ID: 900162556

View in Genome Browser
Species Human (GRCh38)
Location 1:1231353-1231375
Sequence TTCCACCAGAGCTGAAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900162556_900162558 -8 Left 900162556 1:1231353-1231375 CCTGGGCTTCAGCTCTGGTGGAA 0: 1
1: 0
2: 2
3: 12
4: 225
Right 900162558 1:1231368-1231390 TGGTGGAACGAGGCTATTTCTGG 0: 1
1: 0
2: 0
3: 5
4: 59
900162556_900162559 11 Left 900162556 1:1231353-1231375 CCTGGGCTTCAGCTCTGGTGGAA 0: 1
1: 0
2: 2
3: 12
4: 225
Right 900162559 1:1231387-1231409 CTGGCAGTTAACAACACACACGG 0: 1
1: 0
2: 0
3: 12
4: 976

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900162556 Original CRISPR TTCCACCAGAGCTGAAGCCC AGG (reversed) Intronic
900162556 1:1231353-1231375 TTCCACCAGAGCTGAAGCCCAGG - Intronic
900756532 1:4439154-4439176 TTGGACAGGAGCTGAAGCCCAGG + Intergenic
902041754 1:13497564-13497586 TTCCCCCAGAGAGGAAGCCAAGG - Intronic
902090436 1:13898643-13898665 TGGCATCAGAGCTGCAGCCCAGG - Intergenic
902191633 1:14767299-14767321 TTTCACCTGAGCTGAAGGCTGGG + Intronic
903181945 1:21609232-21609254 TACGTACAGAGCTGAAGCCCAGG + Intronic
906210717 1:44010988-44011010 TGCCAGCAGAGGGGAAGCCCGGG - Intronic
907359873 1:53905906-53905928 TTGATCCAGAACTGAAGCCCAGG - Intronic
908846197 1:68326762-68326784 GTTCACCAGGGCTGAAGCACAGG + Intergenic
909078812 1:71084980-71085002 TTCCACCAGAGCTAATCTCCTGG - Intergenic
909774991 1:79473001-79473023 TTCCAAAAGAGCTTGAGCCCAGG - Intergenic
912924296 1:113900269-113900291 TTCCTCAAGAGCAGTAGCCCAGG - Exonic
916205840 1:162315502-162315524 TGCCACCAGAGAGGAAGCCAAGG - Intronic
917287330 1:173434945-173434967 TTTCACCAGAGATGAATCCTAGG - Intergenic
919012529 1:191983501-191983523 TGCCACCAGAGATGAAGCAGAGG - Intergenic
919640587 1:200040952-200040974 GTCCCCTAGAGCTGAAGCCCCGG + Intronic
920987510 1:210904381-210904403 GTCCACCAGAGATGAGGCCCTGG - Intronic
923274955 1:232387529-232387551 TTCCACCAGTGCTGGAAACCAGG + Intergenic
924023297 1:239807497-239807519 TTCCACCAGAAGAGAAGCCTTGG + Intronic
1063149854 10:3326487-3326509 TTTCACCAGGCCTGATGCCCTGG + Intergenic
1063187572 10:3665009-3665031 TGCCACCACTGCTGGAGCCCAGG + Intergenic
1063405914 10:5794891-5794913 TTCCACTGAAGCAGAAGCCCTGG - Exonic
1064197713 10:13259480-13259502 TGCCACCAAAGTGGAAGCCCAGG - Intergenic
1064688764 10:17892403-17892425 ATTGACCAGAGCAGAAGCCCAGG - Intronic
1067211793 10:44265714-44265736 TTGAACCAGAACTCAAGCCCAGG + Intergenic
1067684594 10:48458929-48458951 TGCCCCCAGAGGAGAAGCCCTGG + Intronic
1067851668 10:49758753-49758775 TTCCACCAGACAGTAAGCCCAGG - Intronic
1070309512 10:75263023-75263045 TGCCCCCAGACCTGAAGCTCAGG + Intergenic
1070704670 10:78629077-78629099 CTCCATTAGAGGTGAAGCCCTGG + Intergenic
1072394601 10:95026021-95026043 CTCCACCAGACCTGAAGCAGAGG - Intergenic
1072464512 10:95650836-95650858 TTCAAACTGAGCTGAAGGCCAGG + Intronic
1072692422 10:97580777-97580799 TCCCACCCAAGCTGAGGCCCAGG - Intronic
