGGGGCCTGGGTACCCAGG - Intronic
1083714953 11:64569805-64569827 GCGGAAGTCCCTGGGTCTCCGGG - Exonic
1083759529 11:64808031-64808053 CTGCCAGGCCCTGGGTCTCCGGG - Exonic
1084155663 11:67311297-67311319 GCAGGGAGGCCTGGGTCTCCAGG + Intronic
1084216316 11:67648669-67648691 CTGGGGGGCTCTGGGTGGCCAGG + Intronic
1084973042 11:72781727-72781749 CCGCGCGGCCCCGGGTCTCCCGG - Intronic
1085039317 11:73317627-73317649 AATGGGGGCCCTGGGTCCCCTGG + Intronic
1085273381 11:75283427-75283449 CCGGGAGGACCTGGATGTCCTGG - Exonic
1085273918 11:75286088-75286110 CCTGGGAGCCCAGGGTCCCCAGG + Intronic
1085743435 11:79095574-79095596 CACCGGGTCCCTGGGTCTCCTGG - Intronic
1089573134 11:119423077-119423099 CCGGTGGGACCTGGGGCTCGGGG - Intronic
1091221296 11:133931385-133931407 CCAGGGAGCCCTGGGGCTGCGGG - Intronic
1091221312 11:133931421-133931443 CCCTGGAGCCCTGGGTCTGCAGG - Intronic
1091239407 11:134042566-134042588 CCGGGAGGCCCTGTGGTTCCTGG + Intergenic
1091840015 12:3614018-3614040 CTGTGGGGGCCTGGGTCTGCAGG + Intronic
1091884036 12:4003111-4003133 CTTGGGGGCCCTGGGCTTCCAGG + Intergenic
1094831219 12:34301154-34301176 ACGGGGGGCCCCAGGTATCCTGG + Intergenic
1094838150 12:34331850-34331872 CGAGGGGACCCTGGGCCTCCCGG + Intergenic
1094840902 12:34342346-34342368 CCTGGGAGCCCAGGGTCCCCGGG - Intergenic
1094842728 12:34348780-34348802 CCGGGGACCCCTAGGTCCCCGGG + Intergenic
1094844684 12:34356245-34356267 CTGGGAGGCCCATGGTCTCCTGG + Intergenic
1094850630 12:34380789-34380811 CAGGGATGCCCAGGGTCTCCTGG + Intergenic
1094856541 12:34405425-34405447 CAGGGATGCCCTGGGTCCCCTGG - Intergenic
1095096134 12:38150335-38150357 CAGTGGTGCCCTGGGTCTCTGGG + Intergenic
1095981564 12:47977372-47977394 CCAGGGGGCCCAGGGGCTCCAGG + Exonic
1096106328 12:48998609-48998631 CCCGCCGGCCCTGGGCCTCCAGG - Exonic
1096215946 12:49797348-49797370 GCTGGGGGGCCTGGGCCTCCTGG + Exonic
1096476821 12:51913638-51913660 CCTGGTGGCCCTGGGTGTCCTGG + Exonic
1096706381 12:53424852-53424874 CCAGGGAGCCCTGGGACTCCTGG + Exonic
1096839944 12:54374014-54374036 CCTGGGGGAGCTGGGTCTCCAGG + Exonic
1096865722 12:54561520-54561542 CTTGGGGGCCCTGGGGCTCCTGG + Intronic
1096992510 12:55816880-55816902 CGGGTGGGCCCTGCATCTCCTGG - Intronic
1101482163 12:105108169-105108191 CCCGGGGCCGCTGGGCCTCCCGG - Intronic
1101718457 12:107331511-107331533 CCGGGGGGACCGGGGACACCAGG + Intronic
1102005185 12:109585188-109585210 CCAGGGGTCTCTGGGGCTCCTGG + Intronic
1102967919 12:117142243-117142265 CAGGTGGTCCCTGAGTCTCCAGG - Intronic
1103364032 12:120369373-120369395 CGCGGGGCTCCTGGGTCTCCGGG + Intergenic
1103370250 12:120414036-120414058 CTGGGGAGCGCTGGCTCTCCAGG - Intergenic
1103427021 12:120844794-120844816 CCCGTGGGCCCTTGGCCTCCGGG - Intronic
1103691030 12:122774557-122774579 GCGCGGGGCCCCGGGGCTCCGGG + Exonic
1104042039 12:125136843-125136865 CCGGGATGCCCTTGGTTTCCAGG - Exonic
1104049704 12:125186994-125187016 CCGGGGGCTCCTGGGTTCCCAGG - Intronic
1105930337 13:25046824-25046846 CAGACGGGCCCTGAGTCTCCAGG - Intergenic
1106670893 13:31903910-31903932 CTGGGGGTCCCTGTGTCCCCAGG + Intergenic
1107698488 13:43023594-43023616 CCGCGGCGCCTTGAGTCTCCGGG + Exonic
1112009189 13:95279829-95279851 CTGGGGGGCCCTGTGGCTCCAGG - Intronic
1113423263 13:110186393-110186415 CCTGGAGGCCCTGGATCCCCAGG - Exonic
1113456041 13:110449738-110449760 CCTGGGAGGCCCGGGTCTCCTGG - Exonic
1113459696 13:110473120-110473142 CCAGGGGGGCCTCTGTCTCCGGG - Exonic
1113560197 13:111272640-111272662 CGGGGGTCACCTGGGTCTCCTGG + Intronic
1113805516 13:113108714-113108736 CCCGGGGGTCGTGGGTGTCCCGG + Intronic
1113805714 13:113109242-113109264 CCCGGGGGTCGTGGGTGTCCCGG + Intronic
1113904102 13:113811398-113811420 AAGAGTGGCCCTGGGTCTCCGGG + Intronic
1118868155 14:69719326-69719348 CAGGGGCTGCCTGGGTCTCCTGG - Intergenic
1119049721 14:71354937-71354959 CCCCCGGGCCCTGGGTCTCCAGG - Intronic
1121541845 14:94733698-94733720 CCGGGGGCACCTGGCTCTCTTGG + Intergenic
1121548689 14:94781738-94781760 CCGGGTAGCCCTGGGGCTCGTGG + Intergenic
1121818209 14:96944236-96944258 CCTCGGGTCCCTGGGGCTCCGGG + Intergenic
