ID: 900160930

View in Genome Browser
Species Human (GRCh38)
Location 1:1223497-1223519
Sequence CAGGTGAGGAAACGGGTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 468
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 423}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900160930_900160936 -10 Left 900160930 1:1223497-1223519 CCCCACACCCGTTTCCTCACCTG 0: 1
1: 0
2: 4
3: 40
4: 423
Right 900160936 1:1223510-1223532 TCCTCACCTGTGAGGCCAGCCGG 0: 1
1: 0
2: 4
3: 27
4: 231
900160930_900160943 9 Left 900160930 1:1223497-1223519 CCCCACACCCGTTTCCTCACCTG 0: 1
1: 0
2: 4
3: 40
4: 423
Right 900160943 1:1223529-1223551 CCGGCAACGTCTGTGCCTCGGGG 0: 1
1: 0
2: 0
3: 1
4: 61
900160930_900160940 7 Left 900160930 1:1223497-1223519 CCCCACACCCGTTTCCTCACCTG 0: 1
1: 0
2: 4
3: 40
4: 423
Right 900160940 1:1223527-1223549 AGCCGGCAACGTCTGTGCCTCGG 0: 1
1: 0
2: 1
3: 4
4: 63
900160930_900160941 8 Left 900160930 1:1223497-1223519 CCCCACACCCGTTTCCTCACCTG 0: 1
1: 0
2: 4
3: 40
4: 423
Right 900160941 1:1223528-1223550 GCCGGCAACGTCTGTGCCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 61
900160930_900160944 20 Left 900160930 1:1223497-1223519 CCCCACACCCGTTTCCTCACCTG 0: 1
1: 0
2: 4
3: 40
4: 423
Right 900160944 1:1223540-1223562 TGTGCCTCGGGGCCACCAAGAGG 0: 1
1: 1
2: 0
3: 8
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900160930 Original CRISPR CAGGTGAGGAAACGGGTGTG GGG (reversed) Intronic
900160930 1:1223497-1223519 CAGGTGAGGAAACGGGTGTGGGG - Intronic
900173331 1:1281150-1281172 CAGGGGAGGAAACGGGGCTCTGG + Intronic
900910651 1:5594769-5594791 CATCTGAGGAAACGGGGTTGGGG + Intergenic
901189959 1:7403866-7403888 CAAGTGAGGAAATGGGTGCAGGG + Intronic
902117003 1:14129474-14129496 CAGGGGAGGAATCGGGTGGGAGG - Intergenic
902362617 1:15950451-15950473 CACGTGAGCACACAGGTGTGTGG + Intronic
902552317 1:17226459-17226481 CAGAGGAGGGAACGGGTGTGGGG - Intronic
903268300 1:22172052-22172074 CAGGTGAGGAAACCGGGGCGTGG + Intergenic
904411380 1:30326971-30326993 CAGGGGAGAAAATGGTTGTGGGG - Intergenic
904641853 1:31937635-31937657 CAGGGGAGGGTATGGGTGTGTGG - Intronic
904830355 1:33302454-33302476 CAGAAGAGGAAATGGATGTGTGG + Intergenic
905655614 1:39684371-39684393 GAGGCGAGGAACCGGGGGTGAGG - Intronic
905747833 1:40434433-40434455 CAGGTGAGCAAGCCAGTGTGGGG - Intergenic
905892860 1:41528109-41528131 AAGGTGAGGGTAAGGGTGTGAGG - Intronic
907308678 1:53527426-53527448 CAGCTGAGGCAGCAGGTGTGAGG - Intronic
907455774 1:54574583-54574605 CAGATGAGGAAACCGGTCTGTGG + Intronic
907982877 1:59502088-59502110 CAGGTGAGGAAACCGTTGCAGGG + Intronic
909379524 1:74982370-74982392 CAAGGGAGGAAACTGGTGGGAGG + Intergenic
910494007 1:87805860-87805882 CAGTTGGGGAAAAGTGTGTGGGG - Intergenic
911874675 1:103144935-103144957 GAGGTGAGGAAAAGAATGTGAGG + Intergenic
912502359 1:110130627-110130649 AAGATGAGGAAATGGGGGTGGGG + Intergenic
913053316 1:115135574-115135596 CAGGTGAGGAAATAGAAGTGTGG - Intergenic
915240754 1:154519843-154519865 TAGGAGAGGAGAAGGGTGTGGGG + Intronic
915527694 1:156486210-156486232 CAGGTGAGGAATGGGGTGTCTGG - Intronic
915622726 1:157095759-157095781 CAGCTGAGGCCATGGGTGTGGGG - Intronic
917167563 1:172129720-172129742 CATGGGAGGAAACTGGTGGGAGG - Intronic
917435693 1:175018929-175018951 CAGGTGAGGAATGAGGTGGGGGG - Intronic
917836560 1:178946071-178946093 CGAGTAAGGAAGCGGGTGTGAGG + Intergenic
917968715 1:180194144-180194166 CTGGGGAGGCAACGGCTGTGGGG + Intronic
919211660 1:194495094-194495116 CAGGTGAGGAACCTGGTGGGAGG - Intergenic
919765537 1:201124896-201124918 CAGGAGGGGAAACTGGGGTGGGG - Intronic
920202265 1:204266803-204266825 CAGGGGAGGAAATAGGCGTGAGG - Intronic
920208460 1:204310911-204310933 CCGGTGATGATGCGGGTGTGGGG + Intronic
920244813 1:204579499-204579521 CAGCTGAGGACACGGGTAAGTGG + Intergenic
921126951 1:212186480-212186502 CAGGTGAGGAAACCTTTGTGTGG - Intergenic
921844390 1:219863406-219863428 TAGGTGAGGGAACCAGTGTGAGG - Intronic
922550732 1:226492269-226492291 CAGGTTAGGAACCCTGTGTGGGG + Intergenic
923968598 1:239173284-239173306 CAAGGGAGGAACCTGGTGTGAGG + Intergenic
924446496 1:244137499-244137521 CAGCATAGGAAACGGGTGTAAGG - Intergenic
924825515 1:247534010-247534032 AAGGTGAGGAAGGGGGTGTGTGG - Intronic
1062768722 10:83645-83667 GATGTGAGGAAGAGGGTGTGGGG - Intergenic
