ID: 900162837

View in Genome Browser
Species Human (GRCh38)
Location 1:1232443-1232465
Sequence CGCCGCCTTCCTGGCAGTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 138}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900162832_900162837 -7 Left 900162832 1:1232427-1232449 CCGCGCCCGCGCGCGCCGCCGCC 0: 1
1: 3
2: 30
3: 235
4: 1551
Right 900162837 1:1232443-1232465 CGCCGCCTTCCTGGCAGTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 138
900162830_900162837 -5 Left 900162830 1:1232425-1232447 CCCCGCGCCCGCGCGCGCCGCCG 0: 1
1: 2
2: 31
3: 179
4: 870
Right 900162837 1:1232443-1232465 CGCCGCCTTCCTGGCAGTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 138
900162824_900162837 10 Left 900162824 1:1232410-1232432 CCGCAGCCCGCCTCCCCCCGCGC 0: 1
1: 0
2: 8
3: 113
4: 1157
Right 900162837 1:1232443-1232465 CGCCGCCTTCCTGGCAGTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 138
900162829_900162837 -4 Left 900162829 1:1232424-1232446 CCCCCGCGCCCGCGCGCGCCGCC 0: 1
1: 1
2: 72
3: 205
4: 1239
Right 900162837 1:1232443-1232465 CGCCGCCTTCCTGGCAGTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 138
900162831_900162837 -6 Left 900162831 1:1232426-1232448 CCCGCGCCCGCGCGCGCCGCCGC 0: 1
1: 2
2: 26
3: 200
4: 1139
Right 900162837 1:1232443-1232465 CGCCGCCTTCCTGGCAGTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 138
900162821_900162837 28 Left 900162821 1:1232392-1232414 CCCCAGGGCGATGTCGGGCCGCA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 900162837 1:1232443-1232465 CGCCGCCTTCCTGGCAGTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 138
900162823_900162837 26 Left 900162823 1:1232394-1232416 CCAGGGCGATGTCGGGCCGCAGC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 900162837 1:1232443-1232465 CGCCGCCTTCCTGGCAGTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 138
900162825_900162837 4 Left 900162825 1:1232416-1232438 CCCGCCTCCCCCCGCGCCCGCGC 0: 1
1: 1
2: 15
3: 167
4: 1389
Right 900162837 1:1232443-1232465 CGCCGCCTTCCTGGCAGTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 138
900162822_900162837 27 Left 900162822 1:1232393-1232415 CCCAGGGCGATGTCGGGCCGCAG 0: 1
1: 0
2: 1
3: 3
4: 53
Right 900162837 1:1232443-1232465 CGCCGCCTTCCTGGCAGTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 138
900162828_900162837 -3 Left 900162828 1:1232423-1232445 CCCCCCGCGCCCGCGCGCGCCGC 0: 1
1: 4
2: 20
3: 184
4: 910
Right 900162837 1:1232443-1232465 CGCCGCCTTCCTGGCAGTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 138
900162827_900162837 0 Left 900162827 1:1232420-1232442 CCTCCCCCCGCGCCCGCGCGCGC 0: 1
1: 4
2: 34
3: 259
4: 1502