1122140601 14:99660761-99660783 CAGGGTGGCCCTGAGTGTCCAGG - Intronic
1122327354 14:100890646-100890668 CCTGGGGCCCCTGGCTCTCTGGG + Intergenic
1122814703 14:104306757-104306779 CAGCGGGGCCCTGGGAGTCCAGG + Intergenic
1122847381 14:104507200-104507222 TCGGGGAGACCTGGGCCTCCTGG + Intronic
1122902404 14:104787297-104787319 GCAGAGGGCCCTGGGGCTCCAGG - Intronic
1123103108 14:105818950-105818972 TCTGGGGGCACTGGGGCTCCAGG + Intergenic
1123129234 14:105972301-105972323 CCGGGGGGCACCTGGACTCCGGG + Intergenic
1124596872 15:31098682-31098704 GCAGGTGGCCCTGGCTCTCCTGG - Intronic
1125882961 15:43209394-43209416 CCTGGGTGGCCTGGGTCTGCGGG + Exonic
1127488739 15:59442132-59442154 CCTGGGGGCCCTGGGTAAACAGG - Intronic
1128813136 15:70586436-70586458 CCGGTGGGCTCGCGGTCTCCCGG + Intergenic
1129108236 15:73323227-73323249 CCGGGGAGGCCTGGGACTCCCGG - Exonic
1129244818 15:74272700-74272722 GCGGGGGGCCCTGGGCTGCCAGG + Intronic
1129269575 15:74412220-74412242 CCAGGGACCCCTGGGCCTCCTGG - Intronic
1131440309 15:92454730-92454752 CCAGGGGCCCCTGGCTCTGCTGG + Intronic
1132373939 15:101316080-101316102 CCAGGTGGGCCTGGGTCTCCAGG + Intronic
1132506283 16:310904-310926 CCGTGGGGCACTGGTTGTCCTGG - Intronic
1132537880 16:492365-492387 CTGGGCGGCCTCGGGTCTCCCGG - Intronic
1132537893 16:492396-492418 CTGGGCGGCCTCGGGTCTCCCGG - Intronic
1132537908 16:492427-492449 CTGGGCGGCCTCGGGTCTCCCGG - Intronic
1132537937 16:492489-492511 CTGGGCGGCCTCGGGTCTCCCGG - Intronic
1132684824 16:1157945-1157967 ACGGGCAGCCCAGGGTCTCCGGG - Intronic
1132747957 16:1444784-1444806 CCGGGGTGTCCTGGGGCTCTCGG - Intergenic
1132937317 16:2487760-2487782 CCGGGGTGGCCTGTGTCTCCAGG + Intronic
1133017541 16:2951258-2951280 CCCGGGGGGCCAGGGGCTCCCGG - Intergenic
1133028463 16:2998646-2998668 CTGGGGGGACCTGGGGATCCAGG - Intergenic
1133050347 16:3113919-3113941 TGTGGGGGACCTGGGTCTCCGGG + Intronic
1133192916 16:4147554-4147576 CCTGGGGGGCCTCGCTCTCCTGG - Intergenic
1133729891 16:8569928-8569950 CCGGGAGGCGCTGTGTCTCTTGG - Exonic
1134132177 16:11657364-11657386 CCTTGGGGACCTGGGGCTCCTGG - Intergenic
1134446468 16:14335062-14335084 TGGGGAGTCCCTGGGTCTCCTGG + Intergenic
1136382333 16:29901359-29901381 CCAGGGGGTCCTGGGGATCCCGG + Exonic
1136609142 16:31355767-31355789 CCCGGGGTGCCTGGGTCTTCTGG - Intronic
1137013103 16:35344167-35344189 CCCGGCTGCACTGGGTCTCCTGG + Intergenic
1137044333 16:35642012-35642034 CCACGGGGCCCTGGCTCTCCTGG - Intergenic
1139719867 16:68843744-68843766 CCGGGCGGCCCTGAGAGTCCCGG - Intronic
1139965328 16:70742110-70742132 CCTGGGAGGCCTGGGTGTCCTGG + Intronic
1140040435 16:71403893-71403915 CCAGGCGGCCCTGGGAGTCCTGG + Intergenic
1140528858 16:75647393-75647415 CCGGCGTGCCCGGGGTATCCCGG + Intronic
1141653129 16:85404149-85404171 CCGGGGGGCCCTGAGTGTAACGG - Intergenic
1141654017 16:85407685-85407707 CCGGGGGGCCCTGAGTGTAACGG - Intergenic
1141654027 16:85407718-85407740 CCGGGGGGCCCTGAGTGTAACGG - Intergenic
1141654349 16:85409062-85409084 CCGGGGGGCCCTGAGTGTAACGG - Intergenic
1141654385 16:85409195-85409217 CCGGGGGGCCCTGAGTGTAACGG - Intergenic
1141654503 16:85409659-85409681 CCGGGGGGCCCTGAGTGTAACGG - Intergenic
1141654545 16:85409824-85409846 CCGGGGGGCCCTGAGTGTAACGG - Intergenic
1141654924 16:85411392-85411414 CCGGGGGGCCCTGAGTGTAACGG - Intergenic
1141674547 16:85510723-85510745 GCGGGGGGCTCTGGGGTTCCAGG - Intergenic
1141687670 16:85579553-85579575 CCTGCTGGCCCTGGATCTCCAGG - Intergenic
1141711083 16:85699319-85699341 CCAGGGGGCGCTGGGTGTCAGGG - Intronic
1142191443 16:88720035-88720057 CGTGGGGGCGCTCGGTCTCCAGG - Intronic
1142192752 16:88725434-88725456 CCTTGGGGCCCAGGGTGTCCTGG + Exonic
1142247994 16:88978536-88978558 CCTGGGGGCCCTGACCCTCCTGG + Intergenic
1142335918 16:89489888-89489910 CCGGGCGGGCCTGGGTGGCCGGG - Intronic
1142345819 16:89553473-89553495 CCCGGGGGCCCCTGGGCTCCAGG + Intronic
1143487246 17:7261716-7261738 GCTGGGGGCCCTGGGTTGCCGGG - Intronic
1143509422 17:7387266-7387288 ACCCTGGGCCCTGGGTCTCCTGG + Intronic