1062829367 10:595222-595244 CAGGTGAGTAAACCTGCGTGAGG - Intronic
1062985521 10:1765154-1765176 CAGGTGAGGAAATGGGCGGATGG + Intergenic
1065549839 10:26860101-26860123 GAGAGGAGGAAGCGGGTGTGGGG - Intronic
1065889810 10:30111182-30111204 CAGGTGAGGAACAGGGTGGAAGG - Intronic
1067205961 10:44214168-44214190 CATGGGAGGAAACTGGTGGGAGG + Intergenic
1067513079 10:46911499-46911521 CAGGTGAGGAAAGGTGGCTGGGG + Intronic
1067649174 10:48140343-48140365 CAGGTGAGGAAAGGTGGCTGGGG - Intergenic
1069076527 10:64043206-64043228 GAGGTGAGAAAAAGGGTGGGAGG - Intergenic
1069987760 10:72295910-72295932 CAGGTGAGGCTGCAGGTGTGGGG + Intergenic
1070195973 10:74156770-74156792 CAGGTGAGAAAAGAGGTATGGGG - Intronic
1072275599 10:93819716-93819738 CAGGGGAGGAGACTGGTGGGAGG - Intergenic
1072560758 10:96571504-96571526 AAGGTGAGGAAAAGGGACTGGGG - Intronic
1073136224 10:101222090-101222112 TAGGTGTGCAAAGGGGTGTGTGG - Intergenic
1073976870 10:109112083-109112105 CAGGGGAGGGAACTGGTGGGAGG + Intergenic
1074580895 10:114718347-114718369 CAGTAGAGAAAACGTGTGTGTGG - Intergenic
1074745826 10:116531404-116531426 CAGGTGAGGAAATGGTGCTGAGG - Intergenic
1075538328 10:123290313-123290335 CAGGTGGGAAAAAAGGTGTGTGG - Intergenic
1075991253 10:126840777-126840799 CAGGTGAGGAAAATAGGGTGTGG + Intergenic
1076248399 10:128965503-128965525 CAGGTGGGGATACAGGTATGAGG - Intergenic
1076572971 10:131444555-131444577 CAGGTGAGTACACAGGGGTGTGG + Intergenic
1076604387 10:131679973-131679995 CAGGTGAGAAAACGGGGAGGAGG - Intergenic
1077322821 11:1949881-1949903 CAGGGGCGGGAACGGGGGTGGGG + Intronic
1077444286 11:2583122-2583144 CAGATGAGGCAGCCGGTGTGGGG + Intronic
1077607496 11:3621931-3621953 CAGGTGAGGAATGGGGAGAGGGG + Intergenic
1078078967 11:8190295-8190317 CAGCTCAGGAAGCAGGTGTGGGG - Intergenic
1078348366 11:10571842-10571864 CAGGTGAGGAAACAGCTTTGAGG - Intronic
1078437370 11:11336626-11336648 CAGCTGAGGAAAAGGGATTGGGG + Intronic
1078658875 11:13268557-13268579 TAGGTGAAGAAACTGATGTGTGG - Intergenic
1079327933 11:19510557-19510579 CAGGTGAGGAAACAGGTGAGAGG + Intronic
1080562309 11:33475150-33475172 GAGGTGAGGAATTGGGTGTTAGG - Intergenic
1081573813 11:44307273-44307295 CAGATGAGGAAACCGGGGTTTGG + Intronic
1081611681 11:44566605-44566627 CAGGTGAGGAAACTGAAGTTTGG - Intronic
1081858527 11:46318866-46318888 GAGGGGAGGAAGCTGGTGTGGGG + Intronic
1083174503 11:60941102-60941124 CAGGTGTGCAGAGGGGTGTGGGG - Exonic
1083190883 11:61051507-61051529 CAGATGAGGAAACGAGGCTGAGG - Intergenic
1083581908 11:63830436-63830458 GAAGTCAGGAAATGGGTGTGTGG - Intergenic
1084270550 11:68027072-68027094 CAGGTGGGGAAGCCGGGGTGGGG - Intronic
1084426165 11:69085590-69085612 CAGCAGAGGAAAGGGGTGTAAGG + Intronic
1084433190 11:69122844-69122866 CAGGTGGGGAGCCGGGCGTGAGG - Intergenic
1084713041 11:70856048-70856070 CAGGTGAGTGAATGGGTGGGTGG + Intronic
1085718270 11:78891690-78891712 CAGGTGAGGAAACTGAGATGTGG + Intronic
1086062755 11:82717359-82717381 CATGTGAGGAAGTGGGTGGGGGG - Intergenic
1086500467 11:87447587-87447609 GAGGTGAGGAGAGGGGTATGTGG + Intergenic
1088591644 11:111408500-111408522 CAGGTGAGGACACTGATGTCAGG - Intronic
1089715159 11:120352630-120352652 TGGGTGGGGAAAGGGGTGTGTGG + Intronic
1090335194 11:125957328-125957350 CAGGGGAGGACAGGGGTGGGGGG + Exonic
1090364090 11:126191875-126191897 CAGGTGAGGAAACTGAGGTCTGG + Intergenic
1090636605 11:128693861-128693883 CAGGGGAGGAAGAGGGGGTGTGG + Exonic
1202805839 11_KI270721v1_random:5194-5216 CAGGGGCGGGAACGGGGGTGGGG + Intergenic
1091856792 12:3746955-3746977 CAGGTGAGTTAAGGGATGTGAGG - Intronic
1092034060 12:5315396-5315418 CAGGAGAGAAAAGGTGTGTGGGG + Intergenic
1092458300 12:8664551-8664573 CAGGGGAAGAAAAGGGTGTTGGG + Intergenic
1093392252 12:18636906-18636928 CAGGTCAGGAAACCAATGTGAGG + Intronic
1093607151 12:21105992-21106014 CAGGTGAGGGAAAGGGAGAGAGG - Intronic
1095573005 12:43703907-43703929 CAGGTTAGGAATCCTGTGTGGGG - Intergenic
1095830112 12:46576514-46576536 CAGGTGAGGAAACTGAGGTTCGG + Intergenic
1096354111 12:50925534-50925556 CCGGTGAGTGAAAGGGTGTGAGG + Exonic
1096820540 12:54230445-54230467 CAGGTCAGGAACATGGTGTGAGG - Intergenic
1100816093 12:98388658-98388680 AAAGCGAGGAAACGGGTGTTTGG - Intergenic
1101690721 12:107077818-107077840 CAGGTGAGGGGAGGGGAGTGGGG - Intronic
