ID: 900165199

View in Genome Browser
Species Human (GRCh38)
Location 1:1241725-1241747
Sequence TGCCAGAGCCAAAATGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 184}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900165189_900165199 19 Left 900165189 1:1241683-1241705 CCTGGACGTCCTGAGGCCAGTTT 0: 1
1: 0
2: 0
3: 11
4: 116
Right 900165199 1:1241725-1241747 TGCCAGAGCCAAAATGGGGTGGG 0: 1
1: 0
2: 0
3: 17
4: 184
900165190_900165199 10 Left 900165190 1:1241692-1241714 CCTGAGGCCAGTTTACACTCTTT 0: 1
1: 0
2: 0
3: 12
4: 128
Right 900165199 1:1241725-1241747 TGCCAGAGCCAAAATGGGGTGGG 0: 1
1: 0
2: 0
3: 17
4: 184
900165192_900165199 3 Left 900165192 1:1241699-1241721 CCAGTTTACACTCTTTGGTGTGG 0: 1
1: 0
2: 1
3: 9
4: 132
Right 900165199 1:1241725-1241747 TGCCAGAGCCAAAATGGGGTGGG 0: 1
1: 0
2: 0
3: 17
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900165199 Original CRISPR TGCCAGAGCCAAAATGGGGT GGG Intergenic
900165199 1:1241725-1241747 TGCCAGAGCCAAAATGGGGTGGG + Intergenic
900365138 1:2308932-2308954 TCCCAGAGCCGAAGTGGGGAAGG - Exonic
900387338 1:2416625-2416647 CCCCAGAGCCAAGATGGGGAGGG + Intergenic
905326050 1:37152739-37152761 TACCAGAGCCAAAGTTGGGAAGG - Intergenic
906720871 1:48003534-48003556 TGAAAGGGCCAACATGGGGTAGG + Intergenic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
912702660 1:111889745-111889767 TAACACAGACAAAATGGGGTAGG + Intronic
913296818 1:117329606-117329628 TGTCAGAGCCCAGATGGGATGGG + Intergenic
914294358 1:146306136-146306158 TGCATGAGCCAAACTGTGGTAGG - Intergenic
914555402 1:148756919-148756941 TGCATGAGCCAAACTGTGGTAGG - Intergenic
915631535 1:157156492-157156514 TGCCAGAGCCAGAAGGGCCTTGG - Intergenic
916674250 1:167053133-167053155 AACCAGAGCCCAAATGGGCTGGG + Exonic
920052198 1:203171031-203171053 TGGCTGAGGCAAAGTGGGGTCGG - Intronic
920069999 1:203296022-203296044 TGGCAGAGCCGTAATGGGGCTGG - Intergenic
921728868 1:218554411-218554433 TGCAAGAGAGAAAATGGGATAGG - Intergenic
922296593 1:224255160-224255182 TGCCTGGCCCAAAATGGTGTAGG + Intronic
922634548 1:227153861-227153883 TTCTAGAGCCAAAATGGGTAAGG + Intronic
924928058 1:248702718-248702740 TGCCAAAGCCAGAATGATGTGGG + Intergenic
1063323550 10:5074866-5074888 TAACACAGACAAAATGGGGTAGG - Intronic
1063972230 10:11389192-11389214 TCCCAGAGCGAGAATGTGGTTGG + Intergenic
1063978893 10:11438002-11438024 TGCCACAGCCAGCATGTGGTCGG + Intergenic
1066670077 10:37827747-37827769 TGCCAGAAGCAAACAGGGGTAGG + Intronic
1070277203 10:75018461-75018483 GGCCTGAGCCTAAATGGGTTAGG - Intronic
1070813463 10:79309875-79309897 TGGCAGAGCGAAAGTGGGGCTGG + Intronic
1073510473 10:104039572-104039594 GGCCAGAGCCAGAATGGGGCGGG + Intronic
1075083097 10:119396943-119396965 TGGCAGGGCCAAGATGGGGATGG + Intronic
1075970439 10:126647571-126647593 TGGAAGAGACAGAATGGGGTGGG + Intronic
1076405609 10:130210571-130210593 TGCCAGAGCCAAGAAGCGCTAGG - Intergenic
1078527391 11:12111036-12111058 CGCAAGCGCCAAAACGGGGTGGG + Intronic
1079569056 11:21920332-21920354 TGCCAGAGACTAAATGGGGCAGG - Intergenic