1074655847 10:115586981-115587003 TTCCAACAGAGCTGCAGCTGAGG - Intronic
1075261999 10:120971027-120971049 AGCCACCTGAGCTAAAGCCCTGG - Intergenic
1075668647 10:124248168-124248190 CTGCACCTGAGCTGAAGGCCTGG - Intergenic
1076044399 10:127279729-127279751 TCCCAACAGAGCTGCAGCCCAGG - Intronic
1076236961 10:128870997-128871019 CGCCCACAGAGCTGAAGCCCAGG - Intergenic
1077374244 11:2198173-2198195 TCCCAGGGGAGCTGAAGCCCAGG - Intergenic
1079003638 11:16777788-16777810 TGCCACCAGACCTGAGTCCCAGG + Intergenic
1079486906 11:20944575-20944597 TTCCACCAGCGCAGAACTCCAGG + Intronic
1079681473 11:23303394-23303416 TTCCAACAGACCTGAAGCTGAGG - Intergenic
1081420828 11:42873798-42873820 TGCCACCAAAGTGGAAGCCCAGG - Intergenic
1083016664 11:59461184-59461206 TTCACCCAGTGCTGAAGCCTCGG + Intergenic
1083736408 11:64684044-64684066 CTCCTCAAGAGCTGAAGTCCTGG + Intronic
1088803508 11:113329531-113329553 CTTCACCAGAGCCGAAGGCCAGG - Intronic
1090936427 11:131346952-131346974 ATCCACCAGAGCTGAATCAGAGG + Intergenic
1092136815 12:6155251-6155273 TCCCACCAGAGCGGAAGAACAGG + Intergenic
1094126935 12:27033225-27033247 TTCCCACAGTTCTGAAGCCCGGG + Intronic
1094225682 12:28042672-28042694 CTCCACCAGAGCTTCAGCCTGGG - Intergenic
1096414578 12:51402238-51402260 TTCAACAACAGCTGAATCCCAGG - Intronic
1096554455 12:52394895-52394917 TCCCACCAGGGCTGAAGACAAGG - Exonic
1099605209 12:84795182-84795204 TGCCACCATAACTGCAGCCCGGG + Intergenic
1101032283 12:100672166-100672188 TCCCACCAGAGCTGCACCCAGGG - Intergenic
1102080608 12:110094966-110094988 TTTCACCAGAGTTCAAGTCCAGG + Intergenic
1102222488 12:111203962-111203984 TGCCACCAGCCCTGAGGCCCTGG - Intronic
1102635396 12:114319275-114319297 TTCCCCCAGAGCTGGAGCTCTGG - Intergenic
1103311772 12:120015406-120015428 TTCCCCCAGTCCTGAAGGCCAGG + Intronic
1105208333 13:18241921-18241943 TCCCACCCCAGCTGAAGCCATGG + Intergenic
1105307427 13:19178916-19178938 TTCCTCCAGATTAGAAGCCCAGG - Intronic
1105883645 13:24624605-24624627 TTCCACCAGGGTTCAGGCCCTGG + Intergenic
1117953873 14:61107976-61107998 TTCCTCCAGAGCTACAGCTCTGG + Intergenic
1119072957 14:71606341-71606363 TACCACCAGGGCTGAAGCATGGG - Intronic
1120047674 14:79826896-79826918 TTCCTCCTGTGCTGAAGCACAGG - Intronic
1120867037 14:89304281-89304303 TTCCTGCTGAGCTGGAGCCCGGG + Intronic
1121691671 14:95882235-95882257 CTAGCCCAGAGCTGAAGCCCTGG - Intergenic
1125722569 15:41852272-41852294 AGCCACAGGAGCTGAAGCCCGGG - Exonic
1126780627 15:52136282-52136304 TCCCAGCAGAGCTGAAATCCTGG + Intronic
1127384574 15:58456989-58457011 CTCCAGCAGAGATGATGCCCAGG + Intronic
1127535531 15:59886599-59886621 TCCCACCAGGGCTGAAAGCCAGG - Intergenic
1127858922 15:62976862-62976884 TTCCCCCAGAGCTAAAGGCCTGG + Intergenic
1128763421 15:70235403-70235425 TTCCTCCAGCACTGCAGCCCTGG - Intergenic
1132559824 16:588573-588595 GTCCCCCAGAGCTGAAGACATGG - Intergenic
1132884282 16:2175747-2175769 GCCCAGCAGTGCTGAAGCCCTGG + Intronic