1101951565 12:109180085-109180107 CAGGTGAGAAAATGGGCTTGGGG + Exonic
1102254582 12:111408209-111408231 CAGATGAGGAAACTGAGGTGGGG - Intronic
1103476386 12:121222013-121222035 CAGGCGTGGAGAGGGGTGTGGGG - Intronic
1103627933 12:122234840-122234862 CTGGTGAGGTAAGGGGTGAGGGG - Intronic
1104244655 12:127026504-127026526 CAGGTGATTTAGCGGGTGTGGGG + Intergenic
1104393015 12:128407116-128407138 CATGGGAGGAAACTGGTGGGAGG + Intronic
1104410174 12:128551213-128551235 CAGGGGAGGAAGCGGGAGGGGGG - Intronic
1104924519 12:132306936-132306958 CAGGGGAGGAGACGGCTGTCTGG + Intronic
1104986214 12:132598837-132598859 CAGGTGAGGAAGCGACTGTGAGG - Intergenic
1105387871 13:19948772-19948794 CAGGTGTGGAATGGGGTGTGTGG + Intergenic
1106526080 13:30542402-30542424 CAGGAGAGGAGACAGGAGTGTGG - Intronic
1107118190 13:36769667-36769689 CAGGTGAGGAACTGGGTCAGAGG - Intergenic
1108419908 13:50238086-50238108 CGGGTGAGGAAACTGGAGTGTGG + Intronic
1109041365 13:57341779-57341801 CTGGTGAGGAAATGGGGGAGAGG + Intergenic
1109924290 13:69114332-69114354 CAGGGGAGGAACCTGGTGGGAGG + Intergenic
1112020786 13:95369499-95369521 CAGGGGAGGAACCTGGTGGGAGG - Intergenic
1113078930 13:106496233-106496255 CAGTGGAGGAAGCAGGTGTGGGG - Intronic
1113346362 13:109482422-109482444 CTGGAGAGGAACTGGGTGTGGGG + Intergenic
1114862352 14:26540143-26540165 TAGGTCAGGGAAGGGGTGTGGGG - Intronic
1115318693 14:32054587-32054609 CATGGGAGGAACCGGGTGGGAGG + Intergenic
1115827035 14:37289926-37289948 TAGGTGAGGAAAGGGGTGGAAGG + Intronic
1117606030 14:57430283-57430305 CAGATGAGGAAAGGGGAGGGTGG + Intergenic
1117757515 14:58991079-58991101 TAGGTGAGGGAACTGGTGGGAGG - Intergenic
1118160654 14:63286433-63286455 CAGGTGGGCAAAGGGGTCTGGGG + Intronic
1119474925 14:74921614-74921636 CAGTGGAGGAAACTGGGGTGCGG - Intronic
1119568327 14:75647562-75647584 CAGGTGAGGAGAGGGGTTGGTGG - Exonic
1119709782 14:76813164-76813186 CAGGTGAGGAAACTGAGGGGCGG - Intronic
1120451298 14:84670151-84670173 CACGTGAGGAAACTCTTGTGAGG + Intergenic
1120846161 14:89126902-89126924 CAGGTTTGGAAACCAGTGTGGGG - Intronic
1120932673 14:89865060-89865082 TTGGTGAGGTTACGGGTGTGAGG + Intronic
1122203950 14:100138990-100139012 AGGGTGAGGAAGAGGGTGTGGGG + Intronic
1122487336 14:102089864-102089886 CAGGTGAGCTGACGGTTGTGTGG - Intronic
1122617952 14:103033840-103033862 CCAGTGAGGAAACTGCTGTGTGG - Intronic
1123050858 14:105541401-105541423 CAGGTGAGGGAACGGGAATGCGG - Intergenic
1123157156 14:106238510-106238532 AAGTTGAGGAAATGTGTGTGTGG - Intergenic
1126403590 15:48300189-48300211 CTGGTGAGGTAGCGTGTGTGTGG + Intronic
1127080650 15:55375386-55375408 CAGGAAAGGAAGCGGGGGTGGGG + Intronic
1127635461 15:60865255-60865277 TAGATGAGGAAACAGGTGTGAGG - Intronic
1127995998 15:64153384-64153406 CAGGTGAGGAAAGGTGTTGGAGG + Intronic
1128354041 15:66911822-66911844 CAGCTGAGGAAACCGAGGTGAGG - Intergenic
1128463545 15:67889731-67889753 CAGGGGAGGAAGCTGGTGGGAGG - Intergenic
1129678908 15:77646959-77646981 CAGGGGAGGGAACGGGCATGGGG + Intronic
1130857508 15:87854042-87854064 CAGGTGAGAAAACTGGGGTTTGG - Intergenic
1131582263 15:93656029-93656051 CAGGTGAGGAAAAGAGCCTGGGG - Intergenic
1131667450 15:94585558-94585580 CATGTGAGCACACGGCTGTGTGG + Intergenic
1132062688 15:98705464-98705486 AAGGTGAGGAAACAGATTTGGGG - Intronic
1132119722 15:99166503-99166525 CGGAAGAGGGAACGGGTGTGAGG + Intronic
1132399906 15:101498799-101498821 CGGGTGAGGGAACTGGTGAGAGG - Intronic
1132457578 16:32669-32691 GATGTGAGGAAGAGGGTGTGGGG - Intergenic
1132566331 16:625240-625262 CAGGTGAGGGCAGGGGTGAGGGG + Intronic
1132576250 16:665787-665809 CAGGTGCTGAACCAGGTGTGTGG + Exonic
1132586647 16:708420-708442 GAGGTGAGGACACGGGTCTGTGG - Intronic
1133771020 16:8867313-8867335 CAGATGAGGAAACTCGGGTGGGG - Intronic
1133772583 16:8875968-8875990 CAGATGAAGAAACGGAGGTGCGG - Intergenic
1133897569 16:9944079-9944101 AAGTTGTGGAAATGGGTGTGGGG - Intronic
1135092092 16:19525005-19525027 CAGAGGACGAAACAGGTGTGGGG + Intronic
1136188074 16:28599755-28599777 CAGATGAGGAAATGGAGGTGGGG + Intergenic
1136190546 16:28612749-28612771 CAGATGAGGAAATGGAGGTGGGG + Intronic
1136869663 16:33794645-33794667 AAGTTGAGGAAATGTGTGTGTGG + Intergenic
1137627728 16:49920210-49920232 CAGGGGAGGGAAGGGGGGTGGGG + Intergenic
1137686512 16:50390580-50390602 CAGGAGAGGAAGCTGGTGCGAGG - Intergenic