1079629541 11:22657246-22657268 TGTCAGAGCCACACAGGGGTTGG + Intronic
1080636364 11:34127297-34127319 TGGCAGGGCAAAAATGGGATGGG - Intronic
1083909742 11:65699359-65699381 CGCAAGAGCCAAAATGGTGCTGG + Intergenic
1084121644 11:67072392-67072414 TCCCAGTGCCTAGATGGGGTGGG - Intergenic
1084646514 11:70462002-70462024 TGCCAGGAACAAAATGGGGTGGG - Intergenic
1085061945 11:73455174-73455196 TGCCAGAGCCCAAAAGTGGCCGG + Intronic
1085722906 11:78929026-78929048 TGCCAGAGCACAGATGGGGTGGG - Intronic
1085790645 11:79494299-79494321 TGTGGGAGCCAAAATGGGGTTGG - Intergenic
1085867717 11:80314767-80314789 TGACAGATTCAAAATGGGTTTGG + Intergenic
1088360596 11:108985071-108985093 GGCCAGATGCAAAATGAGGTAGG + Intergenic
1090031116 11:123207238-123207260 TGCCAGATCTAACATGGGGAGGG + Intergenic
1091624368 12:2111089-2111111 TGCCAGGACCAAAATAGTGTAGG + Intronic
1094707586 12:32929292-32929314 TGACATAGACAAAATGGGGCAGG - Intergenic
1094768098 12:33620773-33620795 TGCCAGAGCCAGAAAGTGGAAGG + Intergenic
1096353475 12:50919083-50919105 GGCCAGAGGCAACATGGAGTTGG + Intergenic
1097014032 12:55972904-55972926 AGCACTAGCCAAAATGGGGTGGG - Intronic
1099322327 12:81166041-81166063 TGCCAGTGACACAATGGGGCTGG + Intronic
1102734751 12:115149397-115149419 TGCCAGTGACACCATGGGGTAGG + Intergenic
1103051455 12:117783502-117783524 GGCCAGAGCCAAAACTGGGATGG - Intronic
1103906017 12:124327574-124327596 TGCCAGCACCAACATGGGGCTGG - Exonic
1106462198 13:29980975-29980997 AGCCAAAGCCAGATTGGGGTTGG + Intergenic
1106872437 13:34036512-34036534 TGCCTGAGCCCAAATGGTCTGGG - Intergenic
1107782914 13:43924192-43924214 TGCCAGGACCAAAATAGGGAAGG - Intergenic
1108259499 13:48642639-48642661 TAACACAGACAAAATGGGGTAGG - Intergenic
1108719473 13:53116546-53116568 TACCTGATCCAAAATGGGGAAGG + Intergenic
1115521934 14:34241721-34241743 AGCCAAAGCCAGATTGGGGTTGG - Intronic
1116262934 14:42654213-42654235 TAACACAGACAAAATGGGGTAGG - Intergenic
1116486437 14:45454550-45454572 TGCCAGGGCCCAAAAGGAGTGGG - Intergenic
1117186496 14:53245463-53245485 TGACACAGACAAAATGGGATAGG - Intergenic
1117191036 14:53292147-53292169 TGCAAGAGCAGAAAAGGGGTAGG - Intergenic
1118960429 14:70524935-70524957 TGAAAGAGCCAGGATGGGGTGGG + Intronic
1121433075 14:93900911-93900933 GGGCAGAGGCAAAATGGAGTCGG - Intergenic
1121625498 14:95383026-95383048 TGCAAGAGACAGAATGGAGTGGG + Intergenic
1124598938 15:31115490-31115512 TGCTAGAGCCAGAAATGGGTAGG + Intronic
1124746220 15:32344115-32344137 TGGCTGGGCCAAAATGGGGGAGG - Intergenic
1125859700 15:42987096-42987118 TGTCAGAGCCAGACTGCGGTTGG - Intronic
1129531620 15:76270174-76270196 TGCCAGAGTCCAAGTAGGGTGGG + Intronic
1131597312 15:93811586-93811608 AGCCAAAGGCAAAATGGGGTGGG + Intergenic
1132853714 16:2035686-2035708 TGCCAGAGGTAACATGGGGCAGG + Intronic
1135062937 16:19286347-19286369 TGTCACAGCCAAGGTGGGGTTGG - Intronic
1135743341 16:24995501-24995523 TACCTGAGCTTAAATGGGGTGGG - Intronic
1136021775 16:27445114-27445136 TACCAGAGGCCATATGGGGTGGG - Intronic