1145078523 17:19875277-19875299 CCTGGTGGCCCTCTGTCTCCTGG - Intergenic
1145980230 17:29006681-29006703 CCACGTAGCCCTGGGTCTCCAGG + Intronic
1148075509 17:44933224-44933246 CCAGGGAGCCCTGGCTCTCCTGG - Intronic
1148081009 17:44967777-44967799 CCGGGAGGACCTGGGTCCCCGGG + Exonic
1148152661 17:45405506-45405528 CCTGGGGTCCCTGGGTCTGTGGG + Intronic
1148796363 17:50199254-50199276 CCGGGGGGTCCGGGGGGTCCGGG + Exonic
1151953087 17:77366012-77366034 CCCTGGGGCCCTTGGTGTCCTGG - Intronic
1152312375 17:79559020-79559042 CCAGGGCTCCCAGGGTCTCCTGG - Intergenic
1152403516 17:80083358-80083380 CCTGGGGACATTGGGTCTCCTGG + Intronic
1152616825 17:81341714-81341736 CCGGCGGTGCCCGGGTCTCCGGG + Intergenic
1152627136 17:81393069-81393091 CCGTGGGGCCCAGTCTCTCCTGG - Intergenic
1152853217 17:82649268-82649290 CCTGGGGGCACTGTGTGTCCTGG - Intergenic
1153643065 18:7172279-7172301 CCTGGTAGCCCTGTGTCTCCAGG - Intergenic
1154202385 18:12308391-12308413 CTGGCGGGCCCCGGGTCTCCCGG + Intronic
1157397680 18:47356197-47356219 TCGGTGAGCTCTGGGTCTCCAGG + Intergenic
1158876878 18:61742634-61742656 GTGCTGGGCCCTGGGTCTCCTGG - Intergenic
1160024494 18:75207093-75207115 CCGGGCTGCGCTGGGTCTCCTGG - Intronic
1160156923 18:76441583-76441605 CCGGCGGGCGCGGGGTCCCCAGG + Exonic
1160223845 18:76997370-76997392 CCCTGGGGCCCTGGGGCTTCTGG + Intronic
1160426745 18:78783116-78783138 CTGGGGAGCCCCGGGTGTCCAGG + Intergenic
1160682186 19:416954-416976 CCTGGGAGCCCTGACTCTCCGGG + Exonic
1160865753 19:1255231-1255253 CCGGGGGGCCGCGGGTCACCAGG + Intronic
1160875262 19:1293858-1293880 CCGGGGGTTCCTGGGTCTCCAGG - Intronic
1160908823 19:1465524-1465546 CCGGCGGGCCCTGCTTCTCCAGG - Exonic
1160983236 19:1826324-1826346 CCCTGGACCCCTGGGTCTCCTGG - Intronic
1161148755 19:2695562-2695584 CCCGGTGCCCCTGGGTTTCCTGG - Intronic
1161261595 19:3340785-3340807 CCCATGGGCCCTGGGGCTCCAGG - Intergenic
1161284844 19:3463746-3463768 TCGGGGAGCTCTGGGTGTCCGGG - Intronic
1161473564 19:4472899-4472921 TCTGGGGGCCCTGGGCCTCAGGG + Intronic
1162079189 19:8208812-8208834 CCGGGGCGCCCTGAGCCTCTGGG - Intronic
1162321025 19:9970629-9970651 CCGGGGGGCCCGGGGGCGCCGGG + Exonic
1162321185 19:9971221-9971243 CCTGGGGGCCCTAGATCTCCGGG + Exonic
1162324629 19:9991813-9991835 CCCGGAGGGCCTGGTTCTCCTGG + Exonic
1162410653 19:10503141-10503163 CCGGGGCGCGCAGGGGCTCCGGG + Intronic
1162733797 19:12734600-12734622 CCGCGGGGCCCGGAGCCTCCCGG + Exonic
1162932187 19:13962754-13962776 CCGGCGGCTCCAGGGTCTCCGGG + Exonic
1163223261 19:15936993-15937015 GAGGGGAGCCCTGGGTCTGCTGG - Intergenic
1163448281 19:17360553-17360575 CAGGGGGCCTCTGGGACTCCAGG + Exonic
1163551678 19:17969072-17969094 CCAGGGGCTCCTGGGTCTCTGGG + Intronic
1163597079 19:18226400-18226422 CGGGGGGGCCCTGCATCGCCAGG + Intronic
1163755999 19:19106417-19106439 CCCGGGGGCTCTGTGTCTCGGGG + Intronic
1165253562 19:34559134-34559156 CCGGGCAGCTCTGGGTCACCAGG + Intergenic
1165460231 19:35939941-35939963 CTGGGAGGCCCTGGGCCGCCTGG + Exonic
1165745734 19:38228862-38228884 CGGGAGCGCCCTCGGTCTCCGGG - Intronic
1166196006 19:41206359-41206381 CCGGCGGGCACGGGCTCTCCAGG - Exonic
1166765597 19:45251151-45251173 CCGGGGGCTCCGGGGGCTCCGGG - Intronic
1166895440 19:46019372-46019394 CCGGGCAGCCCAGGGTCTACTGG - Exonic
1166983902 19:46648766-46648788 CCTGGGGCCCCTGGGACGCCGGG - Exonic
1167246054 19:48373809-48373831 CCGGGAGGCCCTGGGGAGCCAGG - Intronic
1167249759 19:48393614-48393636 AGGGGGGGCTGTGGGTCTCCCGG + Intergenic
1167708692 19:51097555-51097577 CCAGGGGGCGCCGGGTCTCAGGG - Intergenic
1168073109 19:53963469-53963491 CCGGGAGGCTCAGGGTCTCTCGG - Intronic
1168336282 19:55599408-55599430 CGGGGCCGCCCCGGGTCTCCAGG - Intronic
1168494900 19:56840120-56840142 CTCGGGAGCCCTGGGCCTCCTGG - Intronic
1202709034 1_KI270714v1_random:6428-6450 CAGGGTGACCCTGGGCCTCCAGG - Intergenic
1202710956 1_KI270714v1_random:19161-19183 CAGGCGGGCCCAGGGTGTCCAGG + Intergenic
926146769 2:10401124-10401146 CCTGCTGGCCCCGGGTCTCCAGG + Intronic
927210191 2:20634440-20634462 CAGGGGAGCCCTGGGTGCCCAGG + Intronic