1134017791 16:10901529-10901551 TTCCGGCAGACCTGAAGCACTGG + Exonic
1135722223 16:24827598-24827620 TTCCGCCAGGGCTGAAGGCCTGG - Intronic
1136366363 16:29810995-29811017 TTCCACCCCAGCTCCAGCCCTGG + Exonic
1140301950 16:73766584-73766606 TTCAAGAAGAGCTGAAGCTCTGG + Intergenic
1142324111 16:89402967-89402989 TTGCTCTAGAGCTGGAGCCCAGG - Intronic
1142414994 16:89936464-89936486 TGCCATCAGACCTGAAGCCTCGG + Intergenic
1144279338 17:13709122-13709144 AGCCACCAGAGGTGAAGGCCAGG + Intergenic
1144586792 17:16492083-16492105 TTCCCCCAAAGTTGCAGCCCGGG - Intronic
1145935886 17:28714565-28714587 TTCCTCCAGAGCTTGACCCCTGG - Exonic
1148439459 17:47704209-47704231 ATCCACCAGAGCTGACATCCCGG - Intronic
1154062997 18:11081118-11081140 TGCCACAAGAACTTAAGCCCAGG + Intronic
1157533439 18:48441326-48441348 TTCCATTAAAGCTGAAGGCCAGG + Intergenic
1158027833 18:52923062-52923084 TGCCCCTAGAGCTGAAACCCTGG - Intronic
1158528994 18:58241286-58241308 TTCCTGCAGAGCTCAAACCCTGG - Intronic
1159374447 18:67574913-67574935 TCCCAAGAGAGCTGCAGCCCAGG + Intergenic
1160510681 18:79451846-79451868 TCCCACCAGCGCCGAAGCCCAGG - Intronic
1160686927 19:441239-441261 TTCCACCAGCACCGAAGCCGAGG + Intronic
1160732517 19:647742-647764 CTCCCCCAGCGCTGAAGCACGGG - Exonic
1162450099 19:10749319-10749341 GTCCAGCAGATCAGAAGCCCAGG - Intronic
1164340730 19:24394816-24394838 TTCCAGCAGACCTGAAGCTGAGG + Intergenic
1164351415 19:27348085-27348107 TTCCAACAGACCTGCAGCCGAGG - Intergenic
1165129096 19:33621414-33621436 TTCCACGCGAGCTGAAGCCCAGG + Intergenic
1166255649 19:41602250-41602272 GTCCACCAGAGATCAGGCCCAGG + Intronic
1166885706 19:45959876-45959898 AAACACCAGAGCTGGAGCCCAGG - Intronic
1167349935 19:48968259-48968281 TTTCACCAAAGCTGAAGGCAGGG + Exonic
925942950 2:8837479-8837501 TTCCGCCGGAGCTGAGGACCAGG - Exonic
927050539 2:19323818-19323840 ATCCACCACAGCAGATGCCCAGG + Intergenic
927328412 2:21833504-21833526 TTCCATCATAGCTGAAGCTTAGG + Intergenic
927895804 2:26780967-26780989 TTCCACCAGCTTTGAATCCCAGG + Exonic
932731107 2:74222535-74222557 TCCCACCGGAGCTGGAGCACAGG - Intronic
932779018 2:74548752-74548774 CTCCACCTGCGCTGGAGCCCTGG - Intronic
934654340 2:96109390-96109412 TTCCACGAGAGCAGGACCCCTGG - Intergenic
937360026 2:121223168-121223190 TTAACCAAGAGCTGAAGCCCTGG + Exonic
938861763 2:135376671-135376693 TTCCCCCAGGGCTGAACCCCTGG - Intronic
939013156 2:136871091-136871113 CTTCACCAGACCAGAAGCCCAGG - Intronic
940353950 2:152718413-152718435 TTCGACCAGAGCTCGACCCCAGG - Exonic
940441397 2:153720225-153720247 TTCCAACAGACCTGAAGCTGAGG + Intergenic
943130068 2:183842762-183842784 TTCCAGCAGACCTGCAGCACAGG + Intergenic
944483868 2:200182769-200182791 TCTCACCAGAGAGGAAGCCCTGG - Intergenic
945432201 2:209777367-209777389 TTCCACCCCAGCTGGAGCCTCGG - Exonic
945672054 2:212814074-212814096 TTGCATCAGAGATGAAGCCTGGG - Intergenic
946413555 2:219527609-219527631 TTCAAACAGAACTGAACCCCAGG - Intronic