1137763835 16:50962310-50962332 CAGAAAAGGAAAAGGGTGTGGGG - Intergenic
1138563170 16:57814205-57814227 CAGGTGGGGATATGGGGGTGTGG - Intronic
1138577052 16:57914739-57914761 CCAGTGATGAAACGGGTGTCTGG + Intronic
1138595661 16:58027738-58027760 CAGGTGGGGAAATGGCTGGGAGG - Intronic
1140410930 16:74739951-74739973 GAGGAGAGGAAGAGGGTGTGTGG - Intronic
1140443332 16:75003507-75003529 CAGGTAAGGAAACAGGTTTGGGG + Intronic
1140661416 16:77193775-77193797 CTGGTGAGCAAACAGGTGGGAGG + Exonic
1141010069 16:80388882-80388904 CAGGTGGGAAGAGGGGTGTGTGG - Intergenic
1141427306 16:83952701-83952723 CAGATGAGGAAACTGAGGTGCGG + Intronic
1141618770 16:85225373-85225395 CCGAGGAGGGAACGGGTGTGGGG + Intergenic
1141704024 16:85654961-85654983 CGGGTGGGGGAAGGGGTGTGGGG - Exonic
1141730862 16:85822008-85822030 AAGATGAAGAAACAGGTGTGGGG - Intergenic
1142352785 16:89587456-89587478 CAGGCGAGGAAACGGGCTTGGGG + Intronic
1142366292 16:89651715-89651737 CAGGTGTGGGCACAGGTGTGGGG - Intronic
1203102509 16_KI270728v1_random:1321410-1321432 AAGTTGAGGAAATGTGTGTGTGG - Intergenic
1142495961 17:306421-306443 CAGGTGAAGAAACGGAGGCGAGG - Intronic
1142547414 17:714583-714605 CAGGAGGGGAAACGGGAGTGCGG - Intronic
1142767881 17:2075904-2075926 GAGGTCAGAAAAGGGGTGTGGGG - Intronic
1142910030 17:3081132-3081154 CAGGGGAGGAACCTGGTGGGAGG - Intergenic
1142924481 17:3222682-3222704 CAGGGGAGGAACCTGGTGGGAGG + Intergenic
1142924742 17:3224618-3224640 CAGGGGAGGGAACTGGTATGAGG + Intergenic
1143372398 17:6448522-6448544 CAGGTAAGGAAACGGAGGTCCGG + Intronic
1143964197 17:10744952-10744974 AAGGCGAGGAAAAGGGTGGGAGG + Intergenic
1144146537 17:12404558-12404580 CAGGTGAGGAAACTGTGGAGTGG - Intergenic
1144225887 17:13145655-13145677 CAGGGGAGGTAACTGGTGAGAGG + Intergenic
1144642242 17:16943949-16943971 CAGGAGAGGAGACTGGCGTGGGG - Intronic
1144877882 17:18411818-18411840 CGGGGGAGAAAACGGTTGTGGGG - Intergenic
1146727951 17:35170904-35170926 CAGATGAGGAAAGGAGTCTGGGG - Intronic
1147262154 17:39214869-39214891 CAGGAGAGGGAAAGGGTGAGAGG + Intronic
1148129386 17:45254003-45254025 CAGGTGAGAAAGTGGGTCTGAGG - Intergenic
1148130616 17:45260586-45260608 CAGATGAGGAAACGTGTATGAGG + Intronic
1150143770 17:62751277-62751299 CAGGTGAGGAAACAGGTTCCGGG - Intronic
1150287136 17:63960871-63960893 GGGGTGAGGAAATGGGGGTGTGG - Intronic
1150970538 17:70022059-70022081 CAGGTGAGGAAACTGGAGCCCGG - Intergenic
1151749256 17:76027360-76027382 CAGGTGAGGCAGCGGGCGGGCGG + Exonic
1151784767 17:76270168-76270190 CGGGAGAGAACACGGGTGTGGGG - Intronic
1151901822 17:77021003-77021025 CAGGTGGGGAAACTGAGGTGTGG + Intergenic
1152068772 17:78125095-78125117 CAGCTGAGGAAGTGGGTCTGGGG + Intronic
1152304847 17:79514448-79514470 CAGATGAGGTCACGGGTGCGTGG + Intronic
1152510532 17:80784170-80784192 CACTTGAGGACACGAGTGTGAGG - Intronic
1152637656 17:81436723-81436745 CAGCTGAGGACACGGGGCTGAGG - Intronic
1152961606 18:83478-83500 GATGTGAGGAAGAGGGTGTGGGG - Intergenic
1152982123 18:288620-288642 CTGGTGAGTAAATGGGTGTGAGG - Intergenic
1153382727 18:4455950-4455972 GAGGTGAGGAAACAGCTCTGAGG - Intergenic
1153623201 18:6999113-6999135 CAGGAGAGGAAACAGCTTTGTGG - Intronic
1153747913 18:8199243-8199265 CAGCTGAGGAAACTGAAGTGTGG + Intronic
1157710542 18:49847047-49847069 GAGGTGAAGGAAGGGGTGTGGGG + Intronic
1157725325 18:49959491-49959513 CAGGTGAGGAAACAGGGGGCGGG + Intronic
1158016171 18:52786759-52786781 CAGGTTAGGAACCCTGTGTGGGG + Intronic
1158316372 18:56215102-56215124 CAGATGAGGAAACTGAAGTGTGG - Intergenic
1158327149 18:56324545-56324567 CAGGTGATGACACTGGTCTGTGG - Intergenic
1158382704 18:56951389-56951411 AAGGTGAGGAAGAGGGTGTGAGG - Intronic
1159867195 18:73720137-73720159 CATGTGTGGAAATGGATGTGTGG + Intergenic
1160277493 18:77451327-77451349 CAGGTGAGAAAAGGGGTGCAGGG - Intergenic
1160368549 18:78350400-78350422 CAGCTGTGGGAAGGGGTGTGAGG - Intergenic
1160498303 18:79388053-79388075 CAGCTGAGGACACAGGTGGGTGG + Intergenic
1160573168 18:79832216-79832238 CAGGTGAGGAAGGAGGGGTGAGG - Intergenic
1160844086 19:1159073-1159095 CAGGTGGGGTCACGGCTGTGGGG - Intronic
1161099371 19:2413765-2413787 GAGCTGGGGAATCGGGTGTGCGG + Exonic
1161773439 19:6243658-6243680 CAGGTGATGAAGCGGGGCTGGGG - Intronic
1161846448 19:6713972-6713994 CAGGTGAGGGACTGGGGGTGGGG - Exonic