927491778 2:23525751-23525773 CGGGTGGGCCCTGGCTCTGCTGG - Intronic
927809491 2:26173480-26173502 CGGGTGGGCCCCGCGTCTCCCGG - Intronic
927886850 2:26724097-26724119 CCAGGGGGCCCTGGAGCTTCTGG - Intronic
928312157 2:30220103-30220125 CCGAGGGGCCCTGCCTCTCTGGG + Intergenic
928443321 2:31311697-31311719 CCTGTGGGCTCTGAGTCTCCTGG - Intergenic
931515869 2:63050525-63050547 GGAGGGGGCCGTGGGTCTCCAGG - Intronic
932346904 2:71001580-71001602 AGGGAGGGCCCTGGGCCTCCAGG - Intergenic
933810747 2:86031419-86031441 CCTCGGGCCCCTGGGGCTCCTGG + Exonic
933858642 2:86442163-86442185 CCGAGTGGCCCTGGCTCTCCGGG + Exonic
933985148 2:87584544-87584566 CCGGGGTGATCAGGGTCTCCCGG + Intergenic
934466223 2:94265489-94265511 CCTGGGGCTCCTGGGGCTCCTGG - Intergenic
934678259 2:96265350-96265372 CCGGGCAGCCCTGCGCCTCCGGG + Exonic
935563584 2:104583926-104583948 CCGGGTGTCCCAGGGGCTCCTGG + Intergenic
936308694 2:111366267-111366289 CCGGGGTGATCAGGGTCTCCCGG - Intergenic
938079140 2:128360031-128360053 CCGTGGGACCCTGAGTGTCCAGG + Intergenic
938310041 2:130283934-130283956 CCAGGGGGGTCAGGGTCTCCAGG - Intergenic
938444878 2:131368435-131368457 CCAGGGGGGTCAGGGTCTCCAGG + Intergenic
943523468 2:188985707-188985729 CCAGGGGACCCTGGTTGTCCTGG - Exonic
943523471 2:188985716-188985738 CCAGGGTCCCCTGGTTCTCCTGG + Exonic
943523642 2:188988596-188988618 CCAGGGGGTCCTTGGTATCCTGG - Exonic
944440410 2:199737647-199737669 CCTGGGGCCACTGTGTCTCCTGG + Intergenic
946168530 2:217879841-217879863 CCTGGGGCCCCTGGGTCCCATGG - Intronic
946413214 2:219526032-219526054 GGGGAGGGCCCTGGGCCTCCAGG - Intronic
947145146 2:227057447-227057469 CCGGGACTCCCTGGGTATCCAGG - Exonic
947149344 2:227098771-227098793 CCAGGGAACCCTGGGTCCCCTGG + Exonic
947167038 2:227273087-227273109 CCGGGTGGTCCGGGGGCTCCAGG - Exonic
947167385 2:227276429-227276451 CCAGGGGGCCCTGGAGGTCCTGG - Exonic
947167868 2:227280916-227280938 CCTGGGGGTCCTTGTTCTCCAGG - Exonic
947170284 2:227304060-227304082 CCAGGTGGCCCTGGGCTTCCTGG - Exonic
947670992 2:231935191-231935213 CAGGGCAGCCCTGTGTCTCCTGG + Intergenic
947748880 2:232522794-232522816 CAGGGGGCTCCTGGGGCTCCTGG - Exonic
947878105 2:233480941-233480963 CCGGGGGGCCATGGATCTGCGGG + Intronic
948449494 2:238060575-238060597 CCGCGCGGCCCCGGCTCTCCCGG + Intronic
948468339 2:238162745-238162767 CCAGGGCCCCCTGGGCCTCCCGG + Exonic
948595874 2:239078961-239078983 ACAGTGGGCCCTGGGTCCCCCGG + Intronic
948639979 2:239369372-239369394 CTGGGGAGCCCTGTGGCTCCCGG - Intronic
948648619 2:239424866-239424888 CGGGGGAGCCCTTGGTGTCCAGG - Intergenic
948710099 2:239820016-239820038 CAGGGGTGCCCAGGGTCTGCAGG + Intergenic
948912385 2:241011073-241011095 CCTGGGTCTCCTGGGTCTCCTGG + Intronic
948912420 2:241011172-241011194 CCTGGGTCTCCTGGGTCTCCTGG + Intronic
948912433 2:241011208-241011230 CCTGGGTCTCCTGGGTCTCCTGG + Intronic
948939069 2:241187311-241187333 CCTTGGGGCCCTGGGCCTCAGGG - Intergenic
948983891 2:241508521-241508543 CTGGGAGGCCCGGGGTCCCCGGG - Exonic
949000354 2:241609873-241609895 CCACGGGGCTCTGGCTCTCCTGG + Intronic
949073168 2:242039015-242039037 CTGTGGGTCACTGGGTCTCCTGG - Intergenic
1168951210 20:1803412-1803434 CCGGGGCGCCCGGGGCCTCGGGG - Intergenic
1170567636 20:17615867-17615889 CCCCTGGGCCCTGAGTCTCCAGG - Intronic
1171183982 20:23111798-23111820 CCTAGTGGCCCTGGGTCTCAGGG - Intergenic
1171439407 20:25148431-25148453 CCGGCTGGCCCTGGGTGTCTGGG + Intergenic
1172269853 20:33648559-33648581 CTGGGGGGCCCTGCAGCTCCAGG + Exonic
1172719028 20:36985169-36985191 CCGGGAGGCCTTTTGTCTCCTGG - Intergenic
1173803928 20:45911902-45911924 CCGTGGGCTCCCGGGTCTCCCGG + Exonic
1173926394 20:46784458-46784480 CCAGGGGTCCTTGGGTCTCCCGG - Intergenic
1174402886 20:50285395-50285417 CCACGGGGTCCTGGGACTCCTGG + Intergenic
1174796221 20:53524843-53524865 CCGGAGGCCACTGGGTCTCTTGG - Intergenic
1175264855 20:57696303-57696325 CTGGGCGCCCCTGGGGCTCCAGG + Intronic
1175404471 20:58717448-58717470 CAGGTGGGCCCTGGGATTCCAGG - Intronic
1175753483 20:61514922-61514944 CAGGTGTGCCCTGGGCCTCCAGG - Intronic