Right 900162837 1:1232443-1232465 CGCCGCCTTCCTGGCAGTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 138
900162826_900162837 3 Left 900162826 1:1232417-1232439 CCGCCTCCCCCCGCGCCCGCGCG 0: 1
1: 2
2: 12
3: 130
4: 1172
Right 900162837 1:1232443-1232465 CGCCGCCTTCCTGGCAGTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900162837 Original CRISPR CGCCGCCTTCCTGGCAGTGC TGG Exonic
900162837 1:1232443-1232465 CGCCGCCTTCCTGGCAGTGCTGG + Exonic
900357839 1:2273304-2273326 CTCCTCCTTCCCGCCAGTGCCGG + Intronic
902723854 1:18322636-18322658 CGCCCCCTGCCTGCCAGTCCTGG + Intronic
903192651 1:21665643-21665665 CACCACCTGCCTGACAGTGCTGG + Intronic
904611136 1:31726976-31726998 CGCCCCCTCCCAGGCAGGGCTGG + Intergenic
904681896 1:32234962-32234984 CACCACCTGCCTGGCAGTCCAGG - Intergenic
906320096 1:44810363-44810385 TGAGGCCTTCCTGGCAGTGCTGG + Exonic
907924373 1:58941945-58941967 AGAACCCTTCCTGGCAGTGCAGG + Intergenic
910839307 1:91546440-91546462 CGCCGAGTCCCTGGCAGTCCCGG + Intergenic
911631913 1:100193000-100193022 CGCAGCCTTAGTGGCAGTGCTGG - Exonic
923549907 1:234955313-234955335 AGCTGCCTTCCAGGAAGTGCTGG + Intergenic
1064250035 10:13699887-13699909 CGCAGCTCTCCTGGCAGTGATGG - Intronic
1065102516 10:22345260-22345282 CTCCGACCTCCGGGCAGTGCAGG + Intergenic
1067117211 10:43444817-43444839 CTCGGCCTCCCAGGCAGTGCTGG + Intronic
1073137774 10:101229198-101229220 CTCCGCCTCCCTCGCAGTCCGGG - Exonic
1073147847 10:101292196-101292218 CGCCCCCCTCCAGGCAGTCCTGG + Intergenic
1073325571 10:102642668-102642690 CGCCGCCTTCCTCGCGGCGGCGG + Intergenic
1075055424 10:119214932-119214954 TGGCGCCTTCCAGGCAGAGCAGG + Intronic
1075129545 10:119726234-119726256 CGCCGCCTCCCTGGGCGCGCGGG + Exonic
1077244739 11:1531043-1531065 TGCGGCCTGCCTGGCAGTCCTGG + Intergenic
1081604887 11:44520829-44520851 CTGCTCCATCCTGGCAGTGCGGG + Intergenic
1084275403 11:68048813-68048835 CGGGGACTTCCTGGCAGTGATGG + Intronic
1089138875 11:116270772-116270794 CCCCTCCCTCCTGGCAGAGCTGG + Intergenic
1090979832 11:131709827-131709849 TCCCTCCTTCCTGTCAGTGCTGG - Intronic
1090988670 11:131796276-131796298 TGCTGCCTGCCTGGCTGTGCTGG + Intronic
1091348072 11:134868695-134868717 CGCCGTCTTCCTGGGAGAGGAGG + Intergenic
1096271205 12:50167439-50167461 GCCCGCCTCCCTGGCAGGGCCGG + Intronic
1102030698 12:109738533-109738555 CGCAGCCTTCCTGGGGGTGGTGG - Intronic
1104109006 12:125688484-125688506 AGCTGCCTGCCTGACAGTGCAGG + Intergenic
1108004859 13:45936008-45936030 CTCAGCCTTCCTGGAAGTGAAGG + Intergenic
1113435314 13:110286612-110286634 CACCGCCTTTCTGGCACTCCGGG - Intronic
1113585039 13:111459070-111459092 CGCCTCCTTCCTGGGAGTGTGGG + Intergenic
1116950721 14:50876135-50876157 TGCCGCCTTCATGGCAGGGGTGG + Intronic
1118404776 14:65412606-65412628 CGCCCCCTTCCTCGCTGCGCCGG - Intronic