1162526402 19:11209241-11209263 CAGGTGAGGGAATGAGTGAGGGG - Intronic
1162526781 19:11210849-11210871 CAGGTGAGGAGACAGGTGAAGGG - Intronic
1162526801 19:11210953-11210975 CAGGTGAGGACACAAGTGAGGGG - Intronic
1164735158 19:30535949-30535971 CAGGTGAGGCACCAGGTGAGGGG - Intronic
1165912321 19:39236978-39237000 CAGGTGAGGGGGCGGGTGAGGGG + Intergenic
925011222 2:487904-487926 CTGCGGAGGGAACGGGTGTGGGG - Intergenic
925011238 2:487952-487974 CTGCGGAGGGAACGGGTGTGGGG - Intergenic
925011442 2:488576-488598 CTGCGGAGGGAACGGGTGTGGGG - Intergenic
925011450 2:488600-488622 CTGCAGAGGGAACGGGTGTGGGG - Intergenic
926223313 2:10950279-10950301 CAGGAGAGGAACCTGGTGGGAGG + Intergenic
926307037 2:11645303-11645325 CAGTTGGGGAAAGGGGTGTAGGG - Intergenic
926309007 2:11661007-11661029 CAGGAGAGGGAAGGGGTGGGAGG - Intronic
927969441 2:27295826-27295848 CAAGTGAGGAAAGAGGTGTTGGG - Intronic
930096156 2:47568908-47568930 CAGGTGAGTAACCGAGGGTGGGG + Intronic
931878998 2:66546552-66546574 CAGGTGAGGAAACTGGCCAGGGG - Intronic
931994564 2:67827744-67827766 CATGGGAGGAACCTGGTGTGAGG - Intergenic
931996715 2:67845783-67845805 CTGGTGAGGAAGAGGGGGTGGGG + Intergenic
932337399 2:70938921-70938943 CAGTTGAGGAAACCGAGGTGGGG - Intronic
933023869 2:77228875-77228897 CAGGAGAGGTAACAGATGTGTGG - Intronic
933321560 2:80781589-80781611 CTGGAGAGGAAACTGGAGTGGGG - Intergenic
933436913 2:82260402-82260424 CAGGTGAGGAGATGGGAATGGGG + Intergenic
933847249 2:86336502-86336524 CAGGGGCTGAAATGGGTGTGGGG - Intronic
933851166 2:86367836-86367858 CAGGTGAGGAATGAGGTGTAAGG - Intergenic
936085191 2:109462686-109462708 CAGGTCAGGAAACCAATGTGAGG + Intronic
937121885 2:119446231-119446253 CATGTGAGGAAAAGGAAGTGAGG - Intronic
937131649 2:119518418-119518440 CAGGTGAGGGAAGTGGGGTGGGG + Intronic
937857165 2:126680802-126680824 CAGGTTAGGCAAAGGATGTGTGG + Intronic
939371224 2:141303435-141303457 CTGGTAAGGAAAGGTGTGTGGGG - Intronic
939564230 2:143767644-143767666 CAATTGAGGAAACAGGTGAGAGG - Intronic
939682988 2:145161793-145161815 CTGATGAGGAAATGGATGTGAGG - Intergenic
939755122 2:146100696-146100718 CAGGTCAGAAAACTGATGTGGGG - Intergenic
940158946 2:150691289-150691311 CAGGTGAGGAAAAGGGAGTCTGG - Intergenic
941249688 2:163146915-163146937 CAGGTCAGGAAACTTGTGTAGGG - Intergenic
941577155 2:167247565-167247587 CAGGAGACAAAACGGGTGTCTGG + Exonic
942284506 2:174401543-174401565 GAGGTGAGGAAATGGGAGTGGGG + Intronic
943704041 2:191016192-191016214 CATGGGAGGAAACTGGTGGGAGG - Intronic
943729593 2:191287541-191287563 AAGGTGAGGAAACTGGGATGTGG + Intronic
944464239 2:199984241-199984263 CACGTGAGGGAACGGGCATGTGG - Intronic
946138324 2:217666568-217666590 CAGATGATGAAACGGGTCTGGGG - Intronic
946201357 2:218072638-218072660 CATGGGAGGAAAAGGGTGTCTGG - Intronic
946783192 2:223214352-223214374 CAGGTAAGGAAACTGAGGTGAGG - Intergenic
947838157 2:233189784-233189806 CAGGTGAGGGGACAGGTGGGTGG - Intronic
947856642 2:233328665-233328687 CTGGTGAAGAGAGGGGTGTGGGG - Intronic
948560809 2:238849601-238849623 CAGGCTGGGAAACGGGTCTGGGG + Intronic
1169446137 20:5672447-5672469 CAGGTGAGGCCGGGGGTGTGGGG + Intergenic
1169499669 20:6147454-6147476 CAGATGAGGAAACTGAGGTGAGG - Intergenic
1169597987 20:7222676-7222698 CAGGAGCTGAAAAGGGTGTGTGG - Intergenic
1169781868 20:9318401-9318423 CAGGTGGAGACATGGGTGTGAGG + Intronic
1170437152 20:16342001-16342023 CAGGTACAGAAAGGGGTGTGTGG - Intronic
1170626108 20:18031231-18031253 CAGGTGAGGAAACGGCCTTTCGG - Intronic
1171194405 20:23186297-23186319 CAGGTGGGGAAACTGAGGTGAGG + Intergenic
1172640038 20:36435443-36435465 CAGGTGAGGTCACAGCTGTGAGG - Intronic
1172694439 20:36812593-36812615 CTGGTGAGGATATGGGTTTGGGG - Intronic
1172775180 20:37403115-37403137 CCGGTGAGGAAAGTGGGGTGGGG - Intronic
1172886322 20:38233516-38233538 CTGATGAGGAAACTGGGGTGGGG + Intronic
1173577652 20:44123447-44123469 GGGGTGAGGCCACGGGTGTGTGG - Intronic
1174290174 20:49502734-49502756 CAGATGAGGAAACTGACGTGAGG + Intergenic
1174609069 20:51784295-51784317 GAAGTGAGGAAACTGGTGTTTGG + Exonic
1174693121 20:52529398-52529420 CAGATGAGGAAACTGATGTCTGG - Intergenic
1175625196 20:60483899-60483921 CAGGAGAGGAAGCAGGTGTGGGG + Intergenic
1176026705 20:62989716-62989738 CACGCCAGGAAACAGGTGTGGGG - Intergenic
