ID: 900163081

View in Genome Browser
Species Human (GRCh38)
Location 1:1233518-1233540
Sequence CTGTCCCCGACCGGCTCACG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 45}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900163071_900163081 1 Left 900163071 1:1233494-1233516 CCCGGCCGCACGCTGACCCCCGT 0: 1
1: 0
2: 0
3: 4
4: 97
Right 900163081 1:1233518-1233540 CTGTCCCCGACCGGCTCACGGGG 0: 1
1: 0
2: 2
3: 5
4: 45
900163073_900163081 -4 Left 900163073 1:1233499-1233521 CCGCACGCTGACCCCCGTGCTGT 0: 1
1: 0
2: 2
3: 16
4: 160
Right 900163081 1:1233518-1233540 CTGTCCCCGACCGGCTCACGGGG 0: 1
1: 0
2: 2
3: 5
4: 45
900163067_900163081 22 Left 900163067 1:1233473-1233495 CCTCAGCGAGCCTGAGCCGGGCC 0: 1
1: 0
2: 2
3: 15
4: 188
Right 900163081 1:1233518-1233540 CTGTCCCCGACCGGCTCACGGGG 0: 1
1: 0
2: 2
3: 5
4: 45
900163064_900163081 28 Left 900163064 1:1233467-1233489 CCTGGACCTCAGCGAGCCTGAGC 0: 1
1: 0
2: 2
3: 18
4: 203
Right 900163081 1:1233518-1233540 CTGTCCCCGACCGGCTCACGGGG 0: 1
1: 0
2: 2
3: 5
4: 45
900163070_900163081 6 Left 900163070 1:1233489-1233511 CCGGGCCCGGCCGCACGCTGACC 0: 1
1: 0
2: 1
3: 26
4: 272
Right 900163081 1:1233518-1233540 CTGTCCCCGACCGGCTCACGGGG 0: 1
1: 0
2: 2
3: 5
4: 45
900163072_900163081 0 Left 900163072 1:1233495-1233517 CCGGCCGCACGCTGACCCCCGTG 0: 1
1: 0
2: 2
3: 4
4: 112
Right 900163081 1:1233518-1233540 CTGTCCCCGACCGGCTCACGGGG 0: 1
1: 0
2: 2
3: 5
4: 45
900163069_900163081 12 Left 900163069 1:1233483-1233505 CCTGAGCCGGGCCCGGCCGCACG 0: 1
1: 0
2: 3
3: 16
4: 209
Right 900163081 1:1233518-1233540 CTGTCCCCGACCGGCTCACGGGG 0: 1
1: 0
2: 2
3: 5
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900163081 Original CRISPR CTGTCCCCGACCGGCTCACG GGG Exonic