1119831535 14:77707430-77707452 CGCCGCATCCCTGTCAGTTCTGG + Intronic
1124248901 15:28094935-28094957 CGTCCCCTTCCCGGCAGGGCAGG - Intronic
1125596905 15:40893311-40893333 CGCCACCGTCCTGGCTCTGCTGG - Intergenic
1128152738 15:65373353-65373375 CTCGGCCCTCCCGGCAGTGCAGG - Intronic
1131401109 15:92126278-92126300 TGCCGCCTTCCTGCCTGTTCAGG + Intronic
1133029706 16:3004552-3004574 CGCCGCCGTGCTCGCACTGCAGG + Intergenic
1138559066 16:57789175-57789197 CGCAGCCTCCTTGGCAGTCCTGG - Intronic
1141486693 16:84344936-84344958 GGCAGCCCTCCTGGCTGTGCCGG + Intergenic
1141531131 16:84648127-84648149 CGCCTCCTTCCGGGCTGAGCGGG - Intergenic
1142202706 16:88768696-88768718 TGCGCCCTTCCTGGCAGTGAGGG + Intronic
1142490331 17:274386-274408 GGCAGCCTTCCTGGCACTTCAGG + Intronic
1142639955 17:1280052-1280074 CGCCGCATTCCTGGACCTGCCGG + Exonic
1142994718 17:3753794-3753816 GGCCAGCTTCCTGCCAGTGCTGG - Exonic
1144081550 17:11768300-11768322 CGCTGCCTTCCTGGAGGAGCTGG + Intronic
1144444558 17:15314926-15314948 CCCTGTCTGCCTGGCAGTGCAGG - Intronic
1147782991 17:42957075-42957097 CTCCGCCTCCCTCCCAGTGCTGG + Intronic
1148846503 17:50533001-50533023 GGCCCCCTCCCTGGCAGTGGCGG + Intronic
1151329725 17:73399566-73399588 CGCCTTCTTCCTGGCAGTTCTGG + Intronic
1151378405 17:73707873-73707895 CCCCCAGTTCCTGGCAGTGCTGG + Intergenic
1158648816 18:59269127-59269149 CGCCGCCCTCCTACCCGTGCGGG - Exonic
1160921808 19:1524183-1524205 CGCCGCCTTCCTGCGAGACCCGG + Intronic
1161458038 19:4379762-4379784 AGCAGCCATCCTGGCAGTGAGGG - Intronic
1162022763 19:7875121-7875143 CCCAGACTTCCTGGCAGAGCTGG + Intergenic
1162033468 19:7927054-7927076 TGCAGCCGTCCTGGCAGAGCTGG + Exonic
1162461766 19:10817840-10817862 GGCCGCCTTCCTGGTGCTGCCGG - Intronic
1162772434 19:12957204-12957226 CGCCGCCATCTTGGCTGTGCGGG + Exonic
1163167512 19:15508249-15508271 CCCCGCCCTCCTGCCACTGCTGG - Intergenic
1167036910 19:47000167-47000189 CGCAGCCTCCCAGGCAGGGCAGG + Intronic
1168544688 19:57240674-57240696 GGCCGCCTCCCTGGCGGCGCTGG + Intronic
1168581335 19:57558177-57558199 CACACCCATCCTGGCAGTGCTGG - Intronic
926429114 2:12767766-12767788 CGCCGCACTGCTGGCACTGCCGG - Intergenic
934561660 2:95316714-95316736 CCCTGCCTTCCTCGCAGTGAGGG - Intronic
937242911 2:120474158-120474180 CACCGGCTCCCTGGCAGAGCAGG - Intergenic
940251318 2:151679727-151679749 CGCCGCCTGCCTGGCAGCTTTGG + Exonic
940888430 2:159011829-159011851 CTCCTGCTTCCTGGCAGTGTTGG + Intronic
942595399 2:177587404-177587426 AGCCACCTTCCTGGCTGTACAGG + Intergenic
943621794 2:190156664-190156686 CGCAGCCTTGCTGGGAGTGAGGG + Intronic
945850691 2:215003140-215003162 CTCCCCCTCCCTGGCACTGCTGG - Intronic
949020589 2:241739025-241739047 TCCCACCTTCCTGCCAGTGCAGG - Intronic