1176149969 20:63585777-63585799 CAGCTGAGGACACAGGAGTGGGG - Intergenic
1177023753 21:15896029-15896051 CACTTGAGGAGAAGGGTGTGGGG + Intergenic
1177110429 21:17020945-17020967 GAGGTGTGGAGACTGGTGTGAGG - Intergenic
1179445105 21:41425652-41425674 CCAGGGTGGAAACGGGTGTGTGG - Intronic
1179594526 21:42433482-42433504 CAGGAGAGGACAAGGATGTGGGG - Intronic
1182128268 22:27832284-27832306 CAGGAGAGGAAATAGCTGTGCGG + Intergenic
1182523358 22:30898688-30898710 CAGGGGAGGGACCGGGTGGGAGG - Intronic
1183954783 22:41372910-41372932 CAGGAAAGAAAACGGGTCTGAGG + Intronic
1184412339 22:44332392-44332414 GAGGAGAGGAAAAGGGAGTGGGG - Intergenic
1184823891 22:46933873-46933895 GAGGTGGGGACAGGGGTGTGGGG + Intronic
1184832680 22:46999605-46999627 CAAGTGATGAAACAGGTGAGGGG - Intronic
1185023691 22:48395575-48395597 CAGGTGAGGAAAACTGTGTGTGG - Intergenic
1185101360 22:48842662-48842684 CAGGTGGGGAAACGGCAGCGCGG - Intronic
949400240 3:3658073-3658095 AAGGTGAGCAAACGTATGTGAGG - Intergenic
949709800 3:6860924-6860946 AAGGGGGGGAAACGGGTGGGCGG - Intronic
949792675 3:7810308-7810330 CAGATGAGGAAACCAGTGTCAGG + Intergenic
949831400 3:8218619-8218641 CAGGCGAGGAAGGGGGAGTGTGG - Intergenic
950447859 3:13048477-13048499 CAGGTGGGGAGAAGTGTGTGAGG - Intronic
950523976 3:13513007-13513029 CAGATGAGGAAAGGGGACTGGGG + Intergenic
950527181 3:13531349-13531371 CAGGCCAGGAAACTGGTGTGTGG + Intergenic
953387067 3:42512754-42512776 GAGATGAGGAAACTGGTGTGGGG + Intronic
953441259 3:42919568-42919590 CAGGTTAGGAAACCTGTATGGGG + Intronic
953530237 3:43734189-43734211 CAGGTGAGGAAGCAGCTGTTTGG - Intronic
953713687 3:45297103-45297125 CAGGTGGGGGAACAGGAGTGAGG + Intergenic
954852780 3:53617606-53617628 CAGCTGAGGAAAAGGAAGTGTGG + Intronic
956101511 3:65773023-65773045 CAGATGAGGAAACTGGTCCGTGG - Intronic
958942576 3:100332170-100332192 CAGGTGAGGAAAAGGTCCTGAGG + Intergenic
961325975 3:126109588-126109610 CAGGTGAAGCAACGGCTGAGAGG + Intronic
961556838 3:127701747-127701769 CACATGAGGAAAGGGGTCTGGGG - Intronic
961615839 3:128180392-128180414 CAGGTGGGAAAACAGGTGTAAGG - Intronic
961949378 3:130732160-130732182 CAGGTGAGGAAACTGGGGTTAGG - Intronic
964221214 3:154347481-154347503 CATGGGAGGAACCCGGTGTGAGG - Intronic
964265783 3:154894020-154894042 TGGGTGAGGAAACTGGTGGGAGG - Intergenic
964807565 3:160628125-160628147 CATGTGAGGACATGGATGTGGGG - Intergenic
965556151 3:170020512-170020534 TAGATGAGGAAACGGGTTTGGGG - Intergenic
966895259 3:184440025-184440047 GAGGGGAGGACAGGGGTGTGGGG - Intronic
967093024 3:186151588-186151610 CAGGTGGGGCAGCTGGTGTGGGG + Intronic
967503813 3:190230599-190230621 CAGGTGATGAAACTGGAATGTGG - Intergenic
967542432 3:190683243-190683265 CAGGTTAGGAACCCTGTGTGGGG - Intergenic
967964016 3:194946298-194946320 CTGCTCAGGAAATGGGTGTGGGG + Intergenic
968789779 4:2651601-2651623 CAGGGGAGGAACCTGGTGGGAGG - Intronic
968872070 4:3247238-3247260 GAGGTGAGGAAACAGGTTAGTGG + Intronic
968959792 4:3737670-3737692 CAAGTGAGGAATTGGGGGTGAGG + Intergenic
969205050 4:5637376-5637398 CAGGTGAGGAAACTGAGCTGGGG - Intronic
969345263 4:6565853-6565875 CAGAGGAGGAAAGGGGGGTGAGG + Intergenic
969405446 4:6988388-6988410 CAGATGAGGAAACAGGCTTGTGG + Intronic
969589341 4:8112842-8112864 CAGGTGATGGAAGGGGTGGGAGG - Intronic
969719701 4:8886643-8886665 CAGGTGAGGTCAGGGGTGGGGGG + Intergenic
970382014 4:15517998-15518020 CATGGGAGGAACCGGGTGGGAGG - Intronic
970604497 4:17666671-17666693 AAGGTGAGGAAAAGAGAGTGAGG - Intronic
970635662 4:18006755-18006777 CATGGGAGGAAACTGGTGGGAGG - Intronic
970994425 4:22249032-22249054 CATGGGAGGAAACTGGTGGGAGG + Intergenic
971163809 4:24161495-24161517 CAGGTGAGGAAACTGGGGTTTGG - Intergenic
973102294 4:46288098-46288120 CATGAGAGGAAACCAGTGTGAGG - Intronic
973145666 4:46822408-46822430 CAGGTGAGGAGAGGGCTCTGGGG + Intronic
973293113 4:48489895-48489917 CCGGTGAGGGAGCGGGGGTGGGG + Intergenic
973585237 4:52384031-52384053 CAGGGGAGGAACCTGGTGGGAGG - Intergenic
976100588 4:81558571-81558593 CAGGTGAAGAACGGGGTGAGGGG + Intronic
976356264 4:84121006-84121028 AAGGTGAGGAAAGGTGTGTCAGG + Intergenic
976400683 4:84603333-84603355 CAGAGGAGGAAACTGGAGTGAGG - Intronic
976828269 4:89284197-89284219 CAGGTGAAGGAATGGGTGGGTGG + Intronic
977369431 4:96116328-96116350 CAGGTGAGGGAAGGGGTGAAAGG - Intergenic