1175765675 20:61590881-61590903 GGGGGGGTCCCCGGGTCTCCAGG + Intronic
1175895040 20:62332437-62332459 CCAGGTGGTCCTGGGTATCCCGG + Exonic
1175945763 20:62558016-62558038 CCGGAGGCCCCTGGGTGCCCAGG + Intronic
1175997329 20:62817588-62817610 CCGGGCGGCCCTGGGGGGCCGGG - Exonic
1175999165 20:62824463-62824485 CCAGGGGGCCCTGGGGGACCTGG - Exonic
1176002814 20:62840589-62840611 CCGGGAGGCCCAGGCTCGCCGGG - Exonic
1176135510 20:63520537-63520559 CCGGCCGGTCCTGGGTCTGCAGG - Intergenic
1176265718 20:64208318-64208340 CCGGGGAAACCTGGGCCTCCTGG + Exonic
1176376932 21:6091480-6091502 GTGGGGGGCGCTGTGTCTCCAGG + Intergenic
1176427987 21:6560500-6560522 CCTGGGCACCCTGGGGCTCCCGG - Intergenic
1179154128 21:38835069-38835091 CTGGGGGTCCCTGGGCATCCTGG + Intergenic
1179478983 21:41665940-41665962 CCATGGGGTCCTGGGTGTCCTGG + Intergenic
1179596220 21:42444737-42444759 CCTGGTGGCCCTGGGTCAGCCGG - Intronic
1179703478 21:43168817-43168839 CCTGGGCACCCTGGGGCTCCCGG - Intergenic
1179746543 21:43446764-43446786 GTGGGGGGCGCTGTGTCTCCAGG - Intergenic
1179809343 21:43860551-43860573 CCGAGGGCCCCTGGCTCTCCCGG + Intergenic
1179843161 21:44090638-44090660 CCGGGAGGCCCACGGTGTCCAGG + Intronic
1179985961 21:44920483-44920505 CTGGGGGGTCCTGGTGCTCCGGG - Intronic
1180083288 21:45496515-45496537 CCTGGGGGCCCTGGAGGTCCTGG - Exonic
1180098968 21:45575465-45575487 CCGGCTGGCCCTGTGTGTCCTGG + Intergenic
1180155896 21:45977334-45977356 CTGGGGGGATCTGAGTCTCCAGG - Intergenic
1180159347 21:45992170-45992192 CCGGGGGGCCCAGGCTCTCCCGG - Exonic
1180594080 22:16962358-16962380 CCTGTGGGCCTTGGGTCCCCGGG + Exonic
1180790371 22:18572472-18572494 ATGGGGGCCCCTGGGACTCCTGG - Intergenic
1180914001 22:19472612-19472634 CCCGGGGGCCCAGTGTCTCCTGG - Intronic
1181231367 22:21422843-21422865 ATGGGGGCCCCTGGGACTCCTGG + Intronic
1181247284 22:21512025-21512047 ATGGGGGCCCCTGGGACTCCTGG - Intergenic
1181313791 22:21959502-21959524 ACGTGGGGACCTGGGTCCCCAGG + Intronic
1181486489 22:23234858-23234880 CCGGGTGGCCCTTGGTGTCTGGG - Intronic
1181704986 22:24644544-24644566 CAGTGGGGCCCTGGGTCCCAGGG + Intergenic
1182068387 22:27446042-27446064 CAAGGAGGCCCTGGGTGTCCGGG + Intergenic
1182117981 22:27768323-27768345 CCCTGGGGGCCTGGTTCTCCAGG - Intronic
1182554753 22:31123127-31123149 GCGGGGGGCACTGGGTCTCAGGG - Intronic
1182816178 22:33166194-33166216 CCAGGTGGCCCTAGGTATCCTGG - Intronic
1182838366 22:33363150-33363172 CAGGGGGACCCTGCCTCTCCTGG - Intronic
1183117698 22:35704418-35704440 GGGTGGGGCCCTGGGTCTCTTGG + Intergenic
1183477211 22:38042294-38042316 CCAGGGCACCCTGGGCCTCCCGG - Intergenic
1183477212 22:38042294-38042316 CCGGGAGGCCCAGGGTGCCCTGG + Intergenic
1183521398 22:38297964-38297986 CTGGGGGGCTCTGGGTGCCCAGG + Intronic
1183524462 22:38315334-38315356 CCGGGGTTCCCTGTCTCTCCTGG - Intronic
1183619497 22:38964423-38964445 CCTGGGAGCCCTGGGGGTCCTGG + Intronic
1184240027 22:43207097-43207119 CCAGGCGGCCCTGCCTCTCCAGG + Intronic
1184386889 22:44181651-44181673 ACGGCGGGCGCTGGGGCTCCGGG + Intronic
1184392422 22:44212102-44212124 CCTGGGGGCCCTGGGTGCCTGGG + Intronic
1184636521 22:45836511-45836533 CCAGGGAGCCCTGGGCTTCCTGG - Intronic
1184698113 22:46150774-46150796 GCGCGGGGCCCGGGGTCTCGGGG + Intronic
1184698116 22:46150782-46150804 CCCGGGGTCTCGGGGTCTCCGGG + Intronic
1184899900 22:47439427-47439449 CTGGGGGTGCCTGGGACTCCTGG - Intergenic
1184993202 22:48184345-48184367 CTGTGGGGCCCTGGGTCCACTGG - Intergenic
1185171126 22:49295240-49295262 CCGGGGGGCCCTGGAACCCTCGG + Intergenic
952945068 3:38473541-38473563 GGGGAGGCCCCTGGGTCTCCAGG + Intronic
954132231 3:48566676-48566698 CCTGGGGTCCCTGGAGCTCCTGG - Exonic
954133410 3:48571117-48571139 CCGGGCTCCCCTGGGCCTCCTGG - Exonic
954134300 3:48575080-48575102 CCGGGGGGCCCAGGGGTTCCAGG + Exonic
954575985 3:51676466-51676488 GGGGTGGGCCCTGGGTCTCCAGG + Intronic
954646276 3:52133562-52133584 CAGTGTAGCCCTGGGTCTCCTGG - Intronic
955769312 3:62372829-62372851 CCGGGGGCACCATGGTCTCCAGG + Exonic