946481684 2:220063089-220063111 TTTGAGCAGAGCCGAAGCCCAGG - Intergenic
946544207 2:220718755-220718777 TTCCACCAGAATTGAAACACTGG - Intergenic
947887190 2:233583067-233583089 TTCCAACAGAGCTGCAGCTGAGG - Intergenic
948429277 2:237908959-237908981 TGCCACCAGGGCTGCAGCCAGGG - Intronic
1168869063 20:1113537-1113559 TTCCACCTGTCCTGAACCCCAGG - Intronic
1169084618 20:2819038-2819060 TCCTATCAGAGCTAAAGCCCAGG + Intronic
1169303355 20:4466004-4466026 CTCCACTAGAGATGAAGCTCTGG + Intergenic
1170848547 20:19982742-19982764 TTTCACCAGAGCTCTGGCCCAGG + Intronic
1173569711 20:44068417-44068439 TTCACCCAGAGCTGAGGACCGGG + Intronic
1174277064 20:49411585-49411607 GGCCACCTGAGCTGCAGCCCCGG + Intronic
1175332261 20:58173451-58173473 TTCCCCCAGAGATGAAGCTGGGG + Intergenic
1175966946 20:62664546-62664568 CCCCACCTGAGCTGAAGCTCTGG + Intronic
1176045093 20:63088427-63088449 TTACACCACAGCTGCAGCCCAGG - Intergenic
1178056921 21:28810134-28810156 TTCCCCAAGAGCTGAAGACATGG - Intergenic
1178234843 21:30829524-30829546 TACCACCAAAGCTGTAGCCCAGG + Exonic
1180612709 22:17108331-17108353 TCCCCCCACCGCTGAAGCCCAGG + Exonic
1180758904 22:18183821-18183843 TCCCACCCTAGCTGAAGCCATGG + Intergenic
1180769191 22:18367612-18367634 TCCCACCCTAGCTGAAGCCATGG + Intergenic
1180777121 22:18494783-18494805 TCCCACCCTAGCTGAAGCCATGG - Intergenic
1180809841 22:18752092-18752114 TCCCACCCTAGCTGAAGCCATGG - Intergenic
1180827063 22:18870841-18870863 TCCCACCCTAGCTGAAGCCATGG + Intergenic
1181195984 22:21186344-21186366 TCCCACCCTAGCTGAAGCCATGG - Intergenic
1181213544 22:21306780-21306802 TCCCACCCTAGCTGAAGCCATGG + Intergenic
1181471240 22:23141570-23141592 AGCCAACATAGCTGAAGCCCTGG - Intronic
1181524231 22:23470091-23470113 TCCCACCCCAGCTGAAGCCCGGG + Intergenic
1183938769 22:41280528-41280550 TTTCCCCAGAGCTGAGGCTCTGG - Intronic
1184757074 22:46522860-46522882 TTTCACCAGAGATGAGGCCTGGG - Intronic
1185331327 22:50253274-50253296 ATCCATCAGAGCAGACGCCCGGG - Exonic
1203230815 22_KI270731v1_random:108497-108519 TCCCACCCTAGCTGAAGCCATGG + Intergenic
1203277208 22_KI270734v1_random:96746-96768 TCCCACCCTAGCTGAAGCCATGG + Intergenic
950217378 3:11169079-11169101 TTCCTGCAGACCTCAAGCCCAGG - Intronic
950439893 3:13004463-13004485 TCCCACCAGATCTGGAGCCTTGG + Intronic
951031867 3:17891773-17891795 TTCCACAAGAGGAGAAGCACAGG - Intronic
951608960 3:24470048-24470070 TACTCCCAAAGCTGAAGCCCTGG + Intronic
952897134 3:38085203-38085225 TACCAGCTGAGCTCAAGCCCTGG + Intronic
953144130 3:40258255-40258277 TTCCACCTGAGGAGAAGGCCTGG + Exonic
953513438 3:43566600-43566622 TTCCAACAGACCTGAAGCTGAGG + Intronic
953792373 3:45958090-45958112 GTCTACCAGAGCTGCAGCCTTGG - Intronic
955887330 3:63614377-63614399 TTCCATCAAACCTGAGGCCCTGG + Intronic
955941674 3:64151954-64151976 TCACAGCAGAGCTTAAGCCCAGG + Intronic
956024734 3:64970883-64970905 TTCCTACAGGGCTGAAGCCAGGG - Intergenic
957625874 3:82651127-82651149 TTTCAGCAGAGATGAGGCCCTGG - Intergenic