978342512 4:107733641-107733663 CAGGTGATGAAAAGGATGTGTGG - Intergenic
978604792 4:110467542-110467564 CAGGAGAGGAGACGGGTGGCAGG + Intronic
978609879 4:110525936-110525958 AAGGTGAGCAAATTGGTGTGGGG + Intronic
981324917 4:143434766-143434788 TAGAAGAGGAAAGGGGTGTGGGG - Intronic
982312726 4:154002723-154002745 AAGGTGAGGAAGCAGGGGTGTGG - Intergenic
982969645 4:161968147-161968169 CAGATGAGGAAATTGATGTGTGG - Intronic
986334176 5:6740918-6740940 CAGGTGAGGAAACTGAGATGCGG + Intronic
986422182 5:7596607-7596629 GATGTGAGGAAAAAGGTGTGAGG - Intronic
989062280 5:37421094-37421116 CAGGTGAGGAAACTAGTATTCGG + Intronic
990543992 5:56803852-56803874 GAGATGAGGAAACAGGAGTGAGG - Intergenic
991187389 5:63825898-63825920 CAGGGGAGGAACCTGGTGGGAGG - Intergenic
991262845 5:64685554-64685576 CAGGAGAGGAAAAGGGAGTATGG + Intergenic
996401630 5:123069229-123069251 CCAGGGAGTAAACGGGTGTGTGG + Intergenic
998345423 5:141457866-141457888 CAGGTTAGGAACCCTGTGTGGGG + Intronic
998457291 5:142283099-142283121 CAGATGAGGAAACTGATATGTGG - Intergenic
998521247 5:142802865-142802887 CAGGTGAGGAAACTGAGGTTTGG - Intronic
998953385 5:147414076-147414098 CAGGTGAGGAAACCGAGGTCTGG - Intronic
999209427 5:149874955-149874977 CAGATGAGGAAACTGAGGTGAGG + Intronic
999920117 5:156308692-156308714 CAGGTGAGGGACCTGGTGGGAGG - Intronic
1000014257 5:157263903-157263925 CAGGTGAGGAAACAGGGGTGAGG + Intergenic
1000069669 5:157728195-157728217 CAGGTTAGGAACCCTGTGTGGGG + Intergenic
1001086670 5:168704995-168705017 CAGCTGAGGAAACTGAGGTGAGG + Intronic
1002927980 6:1615531-1615553 CAGGAGAGGAAGCGGGTACGGGG + Intergenic
1003298310 6:4853777-4853799 CAGGTGTGGGGACAGGTGTGAGG - Intronic
1004351943 6:14897939-14897961 CAGAAGAAGAAAGGGGTGTGTGG - Intergenic
1005104401 6:22207686-22207708 CAGGGGAGGGACCGGGTGAGAGG - Intergenic
1005119578 6:22375135-22375157 CAGGTTAGGAACCCTGTGTGGGG - Intergenic
1005840891 6:29743989-29744011 CAGGTGAGAAAACGGGGCAGTGG - Intergenic
1006787355 6:36677525-36677547 CAGGGGAGGTCAGGGGTGTGAGG + Intronic
1006841874 6:37033685-37033707 AAGGTGAGGACAAAGGTGTGGGG - Intergenic
1006946882 6:37790513-37790535 CAGATGAGGAAACGGGTTTGGGG + Intergenic
1007399701 6:41596839-41596861 CCGGAGAGAAAACGGGTGGGGGG + Intronic
1007763625 6:44148648-44148670 CTGGTGAGCAAACAGGTGTCAGG + Exonic
1009654761 6:66527369-66527391 CAGGGGAGGAACCTGGTGAGAGG - Intergenic
1010498184 6:76561669-76561691 TATGTGAGGAAATGGGTCTGGGG + Intergenic
1016779762 6:147944495-147944517 TAGGGGAGGAAACCGGTGGGAGG - Intergenic
1017442702 6:154478413-154478435 CTGGTGAGGAAGCTGGTGCGTGG - Intronic
1017801060 6:157896996-157897018 CAGGTGAGGAGAGGGGTGCAAGG + Exonic
1018014637 6:159701108-159701130 CTGGAGAGGAAGCAGGTGTGGGG - Intronic
1018477591 6:164158769-164158791 CATGGGAGGAAACGAGTGGGAGG - Intergenic
1018712498 6:166506780-166506802 AAGGTGGGGAAAAGGGAGTGGGG + Intronic
1019318055 7:400567-400589 CAGATCAGGCAACGGCTGTGAGG + Intergenic
1019519916 7:1455959-1455981 GAAGGGAGGAAACGCGTGTGAGG - Intronic
1019942673 7:4303454-4303476 GTGGTGTGGAAACGGGTGAGGGG + Intergenic
1021096455 7:16540628-16540650 CAGGGGAGGAACCTGGTGGGAGG + Intronic
1021619762 7:22539770-22539792 CAGGGGAGGAAACTGGTGGGAGG + Intronic
1021628940 7:22624543-22624565 CAGGCAAGGAAAGGGGTGGGAGG - Intronic
1022049662 7:26653599-26653621 CATGTGAGGATATGGGTGTGGGG + Intergenic
1022175278 7:27866449-27866471 CAGATGAGGAAATGGAGGTGTGG - Intronic
1022653117 7:32294996-32295018 CAGGTCATGAAATGGGTATGTGG - Intronic
1023293154 7:38688042-38688064 CATGGGAGGAAAAGGGTGTTGGG - Intergenic
1023940416 7:44765636-44765658 CAGGTGAGGAGACTGATCTGGGG - Intronic
1027177579 7:75914721-75914743 CAGGTGAGGAAACAGGGCCGTGG + Intronic
1028371505 7:90097829-90097851 CAGGGGAGGAAACTGGTGGGAGG - Intergenic
1029315562 7:99710001-99710023 CAAGTGAGGACAGGGCTGTGTGG - Intronic
1029321281 7:99762792-99762814 CAAGTGAGGACAGGGCTGTGTGG - Intronic
1030272776 7:107687537-107687559 CAGCTGAGGAAACTGGGATGTGG + Intronic
1031343298 7:120632728-120632750 CAGATGAGGAAATGGGCATGGGG + Intronic
1031798884 7:126216155-126216177 CATGTAAGGAAGTGGGTGTGTGG - Intergenic
1032503252 7:132415767-132415789 CAGGTGAGGAAACTGAGGTCTGG + Intronic
1033175927 7:139123656-139123678 CAGGTGTGGAAACAGGCTTGGGG - Intergenic