955911477 3:63863606-63863628 CCGGGGAGGCCCGGGGCTCCGGG + Intronic
955911511 3:63863697-63863719 CCGGGAGGCCAGGGGTCTCAGGG + Intronic
956892184 3:73624041-73624063 GGGCGGGGCCCTGGGTCCCCAGG + Intronic
958892121 3:99794738-99794760 CCAGGGGGCCCTGGGGCCCAGGG - Exonic
958892366 3:99795462-99795484 CCAGGGGGCCCTGGGAGGCCCGG - Exonic
959398268 3:105868667-105868689 CCCGGGGGCCCGGGGTAGCCAGG - Intronic
961336052 3:126180379-126180401 CCGGGGGCTCCAGGGGCTCCAGG - Intronic
961336056 3:126180388-126180410 CCGGGGGCTCCGGGGGCTCCAGG - Intronic
961772580 3:129260821-129260843 TCTGGGGGCCGTGGGTGTCCTGG - Intronic
964483395 3:157163570-157163592 CCTGGGGTCCCTGCTTCTCCAGG + Intergenic
964706549 3:159624755-159624777 CCTTGGGGCCCTGGATCTCTGGG - Intronic
966748940 3:183303819-183303841 CCTGGGCGCCCAGGGTCTTCAGG + Intronic
968509036 4:987343-987365 CTCTGGGGCCCTGGCTCTCCCGG + Intronic
968599849 4:1503729-1503751 CGGGGGAGCCCGGGGTGTCCGGG - Intergenic
968621578 4:1605648-1605670 GCAGGGAGCCCTGGGTCTCTGGG - Intergenic
968872440 4:3248690-3248712 CCTGGGGCTCCTGGGTGTCCTGG - Exonic
968978367 4:3833661-3833683 CCTGGTGGCCCTGGGTGGCCTGG + Intergenic
969318472 4:6396017-6396039 CCAGTGGGACCTGGGTCACCGGG + Intronic
969488445 4:7485462-7485484 GCAGGGGGCCCTGGGGCTCCAGG - Intronic
969538048 4:7768807-7768829 CCGGGGGTGTCTGGGTGTCCTGG - Intronic
970373798 4:15435861-15435883 CCAGGGGGCCCTGGAGGTCCAGG - Exonic
970720867 4:18987358-18987380 ACTTGGGGCCATGGGTCTCCAGG - Intergenic
976338532 4:83919049-83919071 CCTGATGGCCCTGAGTCTCCTGG + Intergenic
977607364 4:98996034-98996056 CCTGGGGTCCCTGGGTCCTCGGG + Intronic
981747313 4:148064030-148064052 CCGGCTGGCCGTGTGTCTCCAGG + Intronic
982209582 4:153023561-153023583 CTGAGGGGCCCAGGGTCTTCAGG - Intergenic
985574975 5:669789-669811 CGGGGGGCACCCGGGTCTCCTGG - Intronic
986017057 5:3766465-3766487 CCTGGAGGCCCTGAGTCTGCAGG + Intergenic
988717280 5:33840732-33840754 CAGGGTGGCCCTGGGGATCCAGG - Intronic
988935115 5:36074026-36074048 CCGGGGTGTTGTGGGTCTCCTGG - Intergenic
993020377 5:82584531-82584553 CCGGGCTGCCCTGACTCTCCAGG + Intergenic
993170358 5:84411729-84411751 CCAGGGGGGCCTGGAACTCCTGG + Intergenic
993386504 5:87268393-87268415 CTGGTGGCCCCTGGGGCTCCCGG + Exonic
995526019 5:113051184-113051206 CCGTGGGGCCCTGAGGATCCTGG - Intronic
1000351278 5:160354848-160354870 CCTGAGGGCCCTGGGGCTCCTGG + Exonic
1002302158 5:178263269-178263291 CCGGGGCCCCCTGGACCTCCTGG - Exonic
1002523475 5:179803753-179803775 CCGTGGGGCCCTTTATCTCCTGG - Intronic
1002782801 6:380006-380028 CAGGGTGGCCCTGGGGATCCGGG - Intergenic
1004035748 6:11921114-11921136 CCCAAGGGCCCTGGGTGTCCTGG + Intergenic
1005355743 6:24981573-24981595 TCAGTGGGCCCAGGGTCTCCTGG + Intronic
1005989935 6:30896519-30896541 CCGGAGGGCCCTGTGTCTCCCGG - Intronic
1006052761 6:31356610-31356632 CCGGGTCGCCCCGAGTCTCCGGG - Intronic
1006082568 6:31575803-31575825 CAGGGGGGCCCCAGGGCTCCAGG + Exonic
1006295672 6:33168971-33168993 CCAGGGGGGCCAGGGTCACCAGG + Exonic
1006295781 6:33169426-33169448 CCTGGTGGCCCTGGCTCTCCTGG + Exonic
1006425858 6:33962648-33962670 CGGGGGTGCCCTGGGTTTCCTGG + Intergenic
1006677744 6:35776525-35776547 CCGGGGTGGCCTGGGGCGCCGGG + Intergenic
1007400322 6:41599310-41599332 CCAGGGGGCCCTGGGTTTGAGGG - Exonic
1008853896 6:56057784-56057806 CCAGGGAGACCTGGGTCTCCTGG + Exonic
1009924368 6:70102193-70102215 CCTGGGGGTCCTGGTTTTCCGGG - Exonic
1009927863 6:70142029-70142051 CCAGGGGGTCCGGGATCTCCAGG - Exonic
1009930203 6:70168186-70168208 CCGGGTGGCCCTGGGTAACTGGG - Exonic
1009931349 6:70180318-70180340 CCTGGAGGCCCTGGGGCACCAGG - Exonic
1009933092 6:70199715-70199737 CCTTGGGGTCCAGGGTCTCCTGG - Exonic
1013980123 6:116120575-116120597 CCAGGGCCCCCTGGGCCTCCAGG - Exonic
1015440383 6:133241090-133241112 CCTCGGGGCCCTGGATGTCCCGG - Intronic
1015488582 6:133799963-133799985 TAGGAGGGTCCTGGGTCTCCAGG - Intergenic
1016936229 6:149451066-149451088 CCGGGGAGAACTGGCTCTCCGGG + Exonic
1019074857 6:169379094-169379116 CCGCGGGGACCTGGGCCTGCTGG - Intergenic