1138457665 16:57130740-57130762 TGGCAGAGACAAGATGGGGAGGG + Intronic
1139179003 16:64723686-64723708 TGCCAGAGCCCAAATGAACTGGG - Intergenic
1139708403 16:68758169-68758191 TACCCTAGGCAAAATGGGGTGGG - Intronic
1140482212 16:75267701-75267723 TGCCCCAGCCAGAATGGGGCGGG + Intronic
1141464832 16:84198546-84198568 TGGCAGAGACAAAAGGGGGTTGG - Intergenic
1142548916 17:725730-725752 TGCCACAGACAAAATGTAGTAGG + Intergenic
1144103508 17:11964807-11964829 TGGAAGGGGCAAAATGGGGTTGG + Intronic
1144360793 17:14489870-14489892 AGCCAGAGGCAAAATGAAGTAGG - Intergenic
1144557379 17:16294278-16294300 TGGCAGAGAGAACATGGGGTAGG - Intronic
1146686958 17:34847580-34847602 TGCCAGACCCAGCTTGGGGTTGG - Intergenic
1146831763 17:36075762-36075784 TGCCTGAGCCAAAATGAGCAGGG + Intergenic
1147286914 17:39409585-39409607 AGCCAGAGCCAAAGTGGTTTTGG - Exonic
1147896785 17:43756541-43756563 TGCCGGAGCCAAAAGGTGCTGGG - Intronic
1148653126 17:49263926-49263948 TCCCAGAGCCAAACTAGGTTGGG + Intergenic
1148700407 17:49583343-49583365 AGGCAGAGGCAAGATGGGGTGGG + Intronic
1149290511 17:55213752-55213774 TTCCAGAGTCAAAATGGGTAGGG - Intergenic
1153019114 18:610922-610944 TGCTGGAGCCAACATGGGTTGGG + Intronic
1161494346 19:4579424-4579446 AACCAGAGGCAAAATGGGGCAGG + Intergenic
1161501490 19:4618456-4618478 TGCCAGATCCACAGTGGCGTGGG - Intergenic
1162109129 19:8390694-8390716 GGCCAGAGCCTAGAGGGGGTGGG + Intronic
1163276756 19:16289617-16289639 TGCCAGGGCCAAAATCAGGAGGG - Intergenic
1164573587 19:29391976-29391998 TGGCAGAGCCACAATGTGGAAGG + Intergenic
1167029404 19:46947532-46947554 GGCTAGAGGAAAAATGGGGTTGG - Intronic
927352142 2:22128139-22128161 TAACACAGACAAAATGGGGTAGG - Intergenic
930975362 2:57452261-57452283 AGCCAGAGTCTAAATGGGTTGGG - Intergenic
932469529 2:71944827-71944849 TGCAGGATCCAAAGTGGGGTAGG - Intergenic
933894071 2:86794656-86794678 GACCAGAGCAGAAATGGGGTTGG - Intronic
935259018 2:101338630-101338652 GGCCAGAGCCCAAAAGGGCTTGG + Intergenic
935419268 2:102850411-102850433 AGCAAGAGCCGAAATGGGGAGGG - Intergenic
937763292 2:125631185-125631207 TGGCAGAGACAAAACGGTGTCGG + Intergenic
938960556 2:136336663-136336685 TGCCAAAGACAAAATGGAGAAGG - Intergenic
939868908 2:147505911-147505933 AGTTAGAGCCAATATGGGGTTGG - Intergenic
940836775 2:158530683-158530705 TGCCACAACCAACATGGGGCAGG - Intronic
941671862 2:168302353-168302375 TGTCAGAGCAATAATAGGGTGGG + Intergenic
943340203 2:186671559-186671581 TGCAAGATCAAAAGTGGGGTTGG - Intronic
944519178 2:200546062-200546084 TGCCTGTCCCAAAATGGGGGAGG - Intronic
947455230 2:230248107-230248129 TGAGAGTGCCAACATGGGGTGGG + Intronic
947455764 2:230252558-230252580 TGAGAGTGCCAACATGGGGTGGG + Intronic
947485915 2:230548595-230548617 TGACATAGACAAAATGGGGCAGG - Intergenic
948176091 2:235944696-235944718 TGCCAGAGCCTTTATGGGGGTGG + Intronic
1173335971 20:42112672-42112694 TGAGAGAGCCAGGATGGGGTGGG - Intronic
1173876420 20:46375130-46375152 TTCCAGGGCCACCATGGGGTTGG + Intronic
1174102730 20:48139556-48139578 TGCCAAATCCAAGATGGGGATGG - Intergenic
1174286819 20:49480008-49480030 AGCCAGAGCTGAAATGGGGAGGG - Intronic
