ID: 900165756

View in Genome Browser
Species Human (GRCh38)
Location 1:1243729-1243751
Sequence TCCCCGGTAGCCGGGAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 238}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900165756_900165768 12 Left 900165756 1:1243729-1243751 CCCTGCCTCCCGGCTACCGGGGA 0: 1
1: 0
2: 1
3: 9
4: 238
Right 900165768 1:1243764-1243786 CTGGGCATAAAGTGTGATCTGGG 0: 1
1: 0
2: 0
3: 8
4: 162
900165756_900165769 20 Left 900165756 1:1243729-1243751 CCCTGCCTCCCGGCTACCGGGGA 0: 1
1: 0
2: 1
3: 9
4: 238
Right 900165769 1:1243772-1243794 AAAGTGTGATCTGGGCCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 156
900165756_900165767 11 Left 900165756 1:1243729-1243751 CCCTGCCTCCCGGCTACCGGGGA 0: 1
1: 0
2: 1
3: 9
4: 238
Right 900165767 1:1243763-1243785 TCTGGGCATAAAGTGTGATCTGG 0: 1
1: 0
2: 1
3: 3
4: 99
900165756_900165770 21 Left 900165756 1:1243729-1243751 CCCTGCCTCCCGGCTACCGGGGA 0: 1
1: 0
2: 1
3: 9
4: 238
Right 900165770 1:1243773-1243795 AAGTGTGATCTGGGCCCCCAGGG 0: 1
1: 0
2: 1
3: 26
4: 190
900165756_900165763 -6 Left 900165756 1:1243729-1243751 CCCTGCCTCCCGGCTACCGGGGA 0: 1
1: 0
2: 1
3: 9
4: 238
Right 900165763 1:1243746-1243768 CGGGGACCCACGCTCCGTCTGGG 0: 1
1: 0
2: 0
3: 3
4: 60
900165756_900165762 -7 Left 900165756 1:1243729-1243751 CCCTGCCTCCCGGCTACCGGGGA 0: 1
1: 0
2: 1
3: 9
4: 238
Right 900165762 1:1243745-1243767 CCGGGGACCCACGCTCCGTCTGG 0: 1
1: 0
2: 0
3: 6
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900165756 Original CRISPR TCCCCGGTAGCCGGGAGGCA GGG (reversed) Intronic
900165756 1:1243729-1243751 TCCCCGGTAGCCGGGAGGCAGGG - Intronic
900270221 1:1783173-1783195 GCTCCAGCAGCCGGGAGGCAGGG - Intergenic
900946804 1:5835356-5835378 TCCCCGGCAGCCTGGAGTCAGGG - Intergenic
901964636 1:12856194-12856216 TCCCAGCTACTCGGGAGGCAAGG + Intronic
902222049 1:14972597-14972619 TCGCCGGAACTCGGGAGGCAGGG - Intronic
903163952 1:21508457-21508479 TCCCGGATAGACGGGAGCCAGGG - Intergenic
903860853 1:26363642-26363664 TCCCCGGTAGCTGGGACGAAGGG - Intronic
904127882 1:28254706-28254728 TCACTTGTACCCGGGAGGCAGGG + Intergenic
904222198 1:28980887-28980909 TCCCCGCTACTCGGGAGGCCAGG - Intronic
904525672 1:31132001-31132023 TCCCAGCTACCCGGGAGGCTGGG + Intergenic
906063442 1:42962940-42962962 TCCCTGGCAGCCAGGAGGAAAGG + Intergenic
910198560 1:84672938-84672960 TCCCTTGAACCCGGGAGGCAAGG + Intronic
910577628 1:88784238-88784260 TCCCAGCTATCCGGGAGGCTGGG - Intronic
917326474 1:173837888-173837910 TCCCAGCTACTCGGGAGGCAAGG - Intronic
917791739 1:178503520-178503542 TCCCAGCTAGTCGGGAGGCTGGG + Intergenic
920044830 1:203126594-203126616 ACCTGGGTAGCTGGGAGGCAGGG - Intronic
921981834 1:221267081-221267103 TCCCCAATTGCCGGGAGACATGG - Intergenic