1019088428 6:169502702-169502724 CACTGGGGCCCTGGGTCACCCGG + Intronic
1019125743 6:169839226-169839248 CAGGCGGGCTCTGGGACTCCGGG - Intergenic
1019267545 7:126948-126970 CTGGGGGGACAAGGGTCTCCAGG - Intergenic
1019379113 7:712210-712232 GCGGGGGGCGCGGGGTCTCTGGG - Intronic
1019424026 7:964726-964748 CTGGGGGGCTCTGGGCCTCCAGG + Intronic
1019457503 7:1138122-1138144 CCCCGGGGCTCTGGGTCTCCTGG + Exonic
1019553982 7:1619620-1619642 GAGCGGGGCCCTGGGCCTCCGGG + Intergenic
1019573797 7:1726527-1726549 CCCGGGGTCCCTGGATCCCCTGG + Intronic
1019711748 7:2521130-2521152 TCAGAAGGCCCTGGGTCTCCGGG - Intronic
1020119493 7:5495181-5495203 GAGGGGGCACCTGGGTCTCCTGG + Intronic
1020274507 7:6616040-6616062 CGGGGTGGCCCTGCGCCTCCTGG + Exonic
1021373205 7:19876188-19876210 CCTGGAAGCTCTGGGTCTCCTGG + Intergenic
1021604261 7:22394526-22394548 CCTGGGTGCCCTGGGTCCCTGGG - Intergenic
1022351058 7:29566305-29566327 CCGGAGGGCCTAGGGGCTCCCGG - Exonic
1023797779 7:43808145-43808167 CAGGAGGGCCTTGTGTCTCCAGG + Intergenic
1024200841 7:47104118-47104140 CCGGGGTGCCCTGGGGATCAGGG + Intergenic
1024957053 7:54933311-54933333 CCGTGGGGCTCAGGGTTTCCGGG + Intergenic
1025034813 7:55587504-55587526 CTGGGGAGCCCAGGGCCTCCAGG - Intergenic
1025035969 7:55592663-55592685 CCTGGGGGGCCAGGGTCTCCAGG - Intergenic
1025807639 7:64850095-64850117 CCGGTGGGCTCTGAGTCTTCTGG - Intergenic
1026205122 7:68250515-68250537 CCGGGGGGCCCTGGGAGCCTTGG + Intergenic
1026795719 7:73364669-73364691 CTAGGGGGCCCTGAGCCTCCGGG + Intergenic
1027266306 7:76496944-76496966 CAGGAGGGCCCAGGGCCTCCTGG + Intronic
1027317686 7:76995062-76995084 CAGGAGGGCCCAGGGCCTCCTGG + Intergenic
1028599873 7:92590130-92590152 GCGGAGGGTGCTGGGTCTCCAGG + Intronic
1029981920 7:104886914-104886936 CCGGGGTCCCCGGGGTCCCCAGG + Intronic
1032500812 7:132398443-132398465 CAGGAGGGCCCTGGGTGTGCGGG + Intronic
1033549521 7:142433976-142433998 CTGGGCGGCCCTCTGTCTCCTGG + Intergenic
1033560892 7:142529310-142529332 CTGGATGGCCCTGTGTCTCCTGG + Intergenic
1034274137 7:149816719-149816741 CCCGGGGTCCCTGGTTCCCCGGG + Intergenic
1034338604 7:150338705-150338727 CCCTGAGGCACTGGGTCTCCTGG + Exonic
1034467318 7:151237736-151237758 CCGGCGGGCCCTGGCTCGCAGGG + Exonic
1034497636 7:151431945-151431967 CAGGGGGTCCCTGGGAGTCCGGG + Intronic
1035022992 7:155809795-155809817 CCGCTGGGCCCTGCGTCCCCCGG + Intronic
1035249292 7:157586614-157586636 AGCGGGGGCCCTGAGTCTCCAGG - Intronic
1035249302 7:157586655-157586677 GCAGGGGGCCCTGAGTCTCCAGG - Intronic
1038204978 8:25457940-25457962 CCCGGGGGCTCCGGGTCTCCCGG - Intronic
1038753252 8:30316427-30316449 CCAGAAGGCCCTGGGTCTCCAGG - Intergenic
1040423361 8:47260801-47260823 CCGGGAGGCCCTGGAGCGCCGGG + Exonic
1041244969 8:55880561-55880583 CCTCTGGACCCTGGGTCTCCTGG + Intronic
1042484658 8:69336872-69336894 CTGTGGGTCACTGGGTCTCCTGG - Intergenic
1044523926 8:93230172-93230194 CCGGTGGCTCCTAGGTCTCCGGG - Intergenic
1045651120 8:104342545-104342567 CCAGTGGGCCATGGGTCTCTGGG - Intronic
1045734859 8:105283101-105283123 CCCAGGGGCCCTAGGTCCCCAGG + Intronic
1046984176 8:120369359-120369381 CCTGGGCCCCCTGGCTCTCCTGG + Exonic
1047547962 8:125838592-125838614 CCTGGGGGCCATGGATCTCTGGG + Intergenic
1048844515 8:138594115-138594137 CCAGGGGGCCCTGGGGGCCCAGG + Exonic
1048854700 8:138676598-138676620 CCTGGGATCCCTGGTTCTCCTGG - Exonic
1048861200 8:138725403-138725425 CCAGGGGGGCCTGGGACACCAGG + Exonic
1048861355 8:138726566-138726588 CCAGGGGGTCCTGGGACACCAGG + Intronic
1049426115 8:142538609-142538631 TCCAGGGGCCCTGGGGCTCCAGG - Intronic
1049594950 8:143479024-143479046 CCGGGAGGCCCTGGGCTCCCAGG - Intronic
1049594951 8:143479024-143479046 CCTGGGAGCCCAGGGCCTCCCGG + Intronic
1049780669 8:144427360-144427382 TCATGGAGCCCTGGGTCTCCAGG - Intronic
1049849166 8:144821560-144821582 CCGAGGGGCCCTGGAGCTGCCGG - Intergenic
1050244733 9:3676819-3676841 CCAGGGAGTCCTGTGTCTCCAGG - Intergenic
1051170736 9:14315879-14315901 CCGGGGGGCGCTGGGGCTACCGG + Intronic
1053696272 9:40642261-40642283 CCTGGGGCTCCTGGGGCTCCTGG - Intergenic