1168851122 20:977860-977882 CGATGCCCGCCTGGCAGTGCAGG + Intronic
1168904591 20:1392986-1393008 CGCCGCCGCCATGGGAGTGCAGG - Exonic
1169824022 20:9746259-9746281 TGCCTCCATCATGGCAGTGCAGG + Intronic
1171227669 20:23454901-23454923 CCCAGCCTTCCTTGCAGTGGGGG + Intergenic
1180180344 21:46116095-46116117 GGGAGCCTGCCTGGCAGTGCTGG - Intronic
1180193984 21:46182687-46182709 CGCCGCCCTCCTGGCAGCTCTGG + Exonic
1180223844 21:46377228-46377250 CTCAGCCCTCCTGGCCGTGCTGG + Intronic
1180887035 22:19253253-19253275 CGCGGCCTTCCTGGCATCTCTGG - Intronic
1180948048 22:19707635-19707657 CCCCGCTTTCCTGGCTATGCAGG + Intergenic
1182427629 22:30283284-30283306 GGCCACCTTCCTAGGAGTGCTGG - Intergenic
1183107917 22:35627905-35627927 CGCCTCCTTCCTGGGGGAGCTGG - Intronic
1183271449 22:36865060-36865082 GGCCGCCTACCTGGGAGTGTGGG - Exonic
1183295998 22:37029918-37029940 CTCTGCCTTCCAAGCAGTGCTGG + Intergenic
1185369704 22:50455413-50455435 CGCTGACCTCCTGGCGGTGCTGG - Intronic
950702171 3:14758158-14758180 CACGGCCTCACTGGCAGTGCTGG - Intronic
952316616 3:32238177-32238199 GGCCGTCTCCCGGGCAGTGCTGG + Intergenic
954394971 3:50288609-50288631 CGCTGCCTTCAAGGAAGTGCTGG - Exonic
954535587 3:51357174-51357196 AGCCGCCTTCCTGGCCAGGCTGG - Intronic
956678231 3:71754508-71754530 CGCGGCCTTCCCGCCAGTGCTGG + Exonic
960592999 3:119383120-119383142 TGCAGCCTTCCTTGCAGTCCGGG + Exonic
961211891 3:125131899-125131921 CGCCAACTCCCTGGCAGTACTGG + Intronic
961647030 3:128398119-128398141 CTGCCCCTTCCTGGCATTGCTGG + Intronic
964087602 3:152835824-152835846 CGCTGCCTTCCTGGCCGGTCCGG + Exonic
966806952 3:183815294-183815316 CTGCCCCTTCCTGGCAGTGCTGG - Intergenic
967939349 3:194754334-194754356 CCCCGGATGCCTGGCAGTGCAGG + Intergenic
977877509 4:102166277-102166299 CTCTGCCTTCATGGCATTGCTGG - Intergenic
985563250 5:602457-602479 CTGGGCCTTCCTGGCAGTGGAGG + Intergenic
985649672 5:1101543-1101565 CGCCGCCTTCATGGCTGAGGAGG - Intronic
985653006 5:1115719-1115741 CGCCTTCTGCCTGGCAGGGCCGG + Intergenic
985780116 5:1866074-1866096 CGCCACCTTCCTGTAAGCGCTGG + Intergenic
986208236 5:5646120-5646142 ACCTGCCTTCCTGGCAGAGCTGG + Intergenic
992636493 5:78729926-78729948 CGCAGCCTTCGTGGCAGCACAGG + Intronic
993915765 5:93741511-93741533 TGCCCCCTTCCAGGCAGTGGTGG - Exonic
997302400 5:132814924-132814946 CGCCGCCTTCTTGGCGATCCAGG + Exonic
998136194 5:139675978-139676000 GGCCACCTTCCTGGCAGTGGAGG - Intronic
998451166 5:142235665-142235687 CCCCTCCTGCCTGGCAGGGCTGG + Intergenic
1000188611 5:158886022-158886044 CCTGGCCTTGCTGGCAGTGCTGG + Intronic
1001568645 5:172716215-172716237 TTCTGCCTTCCTGGCAGTGCTGG - Intergenic
1001704294 5:173730679-173730701 TGGGGCCTTCCTGGCACTGCCGG + Intergenic