1175225972 20:57444223-57444245 TAACACAGACAAAATGGGGTAGG - Intergenic
1175226402 20:57446724-57446746 TAACACAGACAAAATGGGGTAGG + Intergenic
1175735272 20:61381701-61381723 TGCAAAGGCCAAATTGGGGTGGG - Intronic
1179402125 21:41094086-41094108 TGTCAGGGCCAGAATGGGGCGGG + Intergenic
1180920788 22:19520604-19520626 GACCAGAGCCACAATGGGGACGG - Exonic
1181001799 22:19991218-19991240 TGCCAGGGCCAAGAAAGGGTGGG + Intronic
1182369717 22:29802219-29802241 AGCCAGAGCCAAGAAGGGGAAGG + Intronic
1183701522 22:39453887-39453909 TCCCAGAGCCAAAAAGGCCTGGG + Intergenic
1183902883 22:41019738-41019760 TGCCAGAGGCACCTTGGGGTGGG - Intergenic
1184605553 22:45572316-45572338 TGCCAGAGGGAAAATGAAGTTGG - Intronic
953252815 3:41262072-41262094 AGGCAGAGCAACAATGGGGTGGG - Intronic
954654565 3:52186123-52186145 TGCCAGATCCAGCCTGGGGTTGG - Intergenic
955509442 3:59664731-59664753 TGCCAGTCCCAAAATGGGGATGG - Intergenic
955909514 3:63845718-63845740 TTCCAAAGCCAAAATGGCTTTGG - Intronic
956245015 3:67173234-67173256 TACCAGGGCCATCATGGGGTGGG - Intergenic
956654343 3:71534656-71534678 GGACAGAGCCAGAGTGGGGTTGG + Intronic
958814829 3:98903303-98903325 GGCCAGAGGCAAAATAGGCTGGG + Intergenic
960007580 3:112795892-112795914 TGCCAGGGGCAACATGGGCTAGG + Intronic
961629567 3:128286232-128286254 TGCCAGAGCCACAAAGGGAAGGG - Intronic
962222911 3:133579043-133579065 TAGCAGAGCCAAAATAGTGTGGG - Intronic
964612674 3:158630774-158630796 TAACACAGCCAAAATGGGGTAGG - Intergenic
965142951 3:164863186-164863208 TGTTAGAGCCAATATGGAGTTGG - Intergenic
965610845 3:170542474-170542496 TGCAAGAGGCAGAATGGGGAAGG - Intronic
966912283 3:184566235-184566257 TGGCAGGGCCACAGTGGGGTGGG + Intronic
969675059 4:8610054-8610076 TGGCAAAGCCAGAAAGGGGTTGG - Intronic
971359582 4:25924278-25924300 TGGAAGAGTCAAAATGGTGTTGG + Intronic
973191235 4:47388395-47388417 TGCCAGGGTCGAAATGGAGTAGG + Intronic
975169063 4:71212551-71212573 GGACAGAGGCACAATGGGGTTGG + Intronic
979854921 4:125619954-125619976 TGCCAGATCTAAAATGGAATGGG + Intergenic
980744637 4:136999124-136999146 TGCCTGAGCCCCAATGGGGAGGG - Intergenic
980907082 4:138958698-138958720 TGCCAGAAAGGAAATGGGGTTGG + Intergenic
983520412 4:168702599-168702621 TGCTAGAGCCAAAATGCTGAAGG - Intronic
983901315 4:173137949-173137971 TACCAGAGCCCAAATGGGATAGG + Intergenic
985343568 4:188976952-188976974 TGCAAAATCCAAAATGGGCTGGG - Intergenic
989345458 5:40424614-40424636 TGCCAGAGACAGTATGGGGTGGG - Intergenic
992559936 5:77941378-77941400 AGCCACAGCCAAGATGGGGGTGG - Intergenic
994321642 5:98401612-98401634 TGTCAGAGCCAAAGTAGGGAAGG - Intergenic
999997695 5:157107799-157107821 TAACACAGACAAAATGGGGTAGG - Intronic
1001426212 5:171624185-171624207 TGCCACAGCCACCCTGGGGTGGG + Intergenic
1002170428 5:177371438-177371460 GGTCAGAGCCAAAATCGGGAGGG - Intronic
1006580612 6:35075102-35075124 TGCCAGGGCAAAAATAAGGTTGG + Intronic
1006988844 6:38195560-38195582 AGTCAGAGCCAGTATGGGGTTGG - Intronic
1007414354 6:41683356-41683378 TGCCAGAGCCAGAGCGGGGCGGG + Intergenic