1033663095 7:143416986-143417008 CAGGTGAGGAAGGGAGGGTGGGG + Intergenic
1033891927 7:146024162-146024184 CATGGGAGGAACCTGGTGTGAGG + Intergenic
1034965304 7:155387168-155387190 CAGATGAGGAAACAGATGTGTGG + Intronic
1035107303 7:156452564-156452586 CAGGTGGGGCAGGGGGTGTGTGG + Intergenic
1035728560 8:1839666-1839688 CTGGTGTGGAAACTGGTGTGGGG + Intronic
1036656658 8:10681465-10681487 CAGGAGAGGAGAGGGATGTGGGG + Intronic
1037447485 8:18980963-18980985 CAGGTTGGGAAGAGGGTGTGAGG - Intronic
1037829139 8:22177824-22177846 AAGATCAGGAAAAGGGTGTGGGG - Intronic
1038051579 8:23818893-23818915 CAGGTGAGAGAGCGTGTGTGAGG + Intergenic
1038119516 8:24597091-24597113 CAGGGGAGGAAACTGGTGGGAGG - Intergenic
1038186882 8:25283290-25283312 CAGGAGAGGAAGCGGGTTTTAGG + Intronic
1038664599 8:29527220-29527242 CAGGTGAGGAAACTGAGGGGCGG + Intergenic
1038811452 8:30850090-30850112 AAGGAAAGGAAAGGGGTGTGAGG + Intronic
1040464108 8:47678697-47678719 CAGGGGATGAAATGGCTGTGTGG - Intronic
1041791449 8:61700270-61700292 CTGGGGAGGAAAAGGGGGTGAGG - Intronic
1042214666 8:66418218-66418240 CAGGAGAGGAAAAGGGTGGAAGG + Intergenic
1042493961 8:69435341-69435363 CAAGGGAGGAAACTGGTGGGAGG - Intergenic
1043032414 8:75153586-75153608 CAGATGAGGAAACTGGGCTGAGG - Intergenic
1044217997 8:89635578-89635600 CAGGTGAGGAAACTGATGCATGG + Intergenic
1045826286 8:106402395-106402417 CAGGTTAGGAAACCAATGTGAGG + Intronic
1046542431 8:115603853-115603875 CAGGTGAGGCATGGGGGGTGGGG - Exonic
1048257673 8:132917520-132917542 CAGCTGGGGAATGGGGTGTGTGG + Intronic
1048872807 8:138812892-138812914 GATGGGAGGAAATGGGTGTGTGG - Intronic
1049103815 8:140598715-140598737 CAGAGGAGGAAACGGGGTTGGGG - Intronic
1049131558 8:140849228-140849250 GAGGGGAGGACACGGGTCTGTGG - Intronic
1049825127 8:144662937-144662959 AAGGTGAGTAATGGGGTGTGGGG - Intergenic
1050479069 9:6071141-6071163 CAGGGAAGGAAACAGGAGTGAGG - Intergenic
1053489633 9:38488959-38488981 CAGGTGTGGAAACTGAGGTGCGG + Intergenic
1055886073 9:81064134-81064156 CATGGGAGGAAACTGGTGGGAGG + Intergenic
1056425172 9:86468356-86468378 GACGTGAGGAAATGGGGGTGGGG + Intergenic
1056900869 9:90598097-90598119 CAGTTGAGGAAACTGGGGTGTGG + Intergenic
1057282057 9:93720246-93720268 CAGGTGAGGAGATGGGTGCAAGG + Intergenic
1057495813 9:95560102-95560124 CAAGTGAGGAAACGGGAGGCCGG + Intergenic
1057648096 9:96895832-96895854 CAGGTCAGGAAACCAGTGTAGGG - Intergenic
1060359406 9:122940984-122941006 CACGTGAGTAAAGGGGTGGGGGG + Intronic
1061014973 9:127976285-127976307 CAGGTGAGGAAGCTGGGGTCAGG - Intronic
1061118255 9:128628066-128628088 CAGGTGACGAGAAGGGTGGGAGG - Intronic
1061515841 9:131089917-131089939 CAGATGAGGAAACTGAGGTGAGG + Intronic
1061519622 9:131110408-131110430 CAGGTGAGGAAACAGGTGAGAGG + Intronic
1062276396 9:135733448-135733470 CAGGTGTGGGGGCGGGTGTGGGG - Intronic
1062276413 9:135733484-135733506 CAGGTGTGGGGGCGGGTGTGAGG - Intronic
1062425330 9:136503609-136503631 GAGATGAGGAAACGTGTCTGTGG - Intronic
1062675384 9:137740182-137740204 CAGGAGTGGAAATGGGCGTGGGG - Intronic
1062736547 9:138140641-138140663 GATGTGAGGAAGAGGGTGTGGGG + Intergenic
1186356820 X:8799639-8799661 CAGGGGAGGGGAGGGGTGTGGGG - Intronic
1186357147 X:8800754-8800776 CAGGGGAGGGGAGGGGTGTGGGG - Intronic
1187485717 X:19701294-19701316 CAGGTGAGAAAATGGTTATGGGG + Intronic
1188774092 X:34190883-34190905 CATGGGAGGAAACTGGTGAGAGG - Intergenic
1189281107 X:39820734-39820756 CAGGTGAGGAAAAAGGCCTGTGG + Intergenic
1189971855 X:46425936-46425958 CAGGTGAGGAAACTGGTGGTAGG + Intergenic
1190111161 X:47589992-47590014 TTGGTGAGGAGACTGGTGTGGGG - Intronic
1192333656 X:70200031-70200053 CAGGTGGGGAAACAGGTGGATGG + Intronic
1192777297 X:74258584-74258606 CAGGTTAGGAACCCTGTGTGGGG - Intergenic
1194273980 X:91857287-91857309 CATGGGAGGAACCTGGTGTGAGG - Intronic
1195978522 X:110553788-110553810 CAGGGGATGAAACGAGTGTCTGG + Intergenic
1197387895 X:125823002-125823024 CATGTGAGGAACCTGGTGGGAGG - Intergenic
1198418857 X:136448765-136448787 CATGGGAGGAAACTGGTGGGAGG - Intergenic
1198595117 X:138227844-138227866 CATGGGAGGAAACTGGTGGGAGG + Intergenic
1198675308 X:139124660-139124682 CAGATGAGGAAACTGAGGTGAGG - Intronic
1200398778 X:156006712-156006734 GATGTGAGGAAGAGGGTGTGGGG + Intronic
1200591217 Y:5078704-5078726 CATGGGAGGAACCTGGTGTGAGG - Intronic