1002029295 5:176416270-176416292 GGCCGCCTTCCTGGCCCAGCAGG - Exonic
1003645210 6:7909408-7909430 CACAGCTTTCCTGCCAGTGCCGG - Intronic
1011984159 6:93420633-93420655 CGCAGCCTTCCTTGCCGTTCGGG - Intergenic
1014818137 6:125957166-125957188 CGCCGCCCACCTCGCAGTGCAGG - Exonic
1018740040 6:166721599-166721621 GGCAGCTTTCCGGGCAGTGCTGG + Intronic
1018765012 6:166926016-166926038 CGCCACCTGACTGTCAGTGCTGG - Intronic
1019268282 7:131404-131426 CCCAGCCTTCCTTCCAGTGCAGG + Intergenic
1019500862 7:1364193-1364215 CGCTGCCTTCCTGGGCGTGCTGG + Intergenic
1019685488 7:2379717-2379739 TGGCGCCTTTCAGGCAGTGCTGG + Intronic
1020071212 7:5228164-5228186 CGCCGCCCTCCTGGGGGTCCAGG - Exonic
1026968688 7:74455047-74455069 TTCCACCCTCCTGGCAGTGCTGG + Intronic
1032011895 7:128352349-128352371 CGCCCCCTGCCTGGCGCTGCTGG - Exonic
1034704341 7:153127281-153127303 CGCCCCACTCCTGGCAGTACTGG + Intergenic
1035578445 8:724510-724532 CGCCCCCGTCGGGGCAGTGCCGG - Intronic
1036912154 8:12766319-12766341 CCCCGCCTTCCTGGGTGTTCTGG + Intergenic
1040468192 8:47714595-47714617 CCCCGGCTTCCTGCCTGTGCTGG + Intronic
1045485396 8:102627492-102627514 TGCTGCCTTCCTGGATGTGCTGG - Intergenic
1049204554 8:141357719-141357741 AGCCATCTTCCTGGCAGGGCTGG - Exonic
1049475647 8:142795875-142795897 GGCCTCCTGCCTGGCAGAGCTGG - Intergenic
1049569096 8:143360020-143360042 CGCCCCCTTCCCGGCAGCACCGG - Intergenic
1049661287 8:143820812-143820834 GGCGGCCTCCCTGGCAGGGCGGG - Intronic
1057900514 9:98944399-98944421 CGGCTACCTCCTGGCAGTGCAGG + Intronic
1058157699 9:101533701-101533723 CGCCGCCTCCCTAGCAACGCTGG - Intergenic
1058985915 9:110208133-110208155 CTCCCCTTTCCTGGCAGAGCTGG + Exonic
1060724396 9:125997571-125997593 CAGCGCCTCCCTGGCAGAGCAGG - Intergenic
1061403598 9:130381872-130381894 CTGAGCCTTCATGGCAGTGCTGG - Intronic
1061651758 9:132055984-132056006 CACTGCCTTCCTGGCTGTCCTGG - Intronic
1061955861 9:133961016-133961038 CGACGCCTGCCTGGGAGCGCAGG + Intronic
1062464901 9:136676590-136676612 CGCCTTCTACCTGGCAGTCCAGG - Exonic
1062673312 9:137724279-137724301 CTCCTCCCTCCTGGCAGGGCGGG - Intronic
1189303924 X:39972674-39972696 CCAGGCCTTCCTGGCAGTGATGG + Intergenic
1189325555 X:40109006-40109028 CGCCGCGTTCCCGGGAGTGTGGG - Intronic
1190490649 X:50979485-50979507 GGCCTCCTTCCTGGGAGGGCCGG - Intergenic
1192889904 X:75379064-75379086 AGCCGCCTTCTTAGCAGTCCAGG + Intronic
1193095783 X:77547286-77547308 GGCAGCCTTGCTGGCAGTGTTGG - Intronic
1194980349 X:100433918-100433940 AGCCACATTCCTGGCTGTGCTGG - Intergenic
1198413577 X:136396478-136396500 CTCCGCCTCCCTGGCAGAGGTGG + Intronic
1200179930 X:154144008-154144030 CGCCACCTTCCTGGCGGGGATGG + Intergenic
1201977629 Y:19869819-19869841 CTCAGCCTTCGTGGCAGTGGTGG + Intergenic