1008147849 6:47913119-47913141 TGACACAACCAATATGGGGTAGG - Intronic
1009402853 6:63276898-63276920 GGCCAAAGACAAATTGGGGTAGG - Intronic
1009700451 6:67171153-67171175 TGCCAGAGCCAACATGAAGAAGG - Intergenic
1009937175 6:70247869-70247891 TGCCAGTGCCTAGATGGAGTGGG + Intronic
1011677724 6:89751556-89751578 TTCCAGAGCCAAAAGGAGGTCGG - Exonic
1019181353 6:170188925-170188947 TGCCAGACCCAAGCTGGGGCAGG + Intergenic
1019650218 7:2152833-2152855 TGCCAGTGTGAAAATGGGCTTGG - Intronic
1024874794 7:54009412-54009434 TTCCAGAGGCAACATGGGATTGG - Intergenic
1026139768 7:67695739-67695761 TGTGGGAGCCAAAATGGGGAAGG - Intergenic
1028617536 7:92785805-92785827 TGCCAAAGCCAAAATGTTTTTGG + Intronic
1032506466 7:132438418-132438440 TGACATAGCAAAAATAGGGTAGG + Intronic
1033218366 7:139510727-139510749 TGCCAGAACCAACGTGGGTTAGG + Intergenic
1037498225 8:19461356-19461378 TCCCAGGGCCCAAATGAGGTGGG + Intronic
1038528283 8:28295911-28295933 CACCAGGGCCCAAATGGGGTTGG - Intergenic
1043753395 8:83969982-83970004 TGCCAGATACAAAATGCTGTAGG - Intergenic
1044030776 8:87233758-87233780 TGCCACAGCCAAACTGGGCATGG - Intronic
1044624231 8:94220518-94220540 TGCCAGAATCAAAATGGAGTTGG + Intergenic
1044699586 8:94953633-94953655 TGCCAGAGGCAACCTGAGGTGGG + Intronic
1044790626 8:95843216-95843238 AGCCAGTGACAAAATGGGATGGG + Intergenic
1045346751 8:101300444-101300466 TGCCAGAGCAGAAATGGGAGAGG + Intergenic
1045417285 8:101980039-101980061 AGCCAAGGCCAAAATGGGGGTGG + Intronic
1047180094 8:122579211-122579233 TGCCAGAACCAAAGTGCGGTAGG - Intergenic
1047249978 8:123174698-123174720 TGCCAGCCCCAAACTGGGATAGG + Intergenic
1047763301 8:127970078-127970100 TTCAAGAGCCAAAGGGGGGTTGG - Intergenic
1048227768 8:132605929-132605951 TGTCAGGGACATAATGGGGTCGG + Intronic
1049835905 8:144735421-144735443 TGCCAGAGTGAAAAGGGGGCTGG + Intronic
1050710112 9:8451807-8451829 TGGCAGAGCCACAATGGGAAGGG - Intronic
1053000691 9:34575774-34575796 TGACAGAGCCAGAGTTGGGTGGG + Intronic
1054810895 9:69433103-69433125 TGCCTGAGCCACCATGGGGCTGG + Intronic
1056664573 9:88571552-88571574 TACCAGAGCCAAATTGTGGTAGG - Intronic
1057162007 9:92895487-92895509 TGACAGGGCCATGATGGGGTGGG + Intergenic
1058968988 9:110063040-110063062 TAGCACAGACAAAATGGGGTAGG - Intronic
1186182270 X:6984925-6984947 TGCCTGAGCCATTATGGGGCTGG + Intergenic
1189971810 X:46425641-46425663 TCCCAGAGACAGAATTGGGTAGG - Intergenic
1191961728 X:66710837-66710859 AGAGAGAACCAAAATGGGGTTGG + Intergenic
1192039889 X:67607856-67607878 TCCCAGAGCCAAAATACGGCAGG - Intronic
1192607707 X:72536744-72536766 TACCAGAGCCAAAAAAGGTTGGG - Intronic
1195254096 X:103076783-103076805 TGACATAGAGAAAATGGGGTGGG - Intronic
1195257806 X:103106055-103106077 TCCCAGAGCCAAGATGGCTTTGG + Intergenic
1196732372 X:118953759-118953781 CACAAGTGCCAAAATGGGGTGGG + Intergenic
1201765084 Y:17568081-17568103 TGCCCGAGACAAAATGGTGGCGG - Intergenic
1201836468 Y:18337908-18337930 TGCCCGAGACAAAATGGTGGCGG + Intergenic
1201925740 Y:19285688-19285710 TGACACAGACAAAATGGGGTAGG + Intergenic