ID: 900165758

View in Genome Browser
Species Human (GRCh38)
Location 1:1243734-1243756
Sequence GTGGGTCCCCGGTAGCCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 105}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900165758_900165769 15 Left 900165758 1:1243734-1243756 CCTCCCGGCTACCGGGGACCCAC 0: 1
1: 0
2: 0
3: 6
4: 105
Right 900165769 1:1243772-1243794 AAAGTGTGATCTGGGCCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 156
900165758_900165767 6 Left 900165758 1:1243734-1243756 CCTCCCGGCTACCGGGGACCCAC 0: 1
1: 0
2: 0
3: 6
4: 105
Right 900165767 1:1243763-1243785 TCTGGGCATAAAGTGTGATCTGG 0: 1
1: 0
2: 1
3: 3
4: 99
900165758_900165770 16 Left 900165758 1:1243734-1243756 CCTCCCGGCTACCGGGGACCCAC 0: 1
1: 0
2: 0
3: 6
4: 105
Right 900165770 1:1243773-1243795 AAGTGTGATCTGGGCCCCCAGGG 0: 1
1: 0
2: 1
3: 26
4: 190
900165758_900165768 7 Left 900165758 1:1243734-1243756 CCTCCCGGCTACCGGGGACCCAC 0: 1
1: 0
2: 0
3: 6
4: 105
Right 900165768 1:1243764-1243786 CTGGGCATAAAGTGTGATCTGGG 0: 1
1: 0
2: 0
3: 8
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900165758 Original CRISPR GTGGGTCCCCGGTAGCCGGG AGG (reversed) Intronic
900165758 1:1243734-1243756 GTGGGTCCCCGGTAGCCGGGAGG - Intronic
900192755 1:1358427-1358449 GTGGGGCCCTGGGAGGCGGGTGG - Intronic
900347013 1:2214840-2214862 ATGGGACCCCGGGAGCCGAGAGG + Intergenic
900619340 1:3579836-3579858 CGGGGTCCCTGGAAGCCGGGGGG + Exonic
901057485 1:6455416-6455438 GTTGCTCGCCGGCAGCCGGGGGG - Intronic
901666266 1:10828015-10828037 GGGGGACCCCGGTATTCGGGGGG - Intergenic
901810783 1:11765912-11765934 GTGGGTGCCCGGGTGCCAGGTGG + Exonic
902742401 1:18448007-18448029 GTGCGTTCCCAGTGGCCGGGAGG - Intergenic
903388335 1:22944740-22944762 GAGGTTCCTTGGTAGCCGGGTGG - Intergenic
912804236 1:112743279-112743301 GTGGGTCCCGGGTAGGCTGCAGG + Intergenic
920338315 1:205259588-205259610 CTGGATCCCCGATATCCGGGAGG - Intronic
921089552 1:211830380-211830402 GCGGGTCCCGGGGAGGCGGGCGG + Intronic
922586056 1:226736154-226736176 GTGGGGCCCCCGTGGGCGGGGGG - Exonic
1064990889 10:21255858-21255880 GTGGGTCCCAGCTACTCGGGAGG + Intergenic
1066432241 10:35363022-35363044 GTGGGCCGCCGGCGGCCGGGCGG + Intronic
1066602572 10:37124739-37124761 GTGGGTCCCCGGCTGCAGGAGGG + Intergenic
1073370214 10:102981509-102981531 GTGGGTCCCAGCTACTCGGGAGG - Intronic
1075744546 10:124717609-124717631 GTGGGACCGAGGTAGCGGGGAGG + Intronic
1076722154 10:132397409-132397431 GCGGGTCCCGGGTCTCCGGGCGG - Intronic
1077337404 11:2011578-2011600 CTGGGTCCCCAGTCGCCTGGAGG + Intergenic
1078057600 11:8019832-8019854 GCGGGTCCCCGGCAGCCAGCGGG - Intronic
1078803251 11:14668941-14668963 GAGGGTCCCCAGGAGCAGGGAGG - Intronic
1084010925 11:66347820-66347842 GTGCGTCCCGGGAAGCCGGCGGG - Intergenic
1084636966 11:70398941-70398963 GAGGGTCCCTGGGCGCCGGGGGG + Intronic
1085286222 11:75363529-75363551 GAGGGTCCACAGTAGTCGGGGGG - Intergenic
1089610101 11:119664271-119664293 TTGGGTTCCCTCTAGCCGGGAGG + Exonic
1202820388 11_KI270721v1_random:66760-66782 CTGGGTCCCCAGTCGCCTGGAGG + Intergenic
1103692573 12:122787359-122787381 GAGGATCCCCGGAAGCCGGGAGG + Intronic
1105413786 13:20192678-20192700 GTGGGTCTCGGGGAACCGGGGGG - Intronic
1113717212 13:112519836-112519858 GTGGGTCCTCGGTGCCGGGGCGG + Intronic
1119069600 14:71569331-71569353 GAGGGTCCCAAGTAGCTGGGAGG + Intronic
1123941636 15:25219437-25219459 GTGGGTCTCCTGGAGCCTGGTGG + Intergenic
1124187274 15:27541764-27541786 GTGGCTCCCCGCTATCCGTGCGG + Exonic
1125464117 15:39934130-39934152 GTGGGCCCCCGGCAGCCTGCGGG - Intronic
1128078352 15:64841890-64841912 TTGGGCCCCCGGCAGCCGGCGGG + Exonic
1129334310 15:74843248-74843270 GAGGGGCGCCGGGAGCCGGGCGG - Intronic
1132519887 16:382078-382100 GTGGGGCGCCGGTAGGGGGGAGG + Intronic
1132747404 16:1442768-1442790 GTGTGTCCCCAGTAACCCGGCGG - Intronic
1136402577 16:30026586-30026608 GTGAGTCCCGGGGAGCTGGGCGG - Intronic
1142213055 16:88817530-88817552 GTGGGTCCCGGGTGGGCTGGTGG - Intronic
1142217979 16:88839170-88839192 GAGTGTCCCCTGTGGCCGGGCGG - Intronic
1142217991 16:88839215-88839237 GAGTGTCCCCTGTGGCCGGGCGG - Intronic
1142218003 16:88839260-88839282 GAGTGTCCCCTGTGGCCGGGCGG - Intronic
1142218014 16:88839305-88839327 GAGTGTCCCCTGTGGCCGGGCGG - Intronic
1143141968 17:4745876-4745898 GTGGGGGCCCGGGCGCCGGGCGG - Exonic
1143921566 17:10334282-10334304 GTGGTTCCCTGGTAGCTGTGGGG + Intronic
1148807863 17:50273284-50273306 GGGTGCCCCCGGGAGCCGGGAGG - Intronic
1152677280 17:81648161-81648183 GAGGGCCCCGAGTAGCCGGGCGG - Exonic
1156360696 18:36382055-36382077 GTGGGGCCCAGGTCTCCGGGAGG + Intronic
1160788784 19:913283-913305 GTTCGTTCCCGGCAGCCGGGAGG - Intergenic
1161203707 19:3029386-3029408 GCGGGTGCCCGGGGGCCGGGGGG - Intronic
1161394836 19:4039424-4039446 GTGTGTACCCTGTAGTCGGGGGG + Intergenic
1163426275 19:17242681-17242703 GAGGGTCCAGGGCAGCCGGGTGG + Intronic
1163502566 19:17685808-17685830 GTGGGTCCCCGGTGGAGGGGAGG + Intronic
1166897913 19:46035767-46035789 CTGGGTCGCCTGTAGCGGGGTGG + Intergenic
1167467527 19:49658158-49658180 ATGGGGCCCCGGGAGCCTGGTGG + Intronic
924962377 2:46307-46329 CGGGGTCCCGGGTAGCCGCGGGG + Exonic
933724468 2:85418766-85418788 GTGGGATCCCGGTAGCTAGGTGG + Intronic
937998488 2:127713608-127713630 GTGGGTCCTCGGGATCCCGGGGG + Exonic
939592696 2:144084957-144084979 GTGGGTCCCTGGTAGCCTCCAGG + Intronic
946395443 2:219441902-219441924 CTGGGGCCTCGGGAGCCGGGTGG - Intronic
947472320 2:230411232-230411254 GTGGGTCCCCGTTAGACTTGGGG - Intergenic
1172848462 20:37944310-37944332 GTCGGTCCCCGGTGGTCCGGCGG - Exonic
1173491082 20:43482377-43482399 GTGGGTCCCAGCTACCAGGGAGG - Intergenic
1176002182 20:62837214-62837236 GTGGGACCGCGGTATCCAGGGGG - Exonic
1176809656 21:13525099-13525121 GTTGGTCGCCGGTGGCCGGCAGG + Intergenic
1177728208 21:24994944-24994966 AAGGGTCCCCGGTAGAAGGGCGG - Intergenic
1178561586 21:33643132-33643154 GCGGGTCCCCGGGAGGCCGGCGG - Intronic