922754302 1:228086397-228086419 TCCCAGCTACCCGGGAGGCTGGG + Intronic
922895338 1:229095794-229095816 TCCCAGCTACCCTGGAGGCAAGG + Intergenic
923611083 1:235494578-235494600 TCCCCGGTAGCTGGGACGACGGG + Intronic
1062791191 10:307713-307735 GCCCCAGAAGCCGGGAGGGAAGG + Intronic
1065278783 10:24113766-24113788 TTCCCAAAAGCCGGGAGGCATGG - Intronic
1065486961 10:26245066-26245088 TCACTGGAACCCGGGAGGCAGGG + Intronic
1065833004 10:29631688-29631710 TCCCTTGAACCCGGGAGGCAGGG + Intronic
1065993261 10:31032502-31032524 CCCGCGGGAGCCGGGAGCCAGGG - Intergenic
1066177220 10:32920896-32920918 TCGCCTGAACCCGGGAGGCAGGG + Intronic
1067095197 10:43295137-43295159 CCCCCAATAGCCGGGAGGGATGG - Intergenic
1067846122 10:49722913-49722935 TCCCAGCTACTCGGGAGGCAGGG + Intergenic
1071013243 10:80963963-80963985 TCCCAGGTAGCTGGGAGGACAGG - Intergenic
1071536627 10:86438375-86438397 TCCCGGGTAGCCGGGATTAAAGG + Intronic
1071545025 10:86522182-86522204 CGCCCGGGAGCTGGGAGGCAGGG + Intergenic
1071574771 10:86716966-86716988 TCCCAGGGAGCTGGGAGGAATGG + Intronic
1074130055 10:110566477-110566499 TCCCAGTTAGTCGGGAGGCTGGG - Intergenic
1077048013 11:554739-554761 TCCCCCGGAGACGGGAGGCCTGG - Exonic
1078153506 11:8778660-8778682 TACCCGGGGGCTGGGAGGCATGG + Intronic
1078705619 11:13740940-13740962 TCACCGGAAGCCAGAAGGCAAGG - Intergenic
1080632174 11:34088085-34088107 TCCCTTGAACCCGGGAGGCAGGG - Intronic
1082789210 11:57335693-57335715 TCCCCGGTCCCAGGAAGGCAGGG - Intronic
1083422396 11:62561551-62561573 TCCCAGCTACTCGGGAGGCAGGG + Intronic
1085336479 11:75700678-75700700 TCCCAGGTACCCTGGTGGCAAGG + Intergenic
1085413358 11:76305097-76305119 GCCCCTGTAGGCAGGAGGCAGGG - Intergenic
1085444490 11:76591471-76591493 CTCCCGGCACCCGGGAGGCAGGG - Intergenic
1088048073 11:105477831-105477853 TCCCAGGTACTCGGGAGGCTGGG - Intergenic
1088665356 11:112088314-112088336 TCCCAGCTAGTCGGGAGGCAGGG - Intronic
1089177201 11:116557507-116557529 GGCCCTGTAGCTGGGAGGCAAGG - Intergenic
1089334633 11:117714698-117714720 TCCCAGGTACTCGGGAGGCTAGG + Intronic
1089475807 11:118760702-118760724 TCCCAGGTACTCGGGAGGCTGGG + Intronic
1090029406 11:123194768-123194790 TCCTCCGTGGCCAGGAGGCAGGG + Intronic
1090353073 11:126120142-126120164 TCCCTTGAATCCGGGAGGCACGG + Intergenic
1092184769 12:6470716-6470738 TCACCGTTATCCGGGAGGCGTGG - Intronic
1092260589 12:6951535-6951557 CCCACGGTAGACAGGAGGCAAGG + Intronic
1093430904 12:19083896-19083918 TCCCCAGTAGCTGGGAAGCTGGG + Intergenic
1093454907 12:19355466-19355488 TCCCAGCTAGCCAGGAGGCTGGG - Intronic
1098943030 12:76559408-76559430 TCCCAGGGAGGCGGGACGCAAGG + Exonic
1100565487 12:95790456-95790478 TCGCCGGCAGCTGGGAGCCAGGG + Exonic
1101959250 12:109236120-109236142 TGCCAGGGAGCTGGGAGGCACGG - Intronic
1103075292 12:117977240-117977262 TCCCAGGTACTCGGGAGGCTAGG + Intergenic
1103515765 12:121507245-121507267 TCCCAGCTACTCGGGAGGCAGGG + Intronic
1103577065 12:121885846-121885868 TCCCAGCTACTCGGGAGGCAGGG + Intergenic
1107596049 13:41964134-41964156 TCCCAGCTACTCGGGAGGCAGGG + Intergenic
1108071682 13:46635292-46635314 GCCCCGTTAGCTGAGAGGCAGGG - Intronic
1112558593 13:100492249-100492271 TCCCAGCTACTCGGGAGGCAGGG - Intronic
1113296056 13:108959722-108959744 TCCCGTCTAGCCGGGCGGCAGGG + Intronic
1114622853 14:24108086-24108108 TACCAGATAGCCGGGAAGCAAGG - Intronic
1116983396 14:51194560-51194582 TCCCAGGTACTCGGGAGGCTGGG + Intergenic
1117602542 14:57390506-57390528 GCCCGGGCAGCCGGCAGGCAGGG + Intergenic
1117861827 14:60099939-60099961 TCCCAAGTAGCCGGGACGAAAGG - Intronic
1118092943 14:62502614-62502636 TCCCAGGTAGCTGGGAGTAAAGG - Intergenic
1119263158 14:73250136-73250158 CCCCAGGCAGCCCGGAGGCAGGG - Intronic
1119554835 14:75545336-75545358 TCCCAGCTACCCGGGAGGCTCGG - Intronic
1119844097 14:77815633-77815655 TCCCAGCTACTCGGGAGGCAGGG - Intronic
1121011590 14:90523137-90523159 TCCCTGGGAGCAGGGAGGGATGG - Intergenic
1122156386 14:99752925-99752947 TCCCAGGAAGCTGGAAGGCAGGG + Intronic
1122287518 14:100660371-100660393 TCCCTGGTTGAAGGGAGGCATGG - Intergenic
1122703883 14:103608238-103608260 TCCTCAGTAGACAGGAGGCAGGG + Intronic
1123443957 15:20308204-20308226 TCCCGGGTAGCCGGGACCCCAGG - Intergenic
1124121342 15:26891824-26891846 TCCCCGCTGGCCGGGAGGGGAGG - Intronic
1124922275 15:34038800-34038822 CCGCCGGGAGCCGGGAGGCTGGG - Exonic
1125993437 15:44132877-44132899 TCCCAGCTACTCGGGAGGCAAGG - Intronic
1126135803 15:45389974-45389996 TCCCAGCTATTCGGGAGGCAGGG - Intronic
1127251098 15:57239232-57239254 TCCCAGCTAGTCGGGAGGCTGGG + Intronic
1127985705 15:64068768-64068790 TCCCAGCTACCCGGGAGGCTGGG + Intronic
1128987139 15:72230240-72230262 TGCCCCGCTGCCGGGAGGCAGGG - Intronic
1129439571 15:75570649-75570671 TCCCAGGAACCCGGGAGGCGAGG + Intronic
1129577336 15:76764359-76764381 TCCCTGGTAGGTGGGAGCCAAGG + Intronic
1129894529 15:79093500-79093522 TCCCAGGTAGGCTGGAGTCAAGG + Intergenic
1130291490 15:82605919-82605941 TCCCCGTTACCCGGGAGGCTGGG + Intronic
1131207900 15:90466973-90466995 TCCCAGCTACCCGGGAGGCTGGG + Intronic
1131277623 15:90994894-90994916 TTCCCGGCAGCCGGGACTCAGGG - Intronic
1131564176 15:93471038-93471060 TCGCCTGAACCCGGGAGGCAGGG - Intergenic
1134499553 16:14758397-14758419 TCCCAGCTAGTCGGGAGGCTGGG - Intronic
1134618971 16:15673318-15673340 TCCCAGCTACCCGGGAGGCAGGG - Intronic
1135133012 16:19868255-19868277 TCCCAGCTACCCAGGAGGCAGGG + Intronic
1135321345 16:21499352-21499374 TTCCCTGTAACCGGGAGGCAGGG + Intergenic
1135374178 16:21930854-21930876 TTCCCTGTAACCGGGAGGCAGGG + Intergenic
1135437608 16:22439867-22439889 TTCCCTGTAACCGGGAGGCAGGG - Intergenic
1139691514 16:68644999-68645021 TCCGCTGTAGCCGCAAGGCAAGG + Exonic
1140230078 16:73110678-73110700 TCCCAGCTACTCGGGAGGCAGGG - Intergenic
1141530202 16:84641052-84641074 TCCCAGCTACTCGGGAGGCAGGG - Intergenic
1141770992 16:86089556-86089578 TCCATGGTTGCCGGGAGGGAGGG + Intergenic
1141876482 16:86828444-86828466 TCCCCAGCTGCAGGGAGGCAGGG + Intergenic
1143082520 17:4392438-4392460 TCCCAGGTAGCTGGGTAGCAGGG - Intergenic
1143945428 17:10587598-10587620 TCCCAGCTACTCGGGAGGCAAGG - Intergenic
1143953724 17:10653292-10653314 TCCCCTGCAGTCGTGAGGCAGGG + Intronic
1144890540 17:18491621-18491643 TCCCGGGGACCCAGGAGGCAGGG - Intronic
1145141678 17:20452697-20452719 TCCCGGGGACCCAGGAGGCAGGG + Intronic
1146492172 17:33291343-33291365 TCCCCGGCAGTCAGGAGGCCTGG - Intronic
1148691571 17:49530021-49530043 TCCCAGGTAGTTGGGAGGCCTGG + Intergenic
1148704720 17:49619648-49619670 TCCCCGCTACTCGGGAGGCTGGG - Intronic
1148863703 17:50617924-50617946 CCCCAGGTAGCCGGGAGGTGGGG + Exonic
1150343808 17:64388781-64388803 TCCCAGCTACTCGGGAGGCAGGG - Intronic
1151115737 17:71732845-71732867 TCGCCTGAACCCGGGAGGCAGGG + Intergenic
1151417969 17:73979040-73979062 TTCCAGGTAGCAGGGAGGGAGGG + Intergenic
1151755064 17:76069990-76070012 TCACCTGAACCCGGGAGGCATGG + Intronic
1151763789 17:76121964-76121986 TCCCCGGTTGCCTGGAGCCACGG - Intergenic
1152575734 17:81140127-81140149 TCCCAGCTACCCGGGAGGCTGGG - Intronic
1153522561 18:5966437-5966459 TCCCTGGAAGCCGGGTGTCAGGG - Intronic
1153937016 18:9936628-9936650 TCCCAGCTACCCAGGAGGCATGG + Intronic
1155187384 18:23399223-23399245 TCCACAGGAGCAGGGAGGCAGGG - Intronic
1157616234 18:48989261-48989283 TCCCAGGTACCCTGGAGCCAGGG + Intergenic
1160806485 19:994384-994406 GCCCTGGTTGCTGGGAGGCATGG - Exonic
1160879339 19:1312482-1312504 TCCCCAGCACCTGGGAGGCAGGG - Intergenic
1160981906 19:1820086-1820108 TCCCCGGCACCAGGCAGGCATGG - Intronic
1161186522 19:2925100-2925122 TCCCCGGTAGCTGGGACTCCAGG - Intergenic
1161938246 19:7385590-7385612 TCCCCGCTACTCGGGAGGCTGGG - Intronic
1163181838 19:15609384-15609406 TCCCAGGTACTCGGGAGGCTGGG + Intergenic
1163331096 19:16638386-16638408 TCACCTGAACCCGGGAGGCAGGG - Intronic
1163647435 19:18497698-18497720 TCCCAGCTACCCGGGAGGCTGGG + Intronic
1164175754 19:22772590-22772612 TCACCTGAACCCGGGAGGCAGGG + Intronic
1166559263 19:43720934-43720956 TCCCAGGCAGCAGGCAGGCACGG - Intergenic
1168113600 19:54208728-54208750 TCCACGGCAGCCTGGAGGGAGGG + Intronic
925972711 2:9118291-9118313 TCGCTGGAAGCTGGGAGGCAGGG - Intergenic
927786181 2:25976674-25976696 TCCCTTGAACCCGGGAGGCAGGG + Intronic
927839293 2:26428679-26428701 TCCCAGCTACCCGGGAGGCTGGG + Intronic
927975082 2:27332529-27332551 TCCCAGCTACCCGGGAGGCTGGG - Intronic
928311433 2:30213663-30213685 TCCCTGGCAGCCTGGTGGCAGGG + Intergenic
928322833 2:30296700-30296722 GCTCCTGTAGCCTGGAGGCAGGG + Intronic
928572606 2:32624235-32624257 TCGCTTGAAGCCGGGAGGCAGGG - Intergenic
932016007 2:68026926-68026948 TCACCTGAACCCGGGAGGCATGG + Intergenic
932242897 2:70171593-70171615 TCGCCTGAACCCGGGAGGCAGGG - Intronic
933035028 2:77385862-77385884 TCCCAGCTAGTCGGGAGGCTGGG - Intronic
934571958 2:95378237-95378259 TCCCAGGTACTCGGGAGGCTGGG - Intronic
934831734 2:97532604-97532626 TCCCAGCTAGTCGGGAGGCTGGG + Intronic
936004509 2:108871434-108871456 TCCCAGTTACTCGGGAGGCAAGG + Intronic
937740909 2:125352397-125352419 TCCCAGGTACCCGGTAGGCTGGG + Intergenic
938846167 2:135211422-135211444 TCCCAGCTACCTGGGAGGCAGGG + Intronic
938987062 2:136587026-136587048 TCCCAAGTAGCTGGGAGGCTGGG + Intergenic
941271993 2:163441850-163441872 TCCCAGGTAGGCAAGAGGCAAGG + Intergenic
945601159 2:211866164-211866186 TCGCCTGTACCCGGGAGGCGGGG + Intronic
946415992 2:219539959-219539981 TCCCCGGTGCCCGGGTGCCATGG - Exonic
947538404 2:230956279-230956301 TCCCAGGTACTCGGGAGGCTGGG - Intronic
948615772 2:239197967-239197989 TCCCAGCTACTCGGGAGGCAAGG - Intronic
1169493511 20:6091344-6091366 TCCCAGCTACCCGGGAGGCTGGG - Intronic
1172653475 20:36522273-36522295 TCCCAGCTATCCAGGAGGCAAGG - Intronic
1177095084 21:16822770-16822792 TCTCCTGTAGCTGGAAGGCAGGG + Intergenic
1177695496 21:24565884-24565906 TCCCAGCTACCCGGGAGGCTGGG + Intergenic
1178322155 21:31613846-31613868 TCCCTGGAACCCGGGAGGCGGGG + Intergenic
1179048297 21:37866597-37866619 TCCCCAGTTGCCAGTAGGCAGGG - Intronic
1182545784 22:31075594-31075616 TCACTTGAAGCCGGGAGGCAGGG + Intronic
1183920544 22:41163660-41163682 TCGCTGGAACCCGGGAGGCAGGG + Intronic
1184154895 22:42661070-42661092 TCCCAGCTACTCGGGAGGCAAGG - Intergenic
1184842206 22:47058633-47058655 TCCCTGTTAGCAAGGAGGCAGGG + Intronic
1184922869 22:47618151-47618173 TCCTCGGCAGCAGGGAGGGAAGG - Intergenic
1185331362 22:50253424-50253446 TCCCCGGCAGCTGGGGGCCAGGG - Exonic
952268244 3:31807261-31807283 TCCCAGCTAGTCGGGAGGCTGGG + Intronic
952421145 3:33132366-33132388 TCCACGGCAGCCTGGAGGCCAGG - Intronic
952785022 3:37144487-37144509 TCCCAGCTACTCGGGAGGCAAGG + Intronic
952909454 3:38169844-38169866 TCCCAGCTACCTGGGAGGCAGGG - Intronic
953656892 3:44861593-44861615 TCACCGGGAGCCGGGTGGCCGGG + Intronic
954031228 3:47821380-47821402 TCCCCGGTACTCGGGGGGCTGGG - Intronic
960910481 3:122644401-122644423 TCCCAAGTAGCTGAGAGGCAGGG - Intergenic
961450285 3:126999500-126999522 GCCCCAGCCGCCGGGAGGCAGGG - Intronic
961766427 3:129215002-129215024 TCCCAGCTACTCGGGAGGCAGGG + Intergenic
963802941 3:149695642-149695664 TCCCAGGTACCTGGGAGGCTGGG + Intronic
964114404 3:153120743-153120765 TCCCTGCTACTCGGGAGGCAAGG - Intergenic
964794410 3:160481613-160481635 TCGCAGGAACCCGGGAGGCAGGG + Intronic
966515771 3:180819907-180819929 TCCCAGCTACTCGGGAGGCAAGG - Intronic
968898438 4:3418788-3418810 TCCCAGGTACTCGGGAGGCCTGG - Intronic
969131904 4:4996267-4996289 CCCCGGGAAGCAGGGAGGCAAGG - Intergenic
969294991 4:6264509-6264531 TCCCAGGTACTCGGGAGGCTTGG - Intergenic
969297572 4:6278849-6278871 TCCCCTGAAGCCGTGAGGCTGGG - Intronic
970619412 4:17801984-17802006 TCCCAGCTATTCGGGAGGCAGGG + Exonic
974750139 4:66129174-66129196 TCCCAGGTACCCAGGAGGCTCGG + Intergenic
977232657 4:94470088-94470110 TCCCCAGTAGCCGGGAGTACAGG + Intronic
979020724 4:115493915-115493937 TCACCTGAACCCGGGAGGCAGGG - Intergenic
980383012 4:132050234-132050256 TCCCAGGTACTCGGGAGGCTGGG - Intergenic
981920311 4:150078767-150078789 TCCCCGGCAGGCGGGAGGCACGG + Intronic
982575416 4:157103064-157103086 TCCCTTGAACCCGGGAGGCAAGG + Intronic
984705948 4:182847261-182847283 TCCCAGGTAGTCAGGAGGCTGGG + Intergenic
986172786 5:5327335-5327357 GCCCCGGTGGCTGGGAGGGACGG - Intergenic
988241950 5:28623059-28623081 TCCCAGCTACTCGGGAGGCAAGG + Intergenic
988587674 5:32522139-32522161 TCCCAGCTAGTCGGGAGGCTGGG - Intergenic
988612822 5:32744075-32744097 TCACCTGAACCCGGGAGGCAGGG - Intronic
990247209 5:53874828-53874850 TCACAGGTAACAGGGAGGCAAGG - Intergenic
991363550 5:65845123-65845145 TCCCAGCTACTCGGGAGGCAGGG - Intronic
995505836 5:112860026-112860048 TCCCAGCTACTCGGGAGGCAGGG - Intronic
997484391 5:134217161-134217183 TCCCAGCTACCCGGGAGGCTGGG + Intronic
997517901 5:134503903-134503925 TCCCAGGCAGGCAGGAGGCAGGG - Intergenic
998391291 5:141788573-141788595 GCCCTGGTAGAAGGGAGGCAGGG - Intergenic
1001576861 5:172770506-172770528 CCCCCGGGAGCCGAGAGCCAGGG + Intronic
1002013258 5:176301692-176301714 TCACCTGAACCCGGGAGGCAGGG + Intronic
1002214581 5:177621055-177621077 TCGCCTGAACCCGGGAGGCAGGG - Intergenic
1003408166 6:5840103-5840125 GCAGCAGTAGCCGGGAGGCAAGG - Intergenic
1004935498 6:20503806-20503828 TCCCCGGTAGCCGGGATTACAGG - Intergenic
1006123382 6:31821493-31821515 TCCCAGCTACCCGGGAGGCTGGG + Intergenic
1006456629 6:34135554-34135576 TCCCCTGGAGCCAGGAGCCAGGG + Intronic
1006598990 6:35213635-35213657 TCCCCGGGAGCAGGGAGGTCAGG - Intergenic
1008210518 6:48718802-48718824 TCCCTTGAACCCGGGAGGCAGGG - Intergenic
1008677908 6:53841067-53841089 TGCCCAGGAGCCGGGATGCAGGG + Intronic
1013658801 6:112273313-112273335 TCCCGAGTAGCCGGGACTCAGGG + Intergenic
1019507738 7:1401299-1401321 TCCCGAGTAGCTGGGAGGCTGGG - Intergenic
1020088379 7:5323682-5323704 TCCCAGCTACCCGGGAGGCTGGG - Intronic
1020273323 7:6609936-6609958 TCCCAGGTACTCGGGAGGCTGGG + Intergenic
1020804005 7:12765998-12766020 TACCCAGCAGCTGGGAGGCAGGG + Intergenic
1022923370 7:35037526-35037548 TCCCCGCGGGCCGGGAGGCGGGG + Intronic
1023131015 7:37003269-37003291 TCCCGGGTACTCGGGAGGCTGGG + Intronic
1025205932 7:56993430-56993452 TCCCAGCTACCCGGGAGGCTGGG + Intergenic
1025666008 7:63583508-63583530 TCCCAGCTACCCGGGAGGCTGGG - Intergenic
1026018560 7:66691004-66691026 TCGCCGGAACCGGGGAGGCAGGG + Intronic
1026986554 7:74558842-74558864 TCCCCTGTGGGCGAGAGGCAGGG - Exonic
1029134919 7:98363149-98363171 TCCCAGCTACTCGGGAGGCAGGG - Intronic
1029240959 7:99162159-99162181 TCCCAGTTACTCGGGAGGCAAGG - Intergenic
1032826004 7:135568446-135568468 TCCCAGGTACTCGGGAGGCCAGG - Intronic
1036600227 8:10254021-10254043 TCCCCGGCAGATCGGAGGCACGG - Intronic
1037877261 8:22554254-22554276 CCCCTGGGAGCCGGCAGGCACGG + Intronic
1038123174 8:24641338-24641360 TCACTTGAAGCCGGGAGGCAGGG + Intergenic
1038319757 8:26515108-26515130 TCCCCGGTGGTCGGGAGGGGCGG + Intronic
1039193462 8:35003330-35003352 TCCCAGTTACTCGGGAGGCAGGG - Intergenic
1039531768 8:38269065-38269087 TCCCAGGCAGGCGGGCGGCACGG - Intronic
1039960234 8:42240849-42240871 TCCCAGGTAGCTGGGAGTAAAGG - Intergenic
1041983617 8:63893421-63893443 TCCCCAGTAGCCGGGACTAAAGG - Intergenic
1049222953 8:141436187-141436209 TCCCCGGGAGCCGAGAGCCTGGG - Intergenic
1054905722 9:70412653-70412675 TCCCCGGCCTCCGGGAGCCACGG - Intronic
1057590285 9:96367101-96367123 TCCCAGGTACTCGGGAGGCTGGG + Intronic
1060349284 9:122843585-122843607 TCCCAGCTACTCGGGAGGCAGGG - Intergenic
1060373818 9:123100536-123100558 TCCCAGCTAGCTGGGAGGCGAGG - Intronic
1061340990 9:129981202-129981224 TCCCAGGTACTCGGGAGGCGAGG - Intronic
1061347949 9:130042467-130042489 TCCCCGGGAGCGGGGCGGCCGGG - Intronic
1061480728 9:130896577-130896599 CCCCCAGCAGCCGGGATGCAGGG - Intergenic
1185503286 X:614953-614975 TCCCCGGTAGCTGGGATGACAGG - Intergenic
1185503457 X:615992-616014 TCCCCGGTAGCTGGGATGACAGG - Intergenic
1185607955 X:1378067-1378089 TCCCAGCTACTCGGGAGGCAGGG + Intronic
1188632088 X:32376162-32376184 TCCCAGCTACCCGGGAGGCTGGG + Intronic
1189274453 X:39775345-39775367 TCCCCTGTACCCAGGAGGCGGGG + Intergenic
1189334358 X:40161628-40161650 TCCCAGCTACCCGGGAGGCTGGG - Intronic
1189453661 X:41163634-41163656 TCCCGGGTACTCGGGAGGCTGGG + Intronic
1191717807 X:64205289-64205311 CCCCCGAAAGCCGGGAGGCTTGG + Intronic
1198005867 X:132491856-132491878 TCCCCAGTGGCCTGGTGGCATGG - Intergenic
1198106225 X:133463973-133463995 TCCCAGCTACTCGGGAGGCATGG - Intergenic