957964438 3:87304344-87304366 TGCCACCAGAGTTGAAGTACTGG - Intergenic
958090506 3:88870611-88870633 TTCCAACAGACCTGCAGCTCAGG + Intergenic
960942439 3:122943522-122943544 CTCCACCAGACCTGCAGCCGTGG - Exonic
961431752 3:126888852-126888874 TCTCCCCAGAGCGGAAGCCCAGG - Intronic
961591371 3:127984238-127984260 TTCCACCAAATCTGAAGGCGGGG - Exonic
962624544 3:137211908-137211930 CTCCAACAGACCTGCAGCCCAGG + Intergenic
966321804 3:178709352-178709374 CTTCCCTAGAGCTGAAGCCCAGG - Intronic
966971438 3:185048912-185048934 TTCAACCAGTGCAGATGCCCAGG - Intronic
969225010 4:5790364-5790386 ATCCACCAGAACTGAAGTCTAGG + Intronic
971302516 4:25453563-25453585 CTCCACCAGACCAGGAGCCCTGG - Intergenic
972786006 4:42327367-42327389 TTCCAACAGCACTGAAACCCAGG - Intergenic
973596140 4:52492335-52492357 TTCCAACAAAGCGAAAGCCCAGG + Intergenic
974683498 4:65195038-65195060 GTCCACCAGAGTGGCAGCCCAGG + Intergenic
976499983 4:85776272-85776294 TTCCAGCAGAGGTGAACTCCAGG - Intronic
980798187 4:137712279-137712301 TTCCACCAGAGCTCAAGGGATGG + Intergenic
982343503 4:154331018-154331040 TTCCACAGGAGCTCAAGTCCTGG + Intronic
984699216 4:182807792-182807814 TTGCACCAGGTCTGGAGCCCCGG + Intergenic
986203483 5:5600563-5600585 GACAAACAGAGCTGAAGCCCAGG - Intergenic
997018210 5:129963028-129963050 TACCACTGGAGCTGAAACCCTGG - Intronic
999258442 5:150222829-150222851 TTCCCCCAGACCTGCAGGCCTGG + Intronic
999384967 5:151147616-151147638 TTCAACCAGACCTGAAGCCCTGG + Intronic
999867686 5:155719165-155719187 TTCCAACAGAGCTGCAGCTGAGG - Intergenic
1000250893 5:159494383-159494405 TACCCCCAGAGCTGACTCCCAGG + Intergenic
1003092864 6:3118787-3118809 TTCTCTCAGCGCTGAAGCCCGGG + Exonic
1004494133 6:16147496-16147518 TTCCACCAGCTCAGAAGGCCCGG - Intronic
1010752762 6:79632974-79632996 TTCCACAAGAGATAAAGCCTAGG + Intronic
1011628992 6:89306589-89306611 TGCACCCAGAGCTGGAGCCCAGG + Intronic
1015296814 6:131604239-131604261 TTCCACTAGGGCTGGAGCCAAGG + Exonic
1017408702 6:154147125-154147147 TTCAACCAGAGGTGAAGTTCTGG + Intronic
1017662284 6:156686816-156686838 TTCCATCAGAGCTCCTGCCCGGG - Intergenic
1018005446 6:159617815-159617837 ATCCACCGGAGCTGGGGCCCTGG - Intergenic
1018970541 6:168525808-168525830 TCCAACCACAGCTGCAGCCCAGG - Intronic
1022418374 7:30197662-30197684 TGCCACCAGTGCAGAAGGCCAGG - Intergenic
1025194375 7:56921263-56921285 TTCAGCCAGAGTAGAAGCCCAGG - Intergenic
1025677577 7:63655690-63655712 TTCAGCCAGAGTAGAAGCCCAGG + Intergenic
1026392964 7:69920865-69920887 TTAACCCAGAGGTGAAGCCCTGG - Intronic
1029352281 7:100022637-100022659 TTCAACCAAATTTGAAGCCCTGG - Intronic
1029832446 7:103275405-103275427 TGCCACCAAAGCGGGAGCCCAGG + Intergenic
1031699125 7:124901411-124901433 TTCCAACAGACCTGCAGCCGAGG + Intronic
1032491199 7:132325892-132325914 TTCCAACACAGCTGAAAGCCAGG + Intronic
1033100081 7:138462113-138462135 TTCCACCAGAGCAAAAGGCGGGG + Intronic