1054307519 9:63441480-63441502 CCTGGGGCTCCTGGGGCTCCTGG - Intergenic
1054307523 9:63441489-63441511 CCTGGGGCTCCTGGGGCTCCTGG - Intergenic
1054406251 9:64765491-64765513 CCTGGGGCTCCTGGGGCTCCTGG - Intergenic
1054439878 9:65250964-65250986 CCTGGGGCTCCTGGGGCTCCTGG - Intergenic
1054490528 9:65770975-65770997 CCTGGGGCTCCTGGGGCTCCTGG + Intergenic
1055501458 9:76906226-76906248 CCGGCGCGCCCCGGGGCTCCTGG - Intergenic
1057046353 9:91889283-91889305 GCCTGGGGCCCTGGGACTCCTGG - Intronic
1057187028 9:93062705-93062727 AGGGGTGGCCCTGGGTCCCCTGG + Intronic
1057529395 9:95830962-95830984 CCTGGGGCCGCTGGGTCACCAGG + Intergenic
1057619019 9:96619124-96619146 CCGGGCTGCCCGGGGCCTCCGGG - Intronic
1057911724 9:99024880-99024902 CCAGGTGGCCCTGGGGGTCCTGG - Exonic
1057913060 9:99035101-99035123 CCTGGGGGCCCAGGGGGTCCAGG - Exonic
1057916526 9:99059918-99059940 CCGGGAAGCCCTGGCTGTCCTGG - Exonic
1059436896 9:114282499-114282521 CCAGGGGGTCCAGGGTCTCCAGG - Exonic
1059449624 9:114362338-114362360 CCTGGGGTCCCTCAGTCTCCAGG - Intronic
1060152923 9:121300014-121300036 CCGGGGGGCCCCGGGGCTCCCGG + Intronic
1060485875 9:124045814-124045836 CCGGGGTTCCCTGCGTGTCCCGG + Intergenic
1060530862 9:124346438-124346460 CCGAGGGGCCCTGGGATACCTGG - Intronic
1061001681 9:127906162-127906184 CCCGGGGGCTCTGGGTGACCCGG - Intergenic
1061078739 9:128357354-128357376 CCTGTGGCTCCTGGGTCTCCTGG - Intronic
1061438080 9:130579410-130579432 CCAGGCAGCCGTGGGTCTCCAGG - Intronic
1061536298 9:131252340-131252362 TGAGGGGGGCCTGGGTCTCCGGG - Intergenic
1061538757 9:131266062-131266084 ACGGGGAGGCCTGTGTCTCCGGG + Intronic
1061557767 9:131382458-131382480 CAGGGGTTCCCTGGGACTCCTGG - Intergenic
1061651275 9:132052144-132052166 CCAGCAGGCCCTGGGTCTCCTGG + Intronic
1061680944 9:132242146-132242168 CCGGGGGTCCCGGGGTCCCGGGG + Exonic
1062049394 9:134439282-134439304 CCGGGGTGCCCTGGGTCCCCAGG - Intronic
1062117141 9:134815591-134815613 CCGGGGGGGCCAGGATCTCCAGG - Exonic
1062165324 9:135104746-135104768 CTGGGGGGCCCTGGGCTTCGGGG - Intronic
1062268028 9:135696247-135696269 CCCTGGGTCCCTGGGTCTGCTGG - Intronic
1062274328 9:135723654-135723676 GAAGGGGGCCCTGGCTCTCCTGG + Intronic
1062333186 9:136053469-136053491 CAGCTGGGCCCTGTGTCTCCTGG - Intronic
1062416508 9:136453837-136453859 CATGGTGGCCATGGGTCTCCTGG - Intronic
1062491717 9:136808095-136808117 CCGGGGGGGCCGGGGCCGCCGGG + Exonic
1062560606 9:137139972-137139994 CAGAGGGCCCCTGGGGCTCCAGG + Intronic
1062573395 9:137195640-137195662 GCGGACGGCCCTGGGTGTCCAGG + Intronic
1062590232 9:137271255-137271277 CCTCGGGGGCCTGGGTCTCCTGG + Intronic
1062613880 9:137387364-137387386 CTGGGGAGCCCTGAGTCTCTCGG + Intronic
1202778720 9_KI270717v1_random:15922-15944 CCTGGGGCTCCTGGGGCTCCTGG - Intergenic
1203783739 EBV:115617-115639 CCGGGGGGCCCAGGATCTATAGG + Intergenic
1186440142 X:9578958-9578980 CCAAAGGCCCCTGGGTCTCCAGG - Intronic
1192126902 X:68509620-68509642 CCATGTGTCCCTGGGTCTCCTGG + Intronic
1192510478 X:71718045-71718067 CTGTGGGCCCCTGGGGCTCCGGG + Exonic
1192516219 X:71763508-71763530 CTGTGGGCCCCTGGGGCTCCGGG - Exonic
1194405735 X:93494037-93494059 CCGGGCTGCCCTGACTCTCCAGG - Intergenic
1195135809 X:101906568-101906590 TGGGTGGGCCCTGGGTCTGCTGG - Intronic
1195698834 X:107686591-107686613 CTGGGGTGCCCTGGGCATCCGGG + Intergenic
1195751442 X:108164626-108164648 CCGGGAAATCCTGGGTCTCCAGG + Exonic
1195790581 X:108580539-108580561 CCAGGAGGCCCTCGGTCACCAGG - Exonic
1195794074 X:108624277-108624299 CCAGGTTGCCCTGGGTCTCCAGG - Exonic
1195796605 X:108655346-108655368 CCAGGGTTCCCTGGGTATCCAGG - Exonic
1199950239 X:152700642-152700664 CCGGGGGCCTCTGGTCCTCCAGG - Exonic
1200000209 X:153056301-153056323 CCTGGGGGCCCCAGGTCCCCGGG - Intergenic
1200986382 Y:9306330-9306352 CCGGCAGGGCCTGAGTCTCCAGG + Intergenic
1202107397 Y:21385340-21385362 CCGGCAGGGCCTGAGTCTCCAGG + Intronic
1202124195 Y:21554572-21554594 CCGGCAGGGCCTGAGTCTCCAGG - Intergenic
1202154813 Y:21874808-21874830 CCGGCAGGGCCTGAGTCTCCAGG + Intergenic