ID: 900165757

View in Genome Browser
Species Human (GRCh38)
Location 1:1243730-1243752
Sequence GTCCCCGGTAGCCGGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1025
Summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 984}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900165757_900165763 -7 Left 900165757 1:1243730-1243752 CCTGCCTCCCGGCTACCGGGGAC 0: 1
1: 0
2: 0
3: 40
4: 984
Right 900165763 1:1243746-1243768 CGGGGACCCACGCTCCGTCTGGG 0: 1
1: 0
2: 0
3: 3
4: 60
900165757_900165769 19 Left 900165757 1:1243730-1243752 CCTGCCTCCCGGCTACCGGGGAC 0: 1
1: 0
2: 0
3: 40
4: 984
Right 900165769 1:1243772-1243794 AAAGTGTGATCTGGGCCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 156
900165757_900165762 -8 Left 900165757 1:1243730-1243752 CCTGCCTCCCGGCTACCGGGGAC 0: 1
1: 0
2: 0
3: 40
4: 984
Right 900165762 1:1243745-1243767 CCGGGGACCCACGCTCCGTCTGG 0: 1
1: 0
2: 0
3: 6
4: 65
900165757_900165770 20 Left 900165757 1:1243730-1243752 CCTGCCTCCCGGCTACCGGGGAC 0: 1
1: 0
2: 0
3: 40
4: 984
Right 900165770 1:1243773-1243795 AAGTGTGATCTGGGCCCCCAGGG 0: 1
1: 0
2: 1
3: 26
4: 190
900165757_900165767 10 Left 900165757 1:1243730-1243752 CCTGCCTCCCGGCTACCGGGGAC 0: 1
1: 0
2: 0
3: 40
4: 984
Right 900165767 1:1243763-1243785 TCTGGGCATAAAGTGTGATCTGG 0: 1
1: 0
2: 1
3: 3
4: 99
900165757_900165768 11 Left 900165757 1:1243730-1243752 CCTGCCTCCCGGCTACCGGGGAC 0: 1
1: 0
2: 0
3: 40
4: 984
Right 900165768 1:1243764-1243786 CTGGGCATAAAGTGTGATCTGGG 0: 1
1: 0
2: 0
3: 8
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900165757 Original CRISPR GTCCCCGGTAGCCGGGAGGC AGG (reversed) Intronic
900165757 1:1243730-1243752 GTCCCCGGTAGCCGGGAGGCAGG - Intronic
900270222 1:1783174-1783196 GGCTCCAGCAGCCGGGAGGCAGG - Intergenic
900513443 1:3070641-3070663 GGCCCCGGGAGCTGCGAGGCCGG - Intronic
900654654 1:3750000-3750022 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
900946805 1:5835357-5835379 CTCCCCGGCAGCCTGGAGTCAGG - Intergenic
900960990 1:5920047-5920069 GTCCCAGCTACTCGGGAGGCTGG - Intronic
901086409 1:6614388-6614410 GTCCCAGGTCGACGCGAGGCCGG - Intronic
901285418 1:8074752-8074774 GTCCCAGGTACTTGGGAGGCTGG + Intergenic
902307110 1:15549694-15549716 GTCCCAGCTACTCGGGAGGCTGG + Intronic
902516968 1:16994778-16994800 GTCCCAGTTACTCGGGAGGCTGG - Intronic
902533225 1:17103864-17103886 GTCCCAGCTACTCGGGAGGCTGG + Intronic
902742400 1:18448003-18448025 GTTCCCAGTGGCCGGGAGGATGG - Intergenic
902889524 1:19431958-19431980 GTCCCAGCTACTCGGGAGGCTGG + Intronic
902941989 1:19807050-19807072 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
903205453 1:21778897-21778919 GTCCCAGCTACTCGGGAGGCTGG - Intronic
903207478 1:21793492-21793514 GTCCCAGCTAGTCAGGAGGCTGG - Intergenic
903388334 1:22944736-22944758 TTCCTTGGTAGCCGGGTGGCAGG - Intergenic
903500625 1:23798420-23798442 GTCCCAGCTACTCGGGAGGCTGG - Intronic
903801328 1:25970701-25970723 GTCCCAGCTACTCGGGAGGCTGG - Intronic
903860854 1:26363643-26363665 CTCCCCGGTAGCTGGGACGAAGG - Intronic
904329864 1:29751643-29751665 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
904525671 1:31132000-31132022 ATCCCAGCTACCCGGGAGGCTGG + Intergenic
904654604 1:32034861-32034883 GTCCCAGCTAATCGGGAGGCTGG + Intronic
904798847 1:33078773-33078795 GTCCCAGCTACTCGGGAGGCTGG - Intronic
904939204 1:34153132-34153154 GTCCCAGCTACTCGGGAGGCTGG - Intronic
905072650 1:35240882-35240904 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
905080248 1:35313009-35313031 GTCCCAGCTACTCGGGAGGCTGG - Intronic
905103653 1:35548001-35548023 GTCCCAGCTACTCGGGAGGCTGG + Intronic
905111754 1:35600016-35600038 GTCCCAGCTAGTTGGGAGGCTGG + Intronic
905167356 1:36090732-36090754 GTCCCAGCTACTCGGGAGGCTGG + Intronic
905485160 1:38290976-38290998 GTCCCAGTTACTCGGGAGGCTGG - Intergenic
905661987 1:39734787-39734809 GTCCCAGCTACTCGGGAGGCTGG - Intronic
906174794 1:43761831-43761853 GTCCCAGCTACTCGGGAGGCTGG + Intronic
906297344 1:44657074-44657096 GTCCCAGCTACTCGGGAGGCTGG + Intronic
906339536 1:44966931-44966953 GTCCCAGCTACTCGGGAGGCAGG - Intronic
906371074 1:45254339-45254361 GTCCCAGCTACTCGGGAGGCTGG + Intronic
906620053 1:47268977-47268999 GTCCCAGCTACACGGGAGGCAGG + Intronic
906649331 1:47501406-47501428 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
906816638 1:48886668-48886690 GTCCCAGCTACTCGGGAGGCTGG - Intronic
907077527 1:51592230-51592252 GTCCCAGCTACTCGGGAGGCTGG - Intronic
907366570 1:53965595-53965617 GTCCCAGCTACTCGGGAGGCTGG - Intronic
907434449 1:54435468-54435490 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
908085507 1:60628219-60628241 GTCCCAGCTAGTTGGGAGGCTGG + Intergenic
908202491 1:61811941-61811963 GTCCCAGCTACTCGGGAGGCTGG + Intronic
908306365 1:62823036-62823058 GTCCCAGCTACTCGGGAGGCTGG + Intronic
909646616 1:77923793-77923815 GTCCCAGCTACTCGGGAGGCTGG - Intronic
910253133 1:85219292-85219314 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
910464308 1:87480705-87480727 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
910577629 1:88784239-88784261 GTCCCAGCTATCCGGGAGGCTGG - Intronic
911001849 1:93174387-93174409 GTCCCAGCTACCCAGGAGGCTGG + Intronic
911512425 1:98824094-98824116 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
911543059 1:99182421-99182443 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
911644330 1:100322005-100322027 GTCCCGGCTACTCGGGAGGCTGG + Intergenic
912808984 1:112779315-112779337 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
912828199 1:112925494-112925516 GTCCCAGCTACTCGGGAGGCTGG - Intronic
913266812 1:117053195-117053217 GTCCCAGTTACTCGGGAGGCTGG + Intergenic
913678437 1:121165093-121165115 GTCCCAGGTACTTGGGAGGCTGG - Intergenic
914030275 1:143952731-143952753 GTCCCAGGTACTTGGGAGGCTGG - Intronic
914159174 1:145115220-145115242 GTCCCAGGTACTTGGGAGGCTGG + Intergenic
914251973 1:145929116-145929138 GTCCCAGCTAATCGGGAGGCTGG - Intergenic
914832323 1:151179479-151179501 GTCCCAGCTACTCGGGAGGCTGG + Intronic
914903712 1:151727157-151727179 GTCCCAGCTAGTCGAGAGGCTGG + Intronic
914990560 1:152496299-152496321 GTCCCAGGTACTTGGGAGGCTGG + Intergenic
915084382 1:153375162-153375184 GTCCCAGCTACTCGGGAGGCTGG - Intronic
915272738 1:154766795-154766817 GTCCCAGCTACTCGGGAGGCTGG - Intronic
915302990 1:154962045-154962067 GGCCCAGGTAGCCCGGGGGCCGG + Intronic
915479664 1:156176160-156176182 GTCCCAGCTATTCGGGAGGCTGG + Intronic
915531011 1:156502031-156502053 GTCCCAGCTATTCGGGAGGCGGG - Intergenic
916426603 1:164686837-164686859 GTCCCAGCTACTCGGGAGGCTGG + Intronic
916526142 1:165611373-165611395 GTCCCAGTTACCCGGGAGGGAGG - Intergenic
916621819 1:166506117-166506139 GTCCCAGCTACCAGGGAGGCTGG - Intergenic
916633131 1:166638296-166638318 ATCCCAGGTAGCGGGGTGGCTGG - Intergenic
916912081 1:169361660-169361682 GTCCCAGCTACTCGGGAGGCTGG + Intronic
917791738 1:178503519-178503541 GTCCCAGCTAGTCGGGAGGCTGG + Intergenic
917809125 1:178640993-178641015 GTCCCGGCTACTCGGGAGGCTGG - Intergenic
918084651 1:181235407-181235429 GTCCCCGCTACTCAGGAGGCTGG + Intergenic
918452808 1:184676032-184676054 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
918703637 1:187635875-187635897 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
919484792 1:198132943-198132965 GTCCCAGCTACTCGGGAGGCAGG + Intergenic
919766809 1:201132665-201132687 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
920008927 1:202853652-202853674 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
920465743 1:206183617-206183639 GTCCCAGGTACTTGGGAGGCTGG - Intergenic
920852866 1:209640428-209640450 GTCCCAGCTACTCGGGAGGCTGG + Intronic
921870064 1:220130673-220130695 GTCCCAGCTACTCGGGAGGCTGG - Intronic
921915180 1:220601033-220601055 GTCCCAGCTACTCGGGAGGCTGG - Intronic
922754301 1:228086396-228086418 GTCCCAGCTACCCGGGAGGCTGG + Intronic
923020277 1:230158180-230158202 GGCCCGGGTAGCAGGGGGGCAGG + Intronic
923145481 1:231194798-231194820 GTCCCAGCTACTCGGGAGGCTGG - Intronic
923479220 1:234366929-234366951 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
923479738 1:234373094-234373116 GTCCCAGCTACCTGGGAGGCAGG + Intergenic
923595741 1:235359917-235359939 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
923611082 1:235494577-235494599 CTCCCCGGTAGCTGGGACGACGG + Intronic
924054674 1:240113444-240113466 GTCCCAGCTACTCGGGAGGCAGG + Intronic
924377700 1:243430554-243430576 GTCCCAGCTACTCGGGAGGCAGG - Intronic
1062857093 10:784798-784820 GTCCCCTAGACCCGGGAGGCTGG - Intergenic
1062876306 10:945568-945590 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1062885567 10:1013490-1013512 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1063185155 10:3643996-3644018 GTCCCAGCTATTCGGGAGGCTGG - Intergenic
1063538866 10:6911882-6911904 ATCCCAGGTACTCGGGAGGCTGG - Intergenic
1064059984 10:12129500-12129522 GGACCCGGGACCCGGGAGGCGGG - Intergenic
1064127060 10:12672031-12672053 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1064231046 10:13529213-13529235 GTCCCCGGGGGCAGGCAGGCCGG - Intergenic
1064351537 10:14581783-14581805 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1064357127 10:14629628-14629650 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1064415649 10:15146973-15146995 GTCCCAGCTACCTGGGAGGCTGG + Intronic
1064522828 10:16221730-16221752 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1064679007 10:17790436-17790458 GTCCCAGATAGTTGGGAGGCTGG + Intronic
1064735202 10:18375098-18375120 GTCCCAGCTACTCGGGAGGCAGG + Intronic
1064821343 10:19337942-19337964 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1065461409 10:25969119-25969141 GTCCCAGCTACTCGGGAGGCAGG + Intronic
1065544734 10:26807972-26807994 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1065874021 10:29981683-29981705 GTCCCAGGTACTTGGGAGGCTGG + Intergenic
1065993263 10:31032503-31032525 GCCCGCGGGAGCCGGGAGCCAGG - Intergenic
1066118124 10:32258127-32258149 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1066311133 10:34197845-34197867 GTCCCCGCTGCTCGGGAGGCTGG - Intronic
1066378502 10:34881307-34881329 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1066668516 10:37812117-37812139 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1067182570 10:44000073-44000095 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1067670565 10:48317297-48317319 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1067846121 10:49722912-49722934 GTCCCAGCTACTCGGGAGGCAGG + Intergenic
1067960236 10:50839858-50839880 GTCCCAGCTACTCGGGAGGCAGG - Intronic
1068113944 10:52715497-52715519 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1068690327 10:59906935-59906957 GTCCCCGGCACCTGCGAGGCTGG - Intergenic
1068967869 10:62931789-62931811 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1069500447 10:68948392-68948414 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1069503758 10:68977993-68978015 GTCCCAGCTACCTGGGAGGCTGG + Intronic
1069517128 10:69086675-69086697 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1069856272 10:71442878-71442900 GACACCTGTGGCCGGGAGGCAGG + Intronic
1070037824 10:72744510-72744532 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1071578134 10:86745311-86745333 GTCCCAGCTACTCGGGAGGCAGG - Intergenic
1072971563 10:100021992-100022014 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1073092600 10:100955055-100955077 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1073518181 10:104097841-104097863 GTCCCAGCTACCTGGGAGGCTGG + Intergenic
1073769097 10:106715868-106715890 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1074130056 10:110566478-110566500 ATCCCAGTTAGTCGGGAGGCTGG - Intergenic
1074396484 10:113102019-113102041 GTCCCAGCTACTCGGGAGGCAGG + Intronic
1074591449 10:114817513-114817535 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1075301462 10:121328421-121328443 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1076633131 10:131864621-131864643 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1076977725 11:187795-187817 GTCCCAGCTACTCGGGAGGCCGG + Intronic
1077297402 11:1832572-1832594 GTCCCCGGGAGCCATGAGGGAGG + Intronic
1077449198 11:2625685-2625707 GTCCCAGCTACTCGGGAGGCAGG - Intronic
1077545006 11:3165355-3165377 GGCCCAGGGAGCCCGGAGGCGGG + Intronic
1077577113 11:3392605-3392627 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1078049889 11:7954511-7954533 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1078410701 11:11114935-11114957 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1079070030 11:17336634-17336656 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1080890071 11:36401540-36401562 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1081182968 11:40006803-40006825 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1081463998 11:43299764-43299786 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1082030611 11:47600761-47600783 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1082070295 11:47934072-47934094 CTCCCGGGTAGCTGGGAGGAGGG - Intergenic
1082789211 11:57335694-57335716 GTCCCCGGTCCCAGGAAGGCAGG - Intronic
1082839880 11:57680257-57680279 GTCCCAGCTACCCAGGAGGCTGG + Intronic
1083187928 11:61028222-61028244 GTCCCAGGTACTTGGGAGGCTGG - Intergenic
1083388401 11:62329835-62329857 GTCCCAGGTACTCAGGAGGCTGG + Intergenic
1083422395 11:62561550-62561572 GTCCCAGCTACTCGGGAGGCAGG + Intronic
1083439877 11:62669036-62669058 GTCCCAGCTACTCGGGAGGCAGG - Intronic
1083867263 11:65462915-65462937 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1084094257 11:66900290-66900312 GTCCCAGCTAGTTGGGAGGCTGG - Intronic
1084167261 11:67381313-67381335 CTCCCGAGTAGCTGGGAGGCAGG + Intronic
1084617316 11:70245179-70245201 GTCCCAGCTACCCAGGAGGCTGG - Intergenic
1084678800 11:70653088-70653110 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1084974991 11:72792165-72792187 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1085571183 11:77559270-77559292 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1085576284 11:77606661-77606683 GTCCCAGCTACCTGGGAGGCTGG - Intronic
1085944594 11:81252678-81252700 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1086620486 11:88882441-88882463 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1086981740 11:93205987-93206009 GTCCCAGCTACTCGGGAGGCAGG - Intergenic
1087019210 11:93585580-93585602 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1087536174 11:99448896-99448918 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1088048074 11:105477832-105477854 ATCCCAGGTACTCGGGAGGCTGG - Intergenic
1088430369 11:109752098-109752120 GTCCCAGCTACTCGGGAGGCAGG - Intergenic
1088665357 11:112088315-112088337 ATCCCAGCTAGTCGGGAGGCAGG - Intronic
1088790405 11:113220722-113220744 GTCCCAGCTATTCGGGAGGCTGG - Intronic
1089066002 11:115662493-115662515 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1089475806 11:118760701-118760723 ATCCCAGGTACTCGGGAGGCTGG + Intronic
1089621682 11:119726335-119726357 GTCCACGGGTGCAGGGAGGCAGG - Intronic
1089738662 11:120566819-120566841 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1089925631 11:122254555-122254577 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1090263734 11:125341236-125341258 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1090909474 11:131105886-131105908 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1091175531 11:133554335-133554357 GTTCCCGGTAGCCTCGAGGCCGG - Intergenic
1091380576 12:55571-55593 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1091496043 12:973593-973615 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1091510910 12:1125110-1125132 GTCCCAGCTAGTTGGGAGGCTGG - Intronic
1091565535 12:1645549-1645571 GTCCCCATCAGCCGGGAGGATGG - Intronic
1091610925 12:2008233-2008255 GTCCCAGCTACCTGGGAGGCTGG - Intronic
1091755513 12:3048754-3048776 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1091914437 12:4259592-4259614 GTCCCAGATACTCGGGAGGCTGG - Intergenic
1091922451 12:4316308-4316330 GAACCCGGGAGGCGGGAGGCGGG + Intergenic
1092175788 12:6405623-6405645 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1092746308 12:11675694-11675716 GTCCCAGTTACCCAGGAGGCTGG + Intronic
1092840859 12:12539926-12539948 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1093251080 12:16805458-16805480 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1093430903 12:19083895-19083917 CTCCCCAGTAGCTGGGAAGCTGG + Intergenic
1093454908 12:19355467-19355489 GTCCCAGCTAGCCAGGAGGCTGG - Intronic
1094212917 12:27911056-27911078 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1094591673 12:31827394-31827416 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1094700630 12:32867208-32867230 GTCCCAGCTACCCAGGAGGCTGG + Intronic
1095316448 12:40767424-40767446 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1096313804 12:50545491-50545513 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1096690937 12:53321345-53321367 GGCCCCGGAAGTCGGGGGGCGGG + Exonic
1096700228 12:53378284-53378306 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1096725398 12:53557317-53557339 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1097096604 12:56553940-56553962 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1097910871 12:64967832-64967854 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1098916036 12:76257811-76257833 GTCCCAGCTACTCGGGAGGCCGG - Intergenic
1098991325 12:77067088-77067110 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1099274624 12:80559160-80559182 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1099819208 12:87688245-87688267 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1100446643 12:94666791-94666813 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1100565486 12:95790455-95790477 GTCGCCGGCAGCTGGGAGCCAGG + Exonic
1100700325 12:97140427-97140449 GTCCCAGCTATCTGGGAGGCTGG - Intergenic
1101619792 12:106374333-106374355 GTCCCAGTTACCAGGGAGGCTGG - Intronic
1101687548 12:107040401-107040423 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1101964451 12:109272925-109272947 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1102434011 12:112906306-112906328 GTCCCAGGTATTCAGGAGGCTGG + Intergenic
1102954003 12:117047856-117047878 GTCCCTGGTACTCGGGAGACTGG - Intronic
1103066610 12:117903879-117903901 GTCCCAGCTACCTGGGAGGCTGG + Intronic
1103515764 12:121507244-121507266 GTCCCAGCTACTCGGGAGGCAGG + Intronic
1103521531 12:121539213-121539235 GTCCCAGCTACCAGGGAGGCTGG + Intronic
1103696496 12:122819942-122819964 GTCCCAGGCACTCGGGAGGCTGG + Intronic
1104297087 12:127526232-127526254 GTCCCGGGTACTTGGGAGGCTGG + Intergenic
1104698387 12:130882071-130882093 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1105035389 12:132916801-132916823 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1105240907 13:18609279-18609301 GTTCCGTGTAGCCGGGAGGCTGG + Intergenic
1105273115 13:18895718-18895740 GTCGCCAGTGGCCGGCAGGCTGG - Intergenic
1105349307 13:19601750-19601772 GTCTCCGGGAGCCCAGAGGCGGG + Intergenic
1105403436 13:20114873-20114895 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1105488302 13:20859657-20859679 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1105569211 13:21584269-21584291 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1106138660 13:26992873-26992895 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1106154511 13:27141131-27141153 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1106241959 13:27920098-27920120 GGCACCGGGAGCCGGGAGCCGGG - Exonic
1107455727 13:40552918-40552940 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1107456597 13:40561232-40561254 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1107485324 13:40821177-40821199 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1107502149 13:40990735-40990757 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1107932192 13:45315579-45315601 GTCCCCTGTAGCTGGGAGGTGGG + Intergenic
1107942687 13:45388589-45388611 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1108153343 13:47559267-47559289 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1108337705 13:49463121-49463143 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1108987876 13:56616655-56616677 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1109428037 13:62193705-62193727 GTCCCAGCTACTCGGGAGGCAGG + Intergenic
1110583719 13:77162772-77162794 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1110918613 13:81056331-81056353 GTCCCAGCTAGTGGGGAGGCTGG - Intergenic
1111030268 13:82588757-82588779 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1112283070 13:98079793-98079815 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1112350457 13:98628969-98628991 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1112558594 13:100492250-100492272 GTCCCAGCTACTCGGGAGGCAGG - Intronic
1113830405 13:113291063-113291085 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1114313178 14:21486082-21486104 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1114478086 14:23011819-23011841 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1114637855 14:24198424-24198446 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1115248667 14:31322699-31322721 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1115587327 14:34827615-34827637 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1115589695 14:34852007-34852029 GTCCCAGTTACTCGGGAGGCTGG + Intronic
1115610440 14:35044238-35044260 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1115673714 14:35645611-35645633 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1115687855 14:35815061-35815083 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1115759935 14:36569833-36569855 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1116294359 14:43087214-43087236 GTCCCAGCTACCCAGGAGGCTGG + Intergenic
1116767136 14:49086432-49086454 GTCCCAGCTACTCGGGAGGCAGG + Intergenic
1116983395 14:51194559-51194581 ATCCCAGGTACTCGGGAGGCTGG + Intergenic
1117359728 14:54960915-54960937 GTCCCAGGTATTTGGGAGGCTGG - Intronic
1117602541 14:57390505-57390527 GGCCCGGGCAGCCGGCAGGCAGG + Intergenic
1117719081 14:58610871-58610893 GTCCCAGATACTCGGGAGGCTGG - Intergenic
1118196427 14:63630891-63630913 GTCCCAGGTACTCAGGAGGCTGG - Intronic
1118449649 14:65888451-65888473 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1118765340 14:68905863-68905885 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1119001273 14:70884114-70884136 GTCCCAGCTATTCGGGAGGCTGG + Intergenic
1119296217 14:73535584-73535606 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1119468607 14:74879326-74879348 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1119496105 14:75080756-75080778 GTCCCAGCTACTCGGGAGGCTGG - Exonic
1119557887 14:75567390-75567412 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1119751052 14:77077700-77077722 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1119844098 14:77815634-77815656 GTCCCAGCTACTCGGGAGGCAGG - Intronic
1119960867 14:78855044-78855066 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1121039844 14:90736763-90736785 GTCCCAGCTAACTGGGAGGCTGG + Intronic
1121210604 14:92205802-92205824 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1121219366 14:92274445-92274467 GTCCCAGGCAGCCAGGAGCCTGG - Intergenic
1123490450 15:20775860-20775882 GTTCCATGTAGCCGGGAGGTTGG - Intergenic
1123499665 15:20867813-20867835 GTCCCAGCTACTCGGGAGGCAGG + Intergenic
1123546951 15:21344947-21344969 GTTCCATGTAGCCGGGAGGTTGG - Intergenic
1123556917 15:21441543-21441565 GTCCCAGCTACTCGGGAGGCAGG + Intergenic
1123593139 15:21878779-21878801 GTCCCAGCTACTCGGGAGGCAGG + Intergenic
1124184211 15:27508829-27508851 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1124434362 15:29634960-29634982 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1124922277 15:34038801-34038823 GCCGCCGGGAGCCGGGAGGCTGG - Exonic
1125527709 15:40388575-40388597 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1125575784 15:40754806-40754828 GTCACCGGGAGCAGGCAGGCGGG + Exonic
1125625563 15:41106264-41106286 GTCCCAGCTACCTGGGAGGCTGG + Intronic
1125649305 15:41301086-41301108 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1126129254 15:45324633-45324655 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1126135804 15:45389975-45389997 GTCCCAGCTATTCGGGAGGCAGG - Intronic
1126224656 15:46256766-46256788 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1126356342 15:47800423-47800445 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1127251097 15:57239231-57239253 ATCCCAGCTAGTCGGGAGGCTGG + Intronic
1127349105 15:58132065-58132087 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1127433001 15:58930229-58930251 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1127985704 15:64068767-64068789 GTCCCAGCTACCCGGGAGGCTGG + Intronic
1128164254 15:65448552-65448574 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1128404660 15:67323358-67323380 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1128431949 15:67604775-67604797 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1128445083 15:67752181-67752203 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1128607007 15:69044064-69044086 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1129146851 15:73656256-73656278 GTTCCAGCTAGTCGGGAGGCTGG - Intergenic
1129854196 15:78812072-78812094 CTCCCGGGGAGCCTGGAGGCCGG + Intronic
1129858052 15:78839169-78839191 GTCCCAGCTACTCGGGAGGCAGG - Intronic
1129995961 15:80006455-80006477 GTCCCAGTTACTCGGGAGGCTGG - Intergenic
1130291489 15:82605918-82605940 ATCCCCGTTACCCGGGAGGCTGG + Intronic
1130517958 15:84640576-84640598 GTCCCAGCTACTCGGGAGGCTGG + Exonic
1130528331 15:84725965-84725987 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1131207899 15:90466972-90466994 ATCCCAGCTACCCGGGAGGCTGG + Intronic
1131214020 15:90522053-90522075 GTCCCAGCTACCCAGGAGGCTGG - Intergenic
1131258421 15:90876189-90876211 GTCCCCGGGAGGCGGGGGACGGG - Intronic
1131277624 15:90994895-90994917 GTTCCCGGCAGCCGGGACTCAGG - Intronic
1131533527 15:93214845-93214867 GTCCCAGCTACTCGGGAGGCAGG - Intergenic
1131893650 15:97002295-97002317 GTCCCAGGTACTCAGGAGGCTGG + Intergenic
1132125761 15:99222877-99222899 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1132273422 15:100545582-100545604 GTCCCAGCTATTCGGGAGGCTGG - Intergenic
1132279368 15:100599946-100599968 GTCCCAGGTACTCAGGAGGCTGG + Intronic
1132369371 15:101283446-101283468 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1132405790 15:101541303-101541325 GACCCTGGGAGCCTGGAGGCTGG + Intergenic
1132429200 15:101746544-101746566 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1202955282 15_KI270727v1_random:72163-72185 GTTCCATGTAGCCGGGAGGTTGG - Intergenic
1202965260 15_KI270727v1_random:168732-168754 GTCCCAGCTACTCGGGAGGCAGG + Intergenic
1132684164 16:1155337-1155359 GTCCCCGGGAGCCGAGGTGCAGG + Intronic
1132749578 16:1451323-1451345 GTCCCAGGTACTTGGGAGGCTGG - Intronic
1132759862 16:1503431-1503453 GTCCCAGTTACTCGGGAGGCTGG + Intronic
1133331053 16:4974317-4974339 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1133543084 16:6775216-6775238 GTCCCAGCTACTCGGGAGGCAGG + Intronic
1134144531 16:11749490-11749512 GTCCCAGCTACTCGGGAGGCAGG + Intergenic
1134252865 16:12586947-12586969 GTCCCAGCTATTCGGGAGGCTGG + Intergenic
1134499554 16:14758398-14758420 ATCCCAGCTAGTCGGGAGGCTGG - Intronic
1134571083 16:15291728-15291750 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1134618972 16:15673319-15673341 GTCCCAGCTACCCGGGAGGCAGG - Intronic
1135032209 16:19047512-19047534 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1135082539 16:19448974-19448996 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1135321344 16:21499351-21499373 TTTCCCTGTAACCGGGAGGCAGG + Intergenic
1135374177 16:21930853-21930875 TTTCCCTGTAACCGGGAGGCAGG + Intergenic
1135437609 16:22439868-22439890 TTTCCCTGTAACCGGGAGGCAGG - Intergenic
1135615643 16:23908641-23908663 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1135679476 16:24444224-24444246 GTCCCAGATACTCGGGAGGCTGG + Intergenic
1135694976 16:24577617-24577639 GTCCCAGCTACTCGGGAGGCAGG + Intergenic
1135810946 16:25586303-25586325 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1135924408 16:26679944-26679966 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1135984299 16:27172800-27172822 GTCCCAGGTACTTGGGAGGCTGG + Intergenic
1136085143 16:27879495-27879517 GTCCCAGTTAGTCAGGAGGCTGG + Intronic
1136348542 16:29692461-29692483 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1137635180 16:49979817-49979839 GTCCCAGCTATTCGGGAGGCTGG + Intergenic
1137926828 16:52547678-52547700 TCTCCCGGTAGCCGGGAGCCGGG + Intronic
1138362355 16:56442021-56442043 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1138502262 16:57454538-57454560 GTCCCAGCTACCTGGGAGGCTGG + Intronic
1138677011 16:58658743-58658765 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1138695674 16:58811027-58811049 GTCCCAGCTACTCGGGAGGCAGG - Intergenic
1139895110 16:70282209-70282231 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1140230079 16:73110679-73110701 GTCCCAGCTACTCGGGAGGCAGG - Intergenic
1140352754 16:74278586-74278608 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1140470565 16:75211907-75211929 GTCCCAGCTAACTGGGAGGCTGG - Intergenic
1141429211 16:83962354-83962376 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1141511315 16:84514037-84514059 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1141856149 16:86682751-86682773 GGCCCTGGCAGCCGGGAGCCAGG + Intergenic
1142076318 16:88120151-88120173 CTCCCTGGAAGCCGGGAAGCTGG - Intergenic
1142442605 16:90109533-90109555 GTCCCAGCTACTCGGGAGGCCGG - Intergenic
1203142456 16_KI270728v1_random:1777228-1777250 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1142650423 17:1347219-1347241 GTCCCAGCTACTCGGGAGGCAGG + Intronic
1142822591 17:2482797-2482819 GTCCCCGCTACGCAGGAGGCAGG + Intronic
1142849874 17:2699442-2699464 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1143006352 17:3837614-3837636 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1143193417 17:5057243-5057265 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1143632115 17:8145439-8145461 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1143719377 17:8799183-8799205 GCCCCAGGTACCCGGGAGGGAGG + Exonic
1143953723 17:10653291-10653313 GTCCCCTGCAGTCGTGAGGCAGG + Intronic
1144007261 17:11112259-11112281 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1144490210 17:15702002-15702024 GTCCCAGCTAGTCTGGAGGCTGG + Intronic
1144739613 17:17574435-17574457 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1145236141 17:21209649-21209671 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1145897708 17:28470171-28470193 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1145959072 17:28875507-28875529 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1146819981 17:35977198-35977220 GTCCCAGCTACTCGGGAGGCTGG + Exonic
1147201512 17:38805155-38805177 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1147340282 17:39749716-39749738 GTCCCAGCTACCTGGGAGGCTGG + Intergenic
1147708548 17:42446020-42446042 GTCCCAGTTACTCGGGAGGCTGG + Intergenic
1147741263 17:42672184-42672206 GTCTTGGGTAGCCGGGAGCCCGG + Exonic
1147760334 17:42793968-42793990 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1147840385 17:43367377-43367399 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1147905503 17:43820061-43820083 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1148690893 17:49526298-49526320 GGCCGGGGTAGCGGGGAGGCAGG - Intergenic
1148704721 17:49619649-49619671 GTCCCCGCTACTCGGGAGGCTGG - Intronic
1148863701 17:50617923-50617945 GCCCCAGGTAGCCGGGAGGTGGG + Exonic
1149338997 17:55667149-55667171 CTCCCAAGTAGCTGGGAGGCTGG - Intergenic
1149791071 17:59478061-59478083 GTCCCAGGTACTTGGGAGGCTGG + Intergenic
1149822595 17:59794036-59794058 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1149922867 17:60675622-60675644 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1150294450 17:64000445-64000467 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1150672673 17:67215464-67215486 GTCCCAGCTACCTGGGAGGCTGG - Intronic
1150686515 17:67325511-67325533 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1150736578 17:67745415-67745437 GTCCCAGCTACCCAGGAGGCTGG - Intergenic
1150815979 17:68392129-68392151 GGCCCTGGTAGCCCTGAGGCTGG - Intronic
1151046876 17:70930605-70930627 GTCCCAGCTAGTCAGGAGGCTGG + Intergenic
1151138297 17:71968491-71968513 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1151305384 17:73259789-73259811 GTCCCTGGAAGCTGGGGGGCTGG - Intronic
1151391986 17:73793517-73793539 GTCCCAGGTACTTGGGAGGCTGG - Intergenic
1151441656 17:74133217-74133239 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1151797589 17:76356633-76356655 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1151904733 17:77040221-77040243 GTCCCAGGTACTCAGGAGGCTGG + Intergenic
1152074352 17:78149649-78149671 GTCCCAGGTACTTGGGAGGCTGG - Intronic
1152098819 17:78288977-78288999 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1152411665 17:80127330-80127352 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1152419608 17:80185163-80185185 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1152575735 17:81140128-81140150 ATCCCAGCTACCCGGGAGGCTGG - Intronic
1152640395 17:81447037-81447059 GGCGCAGGTATCCGGGAGGCAGG - Exonic
1152746228 17:82040752-82040774 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1152796913 17:82312573-82312595 GTCCCAGCTACCCAGGAGGCTGG + Intergenic
1152829498 17:82488491-82488513 GTCCCAGCTACTCGGGAGGCTGG - Exonic
1153522562 18:5966438-5966460 GTCCCTGGAAGCCGGGTGTCAGG - Intronic
1153599993 18:6771152-6771174 GTCCCAGCTATCCAGGAGGCTGG - Intronic
1154157313 18:11953881-11953903 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1154238975 18:12634128-12634150 GTCCCAGCTACCTGGGAGGCTGG + Intronic
1154266489 18:12883582-12883604 GTCCCCGGGAGCGGTGAGGGCGG - Intronic
1154448063 18:14450629-14450651 GTTCCGTGTAGCCGGGAGGCTGG - Intergenic
1154457723 18:14544688-14544710 GTCCCAGCTACTCGGGAGGCAGG + Intergenic
1154464878 18:14633280-14633302 GTCACCGGTGGCTGGCAGGCGGG - Intergenic
1154532799 18:15364782-15364804 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1155187385 18:23399224-23399246 GTCCACAGGAGCAGGGAGGCAGG - Intronic
1155280013 18:24229866-24229888 GTCCCAGGTACTTGGGAGGCTGG - Intronic
1155518885 18:26649624-26649646 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1155795518 18:30031359-30031381 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1156852237 18:41742170-41742192 GTCCCAGGTACTTGGGAGGCTGG - Intergenic
1157618253 18:49000644-49000666 GTCCCAGCTAGTTGGGAGGCTGG - Intergenic
1158143824 18:54287695-54287717 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1159009924 18:63049180-63049202 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1159695414 18:71551680-71551702 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1160231014 18:77049035-77049057 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1160514442 18:79470736-79470758 GCCCCCTGAAGACGGGAGGCGGG - Intronic
1160788782 19:913279-913301 GTTCCCGGCAGCCGGGAGGTGGG - Intergenic
1160812252 19:1017885-1017907 GGCCCCGGTGGCCTGGAGGCAGG - Intronic
1161191852 19:2961922-2961944 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1161269242 19:3380747-3380769 GTCCCAGCTAGTTGGGAGGCTGG - Intronic
1161331508 19:3690376-3690398 GTCCCAGCTAGTTGGGAGGCTGG + Intronic
1161639380 19:5411369-5411391 GTCCCAGTTACTCGGGAGGCTGG - Intergenic
1161679830 19:5674331-5674353 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1161709602 19:5840583-5840605 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1161880142 19:6943870-6943892 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1161938247 19:7385591-7385613 ATCCCCGCTACTCGGGAGGCTGG - Intronic
1162035319 19:7935281-7935303 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1162377229 19:10311815-10311837 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1162394149 19:10406431-10406453 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1162403929 19:10462231-10462253 GAACCCGGGAGGCGGGAGGCGGG - Intronic
1162618045 19:11817477-11817499 GTCCCAGGTACTCGGGAGGCTGG + Intronic
1162647630 19:12061489-12061511 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1162766026 19:12919947-12919969 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1162912936 19:13859438-13859460 GTCCCAGCTAGTTGGGAGGCTGG + Intergenic
1162915460 19:13872434-13872456 GTCCCAGCTAGTTGGGAGGCAGG - Intronic
1163055762 19:14716374-14716396 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1163181837 19:15609383-15609405 GTCCCAGGTACTCGGGAGGCTGG + Intergenic
1163489350 19:17607699-17607721 GTCCCAGCTACCTGGGAGGCTGG - Intronic
1163502570 19:17685812-17685834 GTCCCCGGTGGAGGGGAGGGGGG + Intronic
1163513233 19:17748224-17748246 GTCCCCGGTGGTCTGCAGGCCGG - Intronic
1163647434 19:18497697-18497719 GTCCCAGCTACCCGGGAGGCTGG + Intronic
1164163269 19:22645162-22645184 GTCCCAGGTTCTCGGGAGGCTGG - Intronic
1164255539 19:23524934-23524956 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1164929347 19:32163657-32163679 GTCCCAGTTACTCGGGAGGCAGG - Intergenic
1164948516 19:32316417-32316439 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1165040331 19:33064214-33064236 GTCCCAGTTACTCGGGAGGCTGG + Intronic
1165161059 19:33816622-33816644 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1165440500 19:35823883-35823905 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1165525056 19:36347490-36347512 GTCCCAGTTACTCGGGAGGCTGG + Intronic
1165842908 19:38799473-38799495 GTCCCAGCTACCTGGGAGGCTGG + Intergenic
1165928301 19:39341238-39341260 GGCCCCTCTAGCCGGGAGACTGG - Intronic
1166009273 19:39929195-39929217 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1166031397 19:40133255-40133277 GTCCCAGATACTCGGGAGGCTGG - Intergenic
1166082084 19:40450386-40450408 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1166286380 19:41832354-41832376 GTCCCAGGTACTCAGGAGGCTGG + Intergenic
1166528280 19:43526780-43526802 TTCCCCGGGAGTCGGGAGTCCGG + Intronic
1166828373 19:45623414-45623436 GTCCCAGGTACTTGGGAGGCAGG + Intronic
1166892556 19:46002531-46002553 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1167318717 19:48782237-48782259 GTCCCCGCTACTCGGGAGGAGGG - Intergenic
1167332134 19:48862624-48862646 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1167600129 19:50450037-50450059 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1167648836 19:50719122-50719144 GCCCCGGAGAGCCGGGAGGCGGG + Intronic
1167716250 19:51144432-51144454 ATCCCCGGTACCCTGGAGTCTGG + Exonic
1167723784 19:51197443-51197465 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1168256431 19:55168182-55168204 GTCCCAGCTACCTGGGAGGCTGG - Intergenic
1168287357 19:55341302-55341324 GCCCCAGGCAGCCTGGAGGCGGG - Intronic
1168500638 19:56890001-56890023 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
925008708 2:466500-466522 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
926721847 2:15966835-15966857 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
927652358 2:24920240-24920262 GGCCCCGGGAGGCGGGAGGCGGG + Intergenic
927778600 2:25921426-25921448 CTCCCCAGTAGCTGGGAGCCGGG - Intergenic
927839292 2:26428678-26428700 GTCCCAGCTACCCGGGAGGCTGG + Intronic
927915154 2:26930854-26930876 GTCCCAGCTACGCGGGAGGCTGG + Intronic
927975083 2:27332530-27332552 GTCCCAGCTACCCGGGAGGCTGG - Intronic
928322832 2:30296699-30296721 GGCTCCTGTAGCCTGGAGGCAGG + Intronic
928544884 2:32320449-32320471 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
928931474 2:36629407-36629429 GTCCCAGCTACTCGGGAGGCTGG + Intronic
929201356 2:39240306-39240328 ATCCCAGGTACTCGGGAGGCAGG + Intergenic
929594046 2:43164977-43164999 GTCCCAGCTACTCGGGAGGCAGG - Intergenic
929616042 2:43308582-43308604 GTCCCAGTTACTCGGGAGGCTGG + Intronic
929724370 2:44408857-44408879 GTCCCAGCTACCCAGGAGGCTGG - Intronic
930700282 2:54453659-54453681 GTCCCAGGTACTCTGGAGGCTGG - Intergenic
930817621 2:55615732-55615754 GTCCCAGGTACACGGGAGGGTGG + Intronic
931359713 2:61567808-61567830 GTCCCAGCTACTCGGGAGGCAGG + Intergenic
931397883 2:61904126-61904148 GTCCCAGCTACTCGGGAGGCTGG - Intronic
931692878 2:64850339-64850361 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
932119466 2:69084968-69084990 GTCCCAGCTACTCGGGAGGCTGG - Intronic
932630173 2:73335184-73335206 GTCCCAGCTATTCGGGAGGCTGG - Intergenic
933035029 2:77385863-77385885 ATCCCAGCTAGTCGGGAGGCTGG - Intronic
934067559 2:88353800-88353822 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
934571959 2:95378238-95378260 GTCCCAGGTACTCGGGAGGCTGG - Intronic
934627782 2:95876732-95876754 GTCCCAGCTAGTCGGGAGGCTGG + Intronic
934704953 2:96470827-96470849 GGCCCCTGCAGGCGGGAGGCAGG + Intergenic
934733506 2:96674338-96674360 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
934805786 2:97224565-97224587 GTCCCAGCTAGTCGGGAGGCTGG - Intronic
934831733 2:97532603-97532625 GTCCCAGCTAGTCGGGAGGCTGG + Intronic
935014909 2:99172763-99172785 GTCCCAGCTACTCGGGAGGCTGG + Intronic
935355952 2:102200037-102200059 GTCCCAGCTACTCGGGAGGCTGG + Intronic
937123089 2:119454214-119454236 GCACCCGGTACCCAGGAGGCAGG + Intronic
937162620 2:119779497-119779519 GTCCCAGCTACTCGGGAGGCTGG + Intronic
937740908 2:125352396-125352418 GTCCCAGGTACCCGGTAGGCTGG + Intergenic
938473526 2:131587745-131587767 GTCCCAGCTACTCGGGAGGCAGG + Intergenic
938531900 2:132196022-132196044 GTCCCAGCTATTCGGGAGGCTGG + Intronic
938846166 2:135211421-135211443 GTCCCAGCTACCTGGGAGGCAGG + Intronic
938987061 2:136587025-136587047 CTCCCAAGTAGCTGGGAGGCTGG + Intergenic
939176497 2:138754084-138754106 GTCCCAGGTATTTGGGAGGCTGG - Intronic
939310043 2:140464076-140464098 GTCCCAGCTACTCGGGAGGCTGG + Intronic
940219325 2:151335155-151335177 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
940291020 2:152077610-152077632 GTCCCAGCTACTCGGGAGGCTGG + Intronic
940336312 2:152531591-152531613 GTCCCAGCTACTCGGGAGGCAGG - Intronic
941552970 2:166939560-166939582 GTCCCAGCTACTCGGGAGGCTGG + Intronic
941932811 2:170959076-170959098 GTCCCAGCTACTCGGGAGGCTGG - Intronic
942026430 2:171915011-171915033 GTCCCAGCTACTCGGGAGGCAGG + Intronic
942222903 2:173788902-173788924 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
942271317 2:174278365-174278387 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
942968190 2:181922802-181922824 GTCCCAGCTACTCGGGAGGCTGG + Intronic
943278569 2:185900327-185900349 GACCCAGGTAGCCAGGAGGAAGG - Intergenic
943550409 2:189331830-189331852 GTCCCAGCTACTCGGGAGGCCGG + Intergenic
944074176 2:195709140-195709162 GTCCCAGCTACTCGGGAGGCTGG - Intronic
944118251 2:196211952-196211974 GTCCCAGCTACTCGGGAGGCAGG - Intronic
944617239 2:201474006-201474028 GTCCCAGCTACTCGGGAGGCTGG - Intronic
944732727 2:202533703-202533725 GTCCCAGCTACTCGGGAGGCTGG + Intronic
944829994 2:203523884-203523906 GTCCCAGCTACTCGGGAGGCTGG + Intronic
944856160 2:203769283-203769305 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
945110024 2:206353778-206353800 GTCCCAGGTACTTGGGAGGCTGG + Intergenic
945146946 2:206748259-206748281 GTCCCAGCTACTCGGGAGGCTGG + Intronic
945239775 2:207665839-207665861 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
945601148 2:211866131-211866153 GTCCCAGCTACTCGGGAGGCTGG + Intronic
945601158 2:211866163-211866185 ATCGCCTGTACCCGGGAGGCGGG + Intronic
945710476 2:213288420-213288442 GTCCCAGCTACTCGGGAGGCTGG - Intronic
945954068 2:216068753-216068775 GTCCCAGCTACTCGGGAGGCTGG - Intronic
946029410 2:216692892-216692914 GTCCGCGCTTGCCAGGAGGCCGG - Intronic
946044812 2:216812078-216812100 GTCCCAGGTACTTGGGAGGCTGG + Intergenic
946218758 2:218207939-218207961 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
946356577 2:219189776-219189798 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
947234407 2:227924693-227924715 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
947538405 2:230956280-230956302 GTCCCAGGTACTCGGGAGGCTGG - Intronic
947889994 2:233609127-233609149 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
947985072 2:234440720-234440742 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
948115781 2:235493860-235493882 GTCCCAGGAAGCCCAGAGGCAGG + Intergenic
948478977 2:238238965-238238987 GTCCCCAGGACCCGGGGGGCTGG + Exonic
948587073 2:239026231-239026253 CTCCCTGGCAGCCTGGAGGCTGG - Intergenic
948960648 2:241333619-241333641 GTCCCAGCTACTCGGGAGGCAGG - Intronic
1168815819 20:736269-736291 GTCCCAGGTACTTGGGAGGCTGG + Intergenic
1169493512 20:6091345-6091367 ATCCCAGCTACCCGGGAGGCTGG - Intronic
1169600439 20:7253907-7253929 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1169775322 20:9245750-9245772 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1169825690 20:9766102-9766124 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1171377894 20:24707232-24707254 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1171455656 20:25270613-25270635 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1172252372 20:33489158-33489180 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1172304753 20:33872838-33872860 GTCCCAGCTAATCGGGAGGCTGG + Intergenic
1173245229 20:41332615-41332637 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1173505362 20:43582803-43582825 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1173513160 20:43646091-43646113 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1173541955 20:43860487-43860509 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1173937507 20:46880320-46880342 GTCCCAGTTACTCGGGAGGCTGG - Intergenic
1174381745 20:50160132-50160154 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1174477077 20:50803061-50803083 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1174630544 20:51953275-51953297 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1174986796 20:55463321-55463343 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1176764562 21:13003425-13003447 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1176786881 21:13267704-13267726 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1176809657 21:13525103-13525125 GTCGCCGGTGGCCGGCAGGCTGG + Intergenic
1176816435 21:13608650-13608672 GTCCCAGCTACTCGGGAGGCAGG - Intergenic
1177445267 21:21187110-21187132 GTCCCAGCTACTCGGGAGGCAGG + Intronic
1177648834 21:23934875-23934897 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1177694046 21:24549378-24549400 GTTCCGGGTACTCGGGAGGCTGG - Intergenic
1177695495 21:24565883-24565905 GTCCCAGCTACCCGGGAGGCTGG + Intergenic
1178271157 21:31191271-31191293 GTCCCAGGTACTCGGGAGGCAGG - Intronic
1178322154 21:31613845-31613867 GTCCCTGGAACCCGGGAGGCGGG + Intergenic
1179213939 21:39349836-39349858 GTCCCAGCTACTCGGGAGGCCGG - Intergenic
1180511756 22:16098232-16098254 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1180645305 22:17333687-17333709 GTCCCAGCTATTCGGGAGGCTGG + Intergenic
1181600532 22:23949389-23949411 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1181607979 22:23991933-23991955 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1182186584 22:28409772-28409794 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1182251377 22:29003720-29003742 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1182567056 22:31208036-31208058 GTCCCAGCTACCCGGGAGGGAGG + Intergenic
1182839169 22:33371864-33371886 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1183366440 22:37409473-37409495 GTCCCAGGGAGCCCGCAGGCAGG + Intronic
1183458998 22:37938282-37938304 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1183470764 22:38005238-38005260 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1183897901 22:40983792-40983814 GTCCCAGGTACTCAGGAGGCTGG + Intergenic
1183981545 22:41543501-41543523 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1184107780 22:42378448-42378470 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1184371560 22:44085420-44085442 GTCCCAGCTACCCAGGAGGCTGG - Intronic
1184395353 22:44232723-44232745 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1184447616 22:44559395-44559417 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1184754735 22:46509384-46509406 GTCCCAGGTAGAGAGGAGGCTGG - Intronic
949347436 3:3089738-3089760 GTCCCAGCTACTCGGGAGGCAGG - Intronic
949724784 3:7031532-7031554 GTCCCAGCTACTCGGGAGGCTGG - Intronic
949985070 3:9534103-9534125 GTCCCCGCTATTTGGGAGGCAGG + Intronic
950383501 3:12637381-12637403 GTCCCCGCTACTGGGGAGGCTGG - Intronic
950404052 3:12793620-12793642 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
950853766 3:16086838-16086860 GTCCCGAGGAGCCAGGAGGCAGG + Intergenic
951613916 3:24521717-24521739 GCCGCCGGTCGCCGGGAGCCCGG + Intergenic
951613920 3:24521724-24521746 GTCGCCGGGAGCCCGGAGCCGGG + Intergenic
952268243 3:31807260-31807282 ATCCCAGCTAGTCGGGAGGCTGG + Intronic
952874332 3:37930377-37930399 GTCCCAGCTAGTTGGGAGGCTGG - Intronic
952909455 3:38169845-38169867 GTCCCAGCTACCTGGGAGGCAGG - Intronic
953294697 3:41702969-41702991 GTCCCAGCTACTCGGGAGGCTGG - Intronic
953439538 3:42906140-42906162 GGCCCCAGCATCCGGGAGGCCGG - Intronic
953491542 3:43356561-43356583 GTCCCAGCTACCCGGGAGGGAGG + Intronic
953649675 3:44790808-44790830 GTCCCAGCTACTCGGGAGGCTGG - Intronic
953656891 3:44861592-44861614 TTCACCGGGAGCCGGGTGGCCGG + Intronic
953863761 3:46566141-46566163 GTCCGAGGTGGCCGGGGGGCGGG - Intronic
954015139 3:47682394-47682416 GTCCCGGCTATCCTGGAGGCTGG - Intronic
954031229 3:47821381-47821403 TTCCCCGGTACTCGGGGGGCTGG - Intronic
954174783 3:48835521-48835543 GTCCCAGCTACTCGGGAGGCTGG + Intronic
954242536 3:49305188-49305210 GTCCCAGCTACTCGGGAGGCTGG - Intronic
954347635 3:50013548-50013570 GTCCCAGCTACTCGGGAGGCTGG + Intronic
955240569 3:57174416-57174438 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
955240892 3:57177145-57177167 GTCCCAGCTACTCGGGAGGCAGG - Intergenic
955383080 3:58457112-58457134 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
955765570 3:62340732-62340754 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
956092623 3:65684054-65684076 GTCCCAGCTACCTGGGAGGCTGG + Intronic
957113737 3:75997607-75997629 GTCCCAGCTACTCGGGAGGCTGG - Intronic
957816848 3:85311491-85311513 GTCCCAGTTACTCGGGAGGCTGG - Intronic
959332749 3:105026564-105026586 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
960001407 3:112735463-112735485 GTCCCAGGTACTCAGGAGGCTGG + Intergenic
961402884 3:126659428-126659450 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
961594887 3:128008115-128008137 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
961607207 3:128105235-128105257 GTCCCAGCTACTCGGGAGGCTGG - Intronic
961883632 3:130081130-130081152 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
962218788 3:133545851-133545873 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
962396758 3:135022095-135022117 GTCCCAGCTACTCGGGAGGCTGG - Intronic
962950529 3:140214334-140214356 GTCCCAGCTACTCGGGAGGCTGG + Intronic
963802940 3:149695641-149695663 ATCCCAGGTACCTGGGAGGCTGG + Intronic
963942509 3:151109167-151109189 GTCCCAGCTACTCGGGAGGCAGG - Intronic
963994896 3:151696686-151696708 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
964133488 3:153317518-153317540 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
964356541 3:155856149-155856171 GTCCCAGATACTCGGGAGGCTGG + Intergenic
964813062 3:160686385-160686407 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
965096584 3:164236415-164236437 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
965097778 3:164256120-164256142 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
965654503 3:170969604-170969626 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
966347524 3:178995959-178995981 GTCCCAGATACTCGGGAGGCTGG + Intergenic
966415716 3:179687539-179687561 GTCCCAGCTACTCGGGAGGCTGG + Intronic
966555242 3:181251522-181251544 GTCCCAGCTACCCAGGAGGCTGG - Intergenic
966689896 3:182731480-182731502 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
966727179 3:183118289-183118311 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
967069522 3:185950432-185950454 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
967223389 3:187268367-187268389 GTCCCAGCTACCCTGGAGGCTGG + Intronic
967501351 3:190201715-190201737 GTCCCAGTTACTCGGGAGGCTGG + Intergenic
967554077 3:190834088-190834110 CTCCCAGCTACCCGGGAGGCTGG + Intergenic
967722746 3:192832670-192832692 GTCCCAGCTACTCGGGAGGCTGG + Intronic
967741058 3:193002683-193002705 GTCCCAGGTACTTGGGAGGCTGG - Intergenic
967804187 3:193700161-193700183 GCTCCCGGCAGCGGGGAGGCAGG - Intergenic
967895388 3:194391790-194391812 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
968145314 3:196293506-196293528 GTCCCAGCTACTCGGGAGGCTGG + Intronic
968216407 3:196895301-196895323 GTCCCAGCTACTCGGGAGGCAGG - Intronic
968249229 3:197190890-197190912 GTCCCAGCTACTCGGGAGGCTGG + Intronic
968292402 3:197548731-197548753 GTCCCAGCTACTCGGGAGGCTGG + Intronic
968362877 3:198160493-198160515 GTCCCAGCTACTCGGGAGGCCGG - Intergenic
968537222 4:1140974-1140996 GTCCCAGCTACTCGGGAGGCAGG + Intergenic
968549768 4:1216239-1216261 CTCACCCGTGGCCGGGAGGCCGG + Intronic
968701472 4:2059964-2059986 GTCCCCGGGAGCCGGGCGCGGGG - Intronic
968983900 4:3865208-3865230 CTGCCCGGCAGCAGGGAGGCTGG - Intergenic
969198182 4:5579721-5579743 GTCCCAGCTACTCGGGAGGCTGG + Intronic
969297573 4:6278850-6278872 TTCCCCTGAAGCCGTGAGGCTGG - Intronic
969412781 4:7040588-7040610 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
969862072 4:10045214-10045236 GTCCCAGCTACTCGGGAGGCTGG - Intronic
970564084 4:17314528-17314550 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
970619411 4:17801983-17802005 GTCCCAGCTATTCGGGAGGCAGG + Exonic
970664177 4:18318333-18318355 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
971405631 4:26319490-26319512 GTGCCCGGGAGGCGGGCGGCGGG - Intronic
971440682 4:26681431-26681453 GTCCCAGCTACTCGGGAGGCTGG + Intronic
972368790 4:38401335-38401357 GTCCCTGCTACTCGGGAGGCAGG - Intergenic
972561190 4:40230446-40230468 GTCCCAGCTATTCGGGAGGCTGG - Intronic
973282259 4:48371824-48371846 GTCCCAGCTAGTCGGGAGACTGG + Intronic
973952800 4:56034842-56034864 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
974061696 4:57041651-57041673 GTCCCAGCTACTCGGGAGGCTGG - Intronic
974305732 4:60137398-60137420 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
974356592 4:60820441-60820463 GTCCCAGCTAGTCGTGAGGCTGG - Intergenic
974449762 4:62038724-62038746 GTCCCAGCTACTCGGGAGGCTGG - Intronic
975118644 4:70705397-70705419 GAGCCGGGTGGCCGGGAGGCGGG + Intronic
975317916 4:72976865-72976887 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
976662617 4:87555474-87555496 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
976729102 4:88244539-88244561 GTCCCCTGGAGCCTGGGGGCTGG + Intergenic
977303754 4:95298192-95298214 GTCCCAGCTACCTGGGAGGCTGG + Intronic
977491030 4:97711785-97711807 GTCCCAGCTACTCGGGAGGCTGG - Intronic
977822557 4:101491089-101491111 GTCCCAGCTACTCGGGAGGCAGG + Intronic
978947744 4:114518073-114518095 GTCCCAGCTACCAGGGAGGCTGG + Intergenic
978974626 4:114854584-114854606 GTCCCAGCTACTCGGGAGGCTGG - Intronic
980315958 4:131200481-131200503 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
980344392 4:131594020-131594042 GTCCCAGCTATTCGGGAGGCTGG - Intergenic
980383013 4:132050235-132050257 ATCCCAGGTACTCGGGAGGCTGG - Intergenic
980985845 4:139693285-139693307 GTCCCAGCTACTCGGGAGGCTGG + Intronic
981223796 4:142268203-142268225 GTCCCAGCTACTCGGGAGGCTGG + Intronic
981708916 4:147689587-147689609 GTCCCAGATATTCGGGAGGCTGG + Intergenic
982294007 4:153808043-153808065 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
982398606 4:154941083-154941105 GTCCCAGTTACTCGGGAGGCAGG - Intergenic
982432147 4:155335620-155335642 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
983614314 4:169684924-169684946 GTCCCAGCTACCTGGGAGGCTGG - Intronic
983641337 4:169946475-169946497 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
983780290 4:171662216-171662238 GTCCCAGGTAGTTGGAAGGCAGG - Intergenic
984205093 4:176777799-176777821 GTCCCTGCTACTCGGGAGGCTGG + Intronic
984615745 4:181895660-181895682 GTCCCAGCTACCCAGGAGGCTGG - Intergenic
984686473 4:182674691-182674713 GTCCCAGCTACCCAGGAGGCTGG - Intronic
984705947 4:182847260-182847282 ATCCCAGGTAGTCAGGAGGCTGG + Intergenic
985447122 4:190029315-190029337 GTCCCAGCTAGTTGGGAGGCAGG + Intergenic
985548973 5:523857-523879 GGACCCGGGAGCCGGGAGTCCGG + Intronic
985567442 5:626707-626729 GTCCCAGCTACTCGGGAGGCAGG + Intronic
986413461 5:7504993-7505015 GTCCCAGTTACTCGGGAGGCTGG - Intronic
986599266 5:9455371-9455393 GTCCCAGCTACTCGGGAGGCTGG - Intronic
986824102 5:11501908-11501930 GTCCCAGCTACTCGGGAGGCTGG + Intronic
986913140 5:12582836-12582858 GTCCCAGTTACTCGGGAGGCTGG + Intergenic
988587675 5:32522140-32522162 ATCCCAGCTAGTCGGGAGGCTGG - Intergenic
989584718 5:43065977-43065999 GTCCCAGCTACCCCGGAGGCTGG + Intronic
989989776 5:50747888-50747910 GTCCCAGCTATTCGGGAGGCTGG - Intronic
990390575 5:55315803-55315825 GTCCCAGCTAGTAGGGAGGCTGG + Intronic
990571527 5:57083705-57083727 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
991044678 5:62210562-62210584 GTCCCAGCTATTCGGGAGGCTGG + Intergenic
991363551 5:65845124-65845146 GTCCCAGCTACTCGGGAGGCAGG - Intronic
991675449 5:69086107-69086129 GTCCCTGTTACGCGGGAGGCTGG - Intergenic
991691010 5:69224954-69224976 GTCCCAGCTACTCGGGAGGCTGG + Intronic
992431404 5:76715097-76715119 GTCCCAGGTAATCCGGAGGCTGG + Intergenic
992765014 5:79990816-79990838 GTCCTCGAAAGCCGGGTGGCTGG - Intronic
992858446 5:80888162-80888184 CTCCCCGGTAGCTGGGACTCAGG - Intergenic
993343175 5:86750435-86750457 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
993809106 5:92453526-92453548 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
994142338 5:96355817-96355839 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
995505837 5:112860027-112860049 GTCCCAGCTACTCGGGAGGCAGG - Intronic
995938718 5:117551460-117551482 GTCAGCTGTGGCCGGGAGGCTGG + Intergenic
996109519 5:119548895-119548917 GTCCCAGCTATTCGGGAGGCTGG + Intronic
996797243 5:127362479-127362501 GTCCCAGCTACTCGGGAGGCAGG - Intronic
997484390 5:134217160-134217182 ATCCCAGCTACCCGGGAGGCTGG + Intronic
998013452 5:138713915-138713937 GTCCCAGCTACCTGGGAGGCTGG - Intronic
998893136 5:146768189-146768211 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1000122036 5:158206793-158206815 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1000307258 5:160006195-160006217 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1000318009 5:160111514-160111536 GTCCCAGGTACATGGGAGGCTGG + Intronic
1001119782 5:168970375-168970397 GTCCCAGCTACGCGGGAGGCTGG + Intronic
1001486912 5:172126444-172126466 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1001492744 5:172167040-172167062 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1001613947 5:173027059-173027081 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1001636912 5:173216938-173216960 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1002043600 5:176530483-176530505 CTCCCAGGCAGCTGGGAGGCAGG - Intronic
1002202826 5:177540187-177540209 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1002281658 5:178133827-178133849 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1002355537 5:178626445-178626467 GTGCCCAGGAGCCGGGAGGTGGG - Intronic
1002457150 5:179351667-179351689 GTCCTGGGTAGCAGGGAGCCTGG + Intergenic
1002458579 5:179360747-179360769 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1002524564 5:179807768-179807790 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1003191079 6:3875078-3875100 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1003612641 6:7627412-7627434 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1003921498 6:10837887-10837909 GTCCCCGGGCGCCGGGAGTCCGG + Intronic
1005036366 6:21558765-21558787 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1005053583 6:21709027-21709049 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1005200750 6:23341570-23341592 GTCCCAGCTACTCGGGAGGCGGG + Intergenic
1005702532 6:28416888-28416910 GTCCCAGCTATTCGGGAGGCTGG - Intergenic
1005827576 6:29643932-29643954 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1005962041 6:30700953-30700975 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1006123381 6:31821492-31821514 GTCCCAGCTACCCGGGAGGCTGG + Intergenic
1006246359 6:32740455-32740477 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1006527713 6:34621742-34621764 GTCCCAGGTACTCAGGAGGCTGG + Intronic
1006534536 6:34687578-34687600 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1006541758 6:34745751-34745773 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1007661026 6:43486471-43486493 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1007814123 6:44508303-44508325 GTCCCAGGTAGTTGGGAGGTGGG - Intergenic
1007842214 6:44725990-44726012 GTCCCAGCTATTCGGGAGGCTGG + Intergenic
1008106973 6:47449500-47449522 GTCCCAGCCACCCGGGAGGCTGG + Intergenic
1012517616 6:100081113-100081135 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1013537974 6:111080924-111080946 GTCCCAGCTACTCGGGAGGCAGG - Intergenic
1013565691 6:111358577-111358599 GTCCCAGCTACCTGGGAGGCTGG - Intronic
1013983717 6:116164977-116164999 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1014152360 6:118072444-118072466 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1014179132 6:118365679-118365701 GTCCCAGCTACCCAGGAGGCTGG - Intergenic
1014432520 6:121387874-121387896 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1014597725 6:123366633-123366655 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1014697244 6:124638771-124638793 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1015567310 6:134586860-134586882 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1015778750 6:136841699-136841721 GTCCCAGCTACCCAGGAGGCTGG - Intronic
1015986287 6:138887342-138887364 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1016015353 6:139178690-139178712 GTCCCAGCTACCTGGGAGGCTGG - Exonic
1016058719 6:139605847-139605869 GTCCCAGCTACCTGGGAGGCTGG - Intergenic
1017341142 6:153323249-153323271 GTCCCAGGTACTTGGGAGGCTGG - Intergenic
1017400368 6:154054249-154054271 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1017617618 6:156261669-156261691 GTGCCAGGTACTCGGGAGGCTGG + Intergenic
1017722488 6:157253611-157253633 GTCCCAGCTACTCGGGAGGCAGG + Intergenic
1018255715 6:161916917-161916939 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1018284884 6:162226649-162226671 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1018306214 6:162458936-162458958 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1018679076 6:166248802-166248824 GTCCCAGCTACTCGGGAGGCAGG - Intergenic
1019146301 6:169977549-169977571 CTCCCCGGGTGCAGGGAGGCAGG + Intergenic
1019252804 7:28218-28240 GTCCCAGCTACTCGGGAGGCCGG + Intergenic
1019325112 7:434192-434214 GTCCCAGCTACTCGGGAGGCCGG + Intergenic
1019425825 7:976071-976093 GCCCCCAGAAGCTGGGAGGCTGG - Intergenic
1019490609 7:1311541-1311563 GCCCCCGGTCGCCAGCAGGCAGG - Intergenic
1019507739 7:1401300-1401322 CTCCCGAGTAGCTGGGAGGCTGG - Intergenic
1019661855 7:2228856-2228878 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1019965295 7:4493966-4493988 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1020059138 7:5139425-5139447 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1020088380 7:5323683-5323705 ATCCCAGCTACCCGGGAGGCTGG - Intronic
1020126789 7:5537394-5537416 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1020187581 7:5970694-5970716 GTCCGCGGTTGCCTGGAGACCGG - Intergenic
1020273322 7:6609935-6609957 ATCCCAGGTACTCGGGAGGCTGG + Intergenic
1020281537 7:6652604-6652626 GGCCCCGCCGGCCGGGAGGCCGG + Exonic
1020295336 7:6754076-6754098 GTCCGCGGTTGCCTGGAGACCGG + Intergenic
1020669349 7:11087307-11087329 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1021174088 7:17430011-17430033 GTCCCAGTTACTCGGGAGGCTGG - Intergenic
1022005129 7:26260544-26260566 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1022028884 7:26473730-26473752 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1022231733 7:28420688-28420710 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1022396376 7:29990691-29990713 GAACCCGGGAGGCGGGAGGCGGG - Intergenic
1022465634 7:30651718-30651740 GTCCCAGCTATTCGGGAGGCTGG + Intergenic
1022716591 7:32904260-32904282 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1022740309 7:33113894-33113916 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1022923369 7:35037525-35037547 CTCCCCGCGGGCCGGGAGGCGGG + Intronic
1023131014 7:37003268-37003290 ATCCCGGGTACTCGGGAGGCTGG + Intronic
1023338020 7:39190009-39190031 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1023710826 7:42990769-42990791 GTCCCAGCTACCAGGGAGGCTGG + Intergenic
1024836520 7:53526091-53526113 GTCCCGGCTACTCGGGAGGCTGG - Intergenic
1025073238 7:55919621-55919643 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1025205931 7:56993429-56993451 ATCCCAGCTACCCGGGAGGCTGG + Intergenic
1025666009 7:63583509-63583531 ATCCCAGCTACCCGGGAGGCTGG - Intergenic
1025932737 7:66009561-66009583 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1025976877 7:66377094-66377116 GCCCCCGGCAGGCGGGAGCCGGG + Intronic
1026009752 7:66628028-66628050 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1026585787 7:71655135-71655157 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1026919205 7:74142703-74142725 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1026939047 7:74276291-74276313 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1027047320 7:74999733-74999755 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1027153416 7:75749485-75749507 GTCCCAGCTACCCAGGAGGCTGG - Intergenic
1027227813 7:76255557-76255579 GTCCCAGCTACCTGGGAGGCTGG - Intronic
1027653317 7:80898246-80898268 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1027852765 7:83469912-83469934 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1028240822 7:88418536-88418558 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1028317453 7:89421316-89421338 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1029130437 7:98326157-98326179 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1029519087 7:101048835-101048857 GTCTCCGGTGGCCCTGAGGCGGG - Exonic
1029522551 7:101072790-101072812 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1029556004 7:101269665-101269687 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1029574107 7:101391670-101391692 GTCCCAGCTACTCGGGAGGCAGG - Intronic
1029658825 7:101945526-101945548 GTCCCAGGTGCCGGGGAGGCAGG + Intronic
1029691227 7:102183368-102183390 GTCCCAGCTACCTGGGAGGCTGG + Intronic
1030204212 7:106937043-106937065 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1030720084 7:112860792-112860814 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1030861947 7:114642924-114642946 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1031051442 7:116950010-116950032 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1033066282 7:138157847-138157869 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1033309312 7:140248671-140248693 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1033769511 7:144533957-144533979 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1034479817 7:151310949-151310971 GTCCCAGCTACCTGGGAGGCTGG + Intergenic
1034915893 7:155038702-155038724 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1035202284 7:157275454-157275476 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1036160299 8:6381295-6381317 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1036499867 8:9303847-9303869 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1036942031 8:13060833-13060855 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1036949622 8:13128715-13128737 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1037234560 8:16702733-16702755 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1037336961 8:17801253-17801275 GGCCCCGGAGGCGGGGAGGCGGG - Intergenic
1037363107 8:18094754-18094776 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1037437153 8:18875031-18875053 GTCCCAGCTACCCGAGAGGCTGG - Intronic
1037748781 8:21666629-21666651 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1037990942 8:23320794-23320816 GTCCCCGCTACTCGGGAGGTGGG + Intronic
1038183404 8:25249702-25249724 GTCCCAGCTACCTGGGAGGCTGG - Intronic
1038193565 8:25345965-25345987 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1038207550 8:25481570-25481592 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1038290142 8:26241922-26241944 GTCCCAGGTACCTGGGAGGGAGG + Intergenic
1038573577 8:28684622-28684644 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1038764891 8:30418337-30418359 CTCCCCAGTAGCTGGGACGCAGG + Intronic
1038807218 8:30805440-30805462 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1038818806 8:30933352-30933374 GACCCAGGTACTCGGGAGGCTGG - Intergenic
1039059572 8:33562971-33562993 GTCCCAGTTACTCGGGAGGCTGG + Intronic
1039155341 8:34549611-34549633 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1039182199 8:34879395-34879417 CTCCCTGGTAGAGGGGAGGCAGG - Intergenic
1039298408 8:36182672-36182694 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1039513262 8:38108701-38108723 GTCCCAGCTACTCGGGAGGCAGG + Intronic
1039608261 8:38900581-38900603 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1039724980 8:40206074-40206096 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1039995794 8:42531934-42531956 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1040026842 8:42789422-42789444 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1040058906 8:43087609-43087631 GTCCCAGCAACCCGGGAGGCTGG + Intergenic
1040393457 8:46970852-46970874 GTCCCAGTTACTCGGGAGGCTGG + Intergenic
1040507443 8:48062473-48062495 GTCCCAGCTACTCGGGAGGCTGG + Exonic
1040547652 8:48411751-48411773 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1040695182 8:49987764-49987786 GTCCCAGCTACCCAGGAGGCTGG - Intronic
1041003361 8:53473443-53473465 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1041091473 8:54305304-54305326 GTCCCAGCTAGCTGGGAGGCTGG - Intergenic
1041258816 8:56002299-56002321 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1042135872 8:65632493-65632515 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1042222962 8:66491355-66491377 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1042256232 8:66806693-66806715 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1042276025 8:67006458-67006480 GTCCCAGGTACTCAGGAGGCTGG - Intronic
1042671691 8:71270991-71271013 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1043012407 8:74897361-74897383 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1043498939 8:80834074-80834096 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1043994023 8:86790626-86790648 GTCCCAGATACTCGGGAGGCTGG - Intergenic
1044736411 8:95283504-95283526 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1045264033 8:100603853-100603875 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1045447739 8:102284917-102284939 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1045986746 8:108257865-108257887 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1046245236 8:111551193-111551215 GTCCCAGCTAATCGGGAGGCAGG - Intergenic
1046667616 8:117022080-117022102 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1046818088 8:118607351-118607373 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1047953027 8:129951184-129951206 GTCCCAGTTACTCGGGAGGCTGG + Intronic
1049222954 8:141436188-141436210 TTCCCCGGGAGCCGAGAGCCTGG - Intergenic
1049557153 8:143288778-143288800 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1049606355 8:143531075-143531097 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1049727881 8:144158854-144158876 GTCCCAGCTACTCGGGAGGCAGG - Intronic
1049736872 8:144212705-144212727 GTCCCAGCTAGTAGGGAGGCTGG - Intronic
1049937112 9:509916-509938 GTCCCAGCTACTCGGGAGGCAGG - Intronic
1050540645 9:6666557-6666579 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1050545190 9:6703762-6703784 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1050748686 9:8910154-8910176 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1051063172 9:13069107-13069129 GTCCCAGCTATTCGGGAGGCTGG + Intergenic
1051171570 9:14322708-14322730 GCGCCCGGGACCCGGGAGGCGGG + Intronic
1051224591 9:14885534-14885556 GTCCCAGGTACCTGGGAGGCTGG - Intronic
1051631422 9:19144616-19144638 GTCCCAGCTACTCGGGAGGCAGG - Intronic
1051646664 9:19275408-19275430 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1052383209 9:27794082-27794104 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1052867932 9:33477039-33477061 GTCCCAGCTAGCCAGGAAGCTGG - Intergenic
1052960100 9:34288368-34288390 GTCCCAGTTACCTGGGAGGCTGG + Intronic
1053401797 9:37831103-37831125 GTCCCAGCTACTCGGGAGGCAGG + Intronic
1053549975 9:39067513-39067535 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1053814087 9:41887606-41887628 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1054598425 9:67092889-67092911 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1054616509 9:67299834-67299856 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1054850710 9:69843756-69843778 GTCCCAGCTACACGGGAGGCTGG - Intronic
1055321396 9:75087021-75087043 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1055536230 9:77248331-77248353 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1056209831 9:84355318-84355340 GTCCCAGCTAACTGGGAGGCTGG + Intergenic
1056300110 9:85231796-85231818 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1056358253 9:85824846-85824868 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1056513333 9:87326975-87326997 GTCCCAGCTACCTGGGAGGCTGG + Intergenic
1056527613 9:87457743-87457765 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1056640377 9:88365146-88365168 GTCCCAGATATTCGGGAGGCTGG + Intergenic
1056646387 9:88415531-88415553 GTCCCAGCTAACTGGGAGGCTGG - Intronic
1057026838 9:91740432-91740454 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1057085708 9:92207990-92208012 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1057564224 9:96153912-96153934 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1057590284 9:96367100-96367122 ATCCCAGGTACTCGGGAGGCTGG + Intronic
1058216449 9:102239300-102239322 GTCCCAGCTACTCGGGAGGCAGG + Intergenic
1058684065 9:107465581-107465603 GTCCCCGGGAGCTGGAAGCCAGG + Intergenic
1059252048 9:112894570-112894592 GTCCCAGGTATTTGGGAGGCTGG + Intergenic
1059435591 9:114274122-114274144 GTCCCAGCTAGTTGGGAGGCGGG + Intronic
1059496044 9:114710347-114710369 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1059969256 9:119648188-119648210 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1060016956 9:120095091-120095113 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1060034971 9:120247369-120247391 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1060093961 9:120770256-120770278 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1060349285 9:122843586-122843608 GTCCCAGCTACTCGGGAGGCAGG - Intergenic
1060696168 9:125710934-125710956 GTCCCAGCTATTCGGGAGGCTGG - Intergenic
1060832661 9:126727155-126727177 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1060923597 9:127439978-127440000 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1061046940 9:128170535-128170557 GTCCCAGGTACTCAGGAGGCTGG + Intronic
1061347950 9:130042468-130042490 TTCCCCGGGAGCGGGGCGGCCGG - Intronic
1061575651 9:131504105-131504127 GTGTCCGGGAGCCGGGTGGCTGG + Intronic
1061613074 9:131761421-131761443 GTCCCAGCTAGTCAGGAGGCTGG - Intergenic
1061625104 9:131836908-131836930 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1062033824 9:134373925-134373947 GTCCCCACTACCCGAGAGGCCGG - Intronic
1062236472 9:135512248-135512270 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1062515991 9:136936190-136936212 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1062747565 9:138224156-138224178 GTCCCAGCTACTCGGGAGGCCGG - Intergenic
1203530922 Un_GL000213v1:140817-140839 GTCCCAGCTACTCGGGAGGCAGG + Intergenic
1185600070 X:1332921-1332943 GTCCCAGCTAGTCAGGAGGCTGG - Intergenic
1185607954 X:1378066-1378088 GTCCCAGCTACTCGGGAGGCAGG + Intronic
1185700329 X:2226681-2226703 GTCCCAGCTACTCGGGAGGCAGG + Intronic
1185723398 X:2399919-2399941 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1186460433 X:9744217-9744239 ATCCCAGCTATCCGGGAGGCTGG + Intronic
1186669820 X:11757803-11757825 GCACCCGGCGGCCGGGAGGCTGG - Intergenic
1187473145 X:19587102-19587124 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1187984349 X:24794092-24794114 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1188195116 X:27223573-27223595 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1188632087 X:32376161-32376183 ATCCCAGCTACCCGGGAGGCTGG + Intronic
1189077082 X:37927658-37927680 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1189274452 X:39775344-39775366 ATCCCCTGTACCCAGGAGGCGGG + Intergenic
1189277124 X:39794906-39794928 GTCCCAGCTATTCGGGAGGCTGG + Intergenic
1189334359 X:40161629-40161651 GTCCCAGCTACCCGGGAGGCTGG - Intronic
1189453660 X:41163633-41163655 GTCCCGGGTACTCGGGAGGCTGG + Intronic
1189465209 X:41273224-41273246 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1189828147 X:44941596-44941618 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1190186393 X:48238269-48238291 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1190195791 X:48317219-48317241 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1190238713 X:48639542-48639564 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1190662493 X:52667581-52667603 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1190668524 X:52717824-52717846 GTCCCAGCTATTCGGGAGGCTGG + Intergenic
1190670893 X:52740580-52740602 GTCCCAGCTATTCGGGAGGCTGG - Intergenic
1191137026 X:57075927-57075949 GTCCCAGCTACTCGGGAGGCCGG - Intergenic
1192129693 X:68537690-68537712 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1192464651 X:71345686-71345708 GTCCCAGCTACTCGGGAGGCTGG - Intergenic
1193860651 X:86662479-86662501 GTCCCAGCTAGTCGGGAGGCAGG + Intronic
1194273364 X:91848317-91848339 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1196119598 X:112035747-112035769 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1196905077 X:120423508-120423530 GTCCCAGCTACCTGGGAGGCTGG - Intergenic
1197331472 X:125158283-125158305 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1197533513 X:127661578-127661600 GACCCCTGTAGCCGGGATCCTGG - Intergenic
1197744030 X:129918757-129918779 GTCCCAGCTACTCGGGAGGCTGG + Intronic
1198220060 X:134590721-134590743 GTCCCAGCTACCCAGGAGGCTGG - Intronic
1198735664 X:139782207-139782229 GTCCCAGCTACCCTGGAGGCTGG + Intronic
1198757543 X:139996999-139997021 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1199349517 X:146784361-146784383 GTCCCAGCTACTCGGGAGGCTGG + Intergenic
1200099333 X:153682104-153682126 GTCCCAGTTACTCGGGAGGCTGG - Intronic
1200143457 X:153913455-153913477 GACCCAGGCAGCCGGCAGGCGGG - Exonic
1200238431 X:154480545-154480567 GTCCCAGCTATTCGGGAGGCTGG + Intergenic
1200306531 X:155031445-155031467 GTCCCAGCTACTCGGGAGGCTGG - Intronic
1200821018 Y:7582650-7582672 GTCCCGGCTACTCGGGAGGCAGG - Intergenic
1200876177 Y:8156940-8156962 GTCCCAGGTACCCAGGAGGCAGG - Intergenic
1202039536 Y:20667640-20667662 GTCCCAGCTAGTCAGGAGGCTGG + Intergenic
1202239287 Y:22750092-22750114 GTCCCGGCTACTCGGGAGGCAGG + Intergenic
1202392274 Y:24383854-24383876 GTCCCGGCTACTCGGGAGGCAGG + Intergenic
1202478510 Y:25286263-25286285 GTCCCGGCTACTCGGGAGGCAGG - Intergenic