1037950371 8:23015545-23015567 TGCCTTCAGAGCTGAAGCTCTGG - Intronic
1038020888 8:23551087-23551109 TTTGACCAGTGCTGAAGTCCAGG - Intronic
1038234136 8:25735569-25735591 TTCCAACAGACCTGCAGCCGAGG - Intergenic
1038642639 8:29340115-29340137 TCCCACAGGAGCTGCAGCCCAGG + Exonic
1039216015 8:35272371-35272393 TCCCCTCAGAGCTGATGCCCAGG - Intronic
1039893507 8:41700076-41700098 TTCAACTGGAGCTGGAGCCCCGG + Intronic
1041095324 8:54343708-54343730 TCCCACCAGAGCTGGAACCCAGG + Intergenic
1042961255 8:74306134-74306156 TGACATCAGAGCTGAAGGCCAGG + Intronic
1043382964 8:79722681-79722703 GTCCACTACAGCAGAAGCCCTGG + Intergenic
1045975001 8:108122288-108122310 TTCCACCAGACCTGCAGCAGAGG - Intergenic
1047757296 8:127928479-127928501 CTCTGCCAGAGCTTAAGCCCAGG + Intergenic
1048319214 8:133385443-133385465 TTCCTCCAGGCCTGGAGCCCAGG - Intergenic
1048796270 8:138152767-138152789 CCCCTCCAGAGCTGAACCCCTGG - Exonic
1049040111 8:140106217-140106239 TGCCATCAGAGCAGAGGCCCCGG + Intronic
1049352476 8:142171562-142171584 TTCCTCCCCATCTGAAGCCCAGG + Intergenic
1049940131 9:537580-537602 TTGCACCTAAGATGAAGCCCTGG + Intronic
1050900826 9:10947036-10947058 GTACACCAGAGCGAAAGCCCTGG - Intergenic
1051101099 9:13522590-13522612 TTGCACCCCAGCTGAAGACCAGG + Intergenic
1051889035 9:21924633-21924655 TTCCTCCAGGGCTTGAGCCCTGG - Intronic
1052707596 9:32011302-32011324 TCTCAGCAGAGGTGAAGCCCTGG - Intergenic
1053391172 9:37737338-37737360 ATCCACTTGAGCTGAAGCCTCGG - Intronic
1056170484 9:83980277-83980299 TCGCACCATCGCTGAAGCCCTGG - Intronic
1056553902 9:87673573-87673595 TTCCCCAAGAGCTGTAGCCTTGG - Intronic
1057381530 9:94571668-94571690 TTCGAGGAGATCTGAAGCCCAGG - Intronic
1057502259 9:95605074-95605096 TGCCACCAAATCTCAAGCCCCGG - Intergenic
1059822118 9:117984835-117984857 TTCCTCCAGACTTGGAGCCCTGG + Intergenic
1187077200 X:15947080-15947102 TTCAACCAGTGCTGAGGCCAGGG + Intergenic
1187222975 X:17347709-17347731 TTCCAACAGACCTGAAGCTGAGG - Intergenic
1187396929 X:18927196-18927218 TCCCACCAGAGATGGGGCCCAGG - Intronic
1187856059 X:23637072-23637094 CACTACCAGAGCTGAAGCACAGG + Intergenic
1188970561 X:36610307-36610329 CTCCTCCAGGGCTGAACCCCAGG - Intergenic
1189304912 X:39979639-39979661 TTCCACCACAGCCTCAGCCCAGG - Intergenic
1192138869 X:68630847-68630869 TGCCACCAGACCTGGCGCCCTGG + Intergenic
1193053930 X:77129581-77129603 GTCCACTGGAGCAGAAGCCCAGG - Intergenic
1193614071 X:83666953-83666975 GTCCACCAGTGCAGAAGCCATGG + Intergenic
1194727003 X:97410293-97410315 CTCCACCAGAGCTGCAGCTGAGG + Intronic
1195097929 X:101524048-101524070 CTGCACCAGAGCTGGAGCCAGGG + Intronic
1196602216 X:117615403-117615425 TTCCATTAGACCTAAAGCCCTGG - Intergenic
1198242801 X:134801624-134801646 TGCCATCAGTGCAGAAGCCCAGG - Intronic
1199614818 X:149648008-149648030 TTCCAGCAGAGGGGAGGCCCTGG - Intergenic
1200121382 X:153792584-153792606 TGCTGCCACAGCTGAAGCCCAGG - Intronic
1201923088 Y:19255340-19255362 TTCCAACAGAACTGAAGCTGAGG + Intergenic