ID: 900165486

View in Genome Browser
Species Human (GRCh38)
Location 1:1242801-1242823
Sequence CGAGCCCTCCCGCTCACACC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 106}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900165481_900165486 -7 Left 900165481 1:1242785-1242807 CCAGCCCGAGTGCACCCGAGCCC 0: 1
1: 0
2: 1
3: 10
4: 126
Right 900165486 1:1242801-1242823 CGAGCCCTCCCGCTCACACCCGG 0: 1
1: 0
2: 0
3: 8
4: 106
900165479_900165486 -2 Left 900165479 1:1242780-1242802 CCGGCCCAGCCCGAGTGCACCCG 0: 1
1: 0
2: 1
3: 17
4: 235
Right 900165486 1:1242801-1242823 CGAGCCCTCCCGCTCACACCCGG 0: 1
1: 0
2: 0
3: 8
4: 106
900165478_900165486 -1 Left 900165478 1:1242779-1242801 CCCGGCCCAGCCCGAGTGCACCC 0: 1
1: 0
2: 0
3: 27
4: 322
Right 900165486 1:1242801-1242823 CGAGCCCTCCCGCTCACACCCGG 0: 1
1: 0
2: 0
3: 8
4: 106
900165480_900165486 -6 Left 900165480 1:1242784-1242806 CCCAGCCCGAGTGCACCCGAGCC 0: 1
1: 0
2: 1
3: 16
4: 90
Right 900165486 1:1242801-1242823 CGAGCCCTCCCGCTCACACCCGG 0: 1
1: 0
2: 0
3: 8
4: 106
900165477_900165486 10 Left 900165477 1:1242768-1242790 CCGAGCTCACACCCGGCCCAGCC 0: 1
1: 0
2: 1
3: 42
4: 491
Right 900165486 1:1242801-1242823 CGAGCCCTCCCGCTCACACCCGG 0: 1
1: 0
2: 0
3: 8
4: 106
900165475_900165486 20 Left 900165475 1:1242758-1242780 CCTGAGTGCACCGAGCTCACACC 0: 1
1: 0
2: 0
3: 13
4: 137
Right 900165486 1:1242801-1242823 CGAGCCCTCCCGCTCACACCCGG 0: 1
1: 0
2: 0
3: 8
4: 106
900165474_900165486 21 Left 900165474 1:1242757-1242779 CCCTGAGTGCACCGAGCTCACAC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 900165486 1:1242801-1242823 CGAGCCCTCCCGCTCACACCCGG 0: 1
1: 0
2: 0
3: 8
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900165486 Original CRISPR CGAGCCCTCCCGCTCACACC CGG Intronic
900165486 1:1242801-1242823 CGAGCCCTCCCGCTCACACCCGG + Intronic
900460780 1:2801316-2801338 CCTGCCCACCCTCTCACACCTGG + Intronic
900530519 1:3150859-3150881 CCAGCCCCCCCGCCCCCACCCGG - Intronic
901471084 1:9456886-9456908 TGTGCCCTGGCGCTCACACCTGG + Intergenic
903217878 1:21853020-21853042 CGAGCCCTCCTCCTCACACGTGG - Exonic
906699794 1:47849692-47849714 CAATCCCACCGGCTCACACCAGG - Intronic
907516621 1:54997149-54997171 CGAGCCCAGCCGCTGACCCCGGG + Intergenic
908788307 1:67756600-67756622 CGTGCACTCATGCTCACACCAGG - Intronic
910892306 1:92030328-92030350 CGCTCCCTCCCGCTCCCGCCAGG - Intronic
915325538 1:155079753-155079775 CGCGCACGCCCGCTCACACTTGG - Intronic
1062772686 10:115564-115586 CCAGCCCTCCCATTCAGACCTGG - Intergenic
1070797046 10:79222962-79222984 CAAGCCCTCTTGCTCTCACCTGG + Intronic
1073124423 10:101140761-101140783 CGAGCCCTGCCCCTCAGATCTGG + Intergenic
1076865722 10:133165319-133165341 CACGCCCTCCTGCTCAGACCTGG - Intronic
1079120704 11:17682681-17682703 CTGGCCCTCTGGCTCACACCTGG + Intergenic
1083595619 11:63917248-63917270 CGGGCCCTCCCTCCCACCCCAGG - Intergenic
1084165276 11:67372579-67372601 CGCCCCCTCCCGCTCCCGCCCGG + Intronic
1085391324 11:76183732-76183754 CCAGCCCTCCAGCTCAGCCCAGG + Intergenic
1087876498 11:103364805-103364827 CATGCCCTCCCTCTCACAGCTGG - Intronic
1089643734 11:119864499-119864521 TGAGCCCTCCCCTTCTCACCTGG - Intergenic
1090362867 11:126185580-126185602 CGGTCCCTCCCGCTCAGCCCTGG + Intergenic
1094056251 12:26272440-26272462 CAACCTCTCCCGCCCACACCAGG + Intronic
1101353622 12:103956612-103956634 GTAGCCCTCCCGCACTCACCAGG + Exonic
1101680237 12:106956603-106956625 CCAGCCCTCCCTGTCACCCCTGG - Intronic
1103727893 12:123007783-123007805 CCAGCCCTTCCGGTCACCCCAGG - Intronic
1104486205 12:129152954-129152976 CCATCCCTCCAGCTCCCACCCGG + Intronic
1113102108 13:106732229-106732251 CCGGCCCTCCCTCTGACACCAGG + Intergenic
1114675277 14:24436185-24436207 GGAGCCCTCCCGCTGAGAACTGG + Intronic
1117315855 14:54569490-54569512 CGAGCCTCCCAGCTCACACCAGG + Intronic
1122855110 14:104556406-104556428 CCAGCCCTGCCCCTCACCCCAGG + Intronic
1124028706 15:25989920-25989942 CCAGGCCTCCTGCTCTCACCTGG - Intergenic
1124505337 15:30267671-30267693 CCAGCCCTCCTGCCCCCACCAGG - Intergenic
1124637014 15:31371817-31371839 CCTGCCCTCCCGCCCACGCCTGG - Intronic
1124738215 15:32270960-32270982 CCAGCCCTCCTGCCCCCACCAGG + Intergenic
1125726399 15:41870427-41870449 CCACCCCTCCGGCTCACACCTGG + Exonic
1128454199 15:67823477-67823499 CGGCCCCTCCCGCTCTCAGCGGG - Intronic
1129264719 15:74387495-74387517 CGAGCCCTCCCGCCCTGACCGGG - Intergenic
1129276645 15:74449945-74449967 CATGCCCTCCAGCTCATACCGGG - Exonic
1131431739 15:92393850-92393872 CGAGCCCGCTCGCTCCCTCCCGG - Exonic
1132148174 15:99440836-99440858 CAAGGCCTCCTGCTTACACCAGG - Intergenic
1132648974 16:1012007-1012029 CGGGTGCTCCTGCTCACACCAGG - Intergenic
1135114394 16:19712893-19712915 CCAGCCCTCCGGCTCACCTCAGG + Intronic
1136573067 16:31108437-31108459 CGAGCCCTTCCGCTGGGACCCGG + Intronic
1136628482 16:31476207-31476229 CGAGCCCGCCCTATCTCACCAGG + Intronic
1137717999 16:50610785-50610807 CCATCCCTCCCGCTCCCAGCTGG - Intronic
1138180077 16:54935215-54935237 GGATCCCTCCCTCTCACAACGGG + Intergenic
1138239937 16:55419299-55419321 CCAGCCCTCATGCTCCCACCAGG + Intronic
1139587850 16:67915850-67915872 CAAGCACACCTGCTCACACCTGG + Intronic
1140207841 16:72948106-72948128 GGAGCTCTCCCGCTCACTCCTGG - Intronic
1141704240 16:85655852-85655874 CGAGCTCTCCCACTCATCCCTGG + Exonic
1141741878 16:85898940-85898962 CGAGCCCCGCTCCTCACACCTGG - Exonic
1142358188 16:89613876-89613898 CGTCCCCTGCCGCACACACCTGG - Intronic
1142494276 17:298068-298090 CGTGCCCTGTGGCTCACACCTGG + Intronic
1144676796 17:17167210-17167232 GGAGCCCTCCTGCTCAGAGCAGG + Intronic
1144684874 17:17219358-17219380 TGAGCCCTCCCTCCCACCCCAGG - Intronic
1146278396 17:31529821-31529843 AGAGCCCTAATGCTCACACCTGG - Intronic
1146393762 17:32445066-32445088 CAAGCGCTCGCGCTCCCACCCGG - Intronic
1148169825 17:45509721-45509743 AGTGCCCTCTCTCTCACACCCGG + Intergenic
1148279384 17:46336087-46336109 AGTGCCCTCTCTCTCACACCCGG - Intronic
1148301601 17:46553942-46553964 AGTGCCCTCTCTCTCACACCCGG - Intronic
1148365534 17:47052944-47052966 AGTGCCCTCTCTCTCACACCCGG - Intergenic
1148553363 17:48563940-48563962 AGAGCCCTCCCGCTCAGAAAGGG - Intronic
1150400906 17:64855319-64855341 AGTGCCCTCTCTCTCACACCCGG + Intronic
1152767630 17:82149699-82149721 AGAGCCCTCCCACTGACCCCAGG + Intronic
1161407481 19:4098690-4098712 TGAGCCCTCCCGCCCCCTCCCGG + Intronic
1161457167 19:4375220-4375242 CGGGCCCTCCAGCCCCCACCTGG + Intronic
1162379075 19:10321313-10321335 AGGGCCCTCCAGCTCCCACCTGG + Intronic
1162385161 19:10356661-10356683 CGAGCCCTCCTGCCCACAGCTGG - Exonic
1162794404 19:13079059-13079081 TGTGCCTTCCCGCTCACAGCTGG - Intronic
1163625717 19:18388353-18388375 CGAGGCCTCCCGCCTTCACCGGG + Exonic
1164753013 19:30670045-30670067 CGGGCCCGCCCTCTCCCACCTGG - Intronic
1168273687 19:55264964-55264986 AGGCCCCTCCCCCTCACACCTGG + Intronic
925975213 2:9137628-9137650 CAAGCCCTCCCACCCACACCAGG + Intergenic
932212741 2:69945779-69945801 CCAGTCCACCCGCTCAGACCTGG - Intergenic
932366509 2:71156619-71156641 TGAGCCCTGCCTCTCATACCTGG + Intergenic
932571596 2:72941185-72941207 CAGGCCCTCCCCCACACACCTGG + Intergenic
1170342335 20:15343144-15343166 CCAGGCCTTCCGCTCACATCAGG + Intronic
1176157166 20:63627573-63627595 CGAGCCCTCCCGGCCGCTCCCGG - Intergenic
1181006670 22:20016792-20016814 CCAGCCCTCCCGCCCTCACGCGG + Exonic
1183293734 22:37018282-37018304 CGAGCCCTCACGCCCAGAACCGG - Exonic
950073541 3:10171174-10171196 CGAGCCCCTCTGCACACACCTGG - Intronic
960163877 3:114380227-114380249 CAAACTCTCACGCTCACACCGGG - Exonic
965555158 3:170011067-170011089 CCACCGCTCCTGCTCACACCTGG + Intergenic
966222720 3:177566572-177566594 AGAGTCCTCACGCTCACACGGGG + Intergenic
968083437 3:195863231-195863253 CGCGCCCTCCCGCTGCCTCCAGG + Intergenic
968505635 4:970105-970127 TAAGGCCTCCTGCTCACACCCGG + Intronic
968796122 4:2705920-2705942 TGAGCCATCACCCTCACACCTGG - Intronic
969726414 4:8920846-8920868 CCAGCCCTCCCACTCAGGCCCGG - Intergenic
973238007 4:47926919-47926941 AAAGCCCTCCGGCTCACCCCAGG + Intronic
985888942 5:2700882-2700904 CCAGCCCTCCACCTCACCCCTGG + Intergenic
992563316 5:77973376-77973398 CGGGCCCTCGCGCTCCCTCCAGG - Intergenic
993992445 5:94676366-94676388 CTAGTCCTGCCGATCACACCAGG + Intronic
1002193273 5:177489752-177489774 CGAGCCCACTCCCTCTCACCAGG + Exonic
1002536458 5:179878795-179878817 GGTGCCCTCCCGCCCACAGCGGG - Intronic
1002908728 6:1471914-1471936 CAGGCCCTCCCTCTCACACGTGG + Intergenic
1003873646 6:10419483-10419505 CGAGCCCTCCAGCCCATGCCCGG - Intronic
1006985813 6:38174949-38174971 CGAGCCCACCAAGTCACACCAGG + Exonic
1011470354 6:87701890-87701912 CCGCCCCTCCCGCTCTCACCCGG - Exonic
1019321726 7:419074-419096 AGAGCCTTCCCGCTCACTCCTGG - Intergenic
1020448037 7:8290763-8290785 TGAGCCCTGCTTCTCACACCTGG + Intergenic
1029590922 7:101506536-101506558 CCAGCCCTGCAGCTCACCCCTGG - Intronic
1029620273 7:101686085-101686107 CCAGCACTCCCGGCCACACCTGG + Intergenic
1034519873 7:151611612-151611634 CGAGCCCACCCCATCCCACCAGG + Intronic
1043270688 8:78329657-78329679 AGAGTCTTCCCGGTCACACCAGG - Intergenic
1047998779 8:130359570-130359592 CGCGCCCTACCCCTCACCCCCGG + Intronic
1049777597 8:144413749-144413771 CGAGGGCTCCCGCGCAGACCTGG - Exonic
1061146966 9:128805728-128805750 CCAGCCCTGGTGCTCACACCTGG + Intronic
1061728593 9:132595773-132595795 AGAGACCTCCCTCTAACACCCGG - Intronic
1062264849 9:135682272-135682294 CCAGCCCTCCCTCTGCCACCGGG + Intergenic
1062268900 9:135699863-135699885 CCAGCCCGCCCACTCCCACCAGG - Intergenic
1062339161 9:136086293-136086315 CGAGGCCTCCCACTCAGAGCTGG + Intronic
1062607104 9:137353301-137353323 CCGGCCCTCCTGCTCTCACCAGG + Intronic
1185736593 X:2500757-2500779 CGAGCCAGCCCGCGCCCACCCGG + Intronic
1189227081 X:39421944-39421966 CCAGCCCTCCTGCTCACTGCAGG - Intergenic
1195034299 X:100957437-100957459 TGAGGCCTCTCGCTCCCACCTGG + Intergenic