ID: 900164658

View in Genome Browser
Species Human (GRCh38)
Location 1:1239873-1239895
Sequence CAGGGTCGGCCTGCGGTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900164649_900164658 -5 Left 900164649 1:1239855-1239877 CCAGCCCCGGCCAGGCAGCAGGG No data
Right 900164658 1:1239873-1239895 CAGGGTCGGCCTGCGGTTCTGGG No data
900164647_900164658 -4 Left 900164647 1:1239854-1239876 CCCAGCCCCGGCCAGGCAGCAGG No data
Right 900164658 1:1239873-1239895 CAGGGTCGGCCTGCGGTTCTGGG No data
900164643_900164658 4 Left 900164643 1:1239846-1239868 CCGATGCCCCCAGCCCCGGCCAG No data
Right 900164658 1:1239873-1239895 CAGGGTCGGCCTGCGGTTCTGGG No data
900164651_900164658 -9 Left 900164651 1:1239859-1239881 CCCCGGCCAGGCAGCAGGGTCGG No data
Right 900164658 1:1239873-1239895 CAGGGTCGGCCTGCGGTTCTGGG No data
900164640_900164658 20 Left 900164640 1:1239830-1239852 CCCACGGCAGGAGTGTCCGATGC No data
Right 900164658 1:1239873-1239895 CAGGGTCGGCCTGCGGTTCTGGG No data
900164645_900164658 -2 Left 900164645 1:1239852-1239874 CCCCCAGCCCCGGCCAGGCAGCA No data
Right 900164658 1:1239873-1239895 CAGGGTCGGCCTGCGGTTCTGGG No data
900164646_900164658 -3 Left 900164646 1:1239853-1239875 CCCCAGCCCCGGCCAGGCAGCAG No data
Right 900164658 1:1239873-1239895 CAGGGTCGGCCTGCGGTTCTGGG No data
900164653_900164658 -10 Left 900164653 1:1239860-1239882 CCCGGCCAGGCAGCAGGGTCGGC No data
Right 900164658 1:1239873-1239895 CAGGGTCGGCCTGCGGTTCTGGG No data
900164641_900164658 19 Left 900164641 1:1239831-1239853 CCACGGCAGGAGTGTCCGATGCC No data
Right 900164658 1:1239873-1239895 CAGGGTCGGCCTGCGGTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900164658 Original CRISPR CAGGGTCGGCCTGCGGTTCT GGG Intergenic
No off target data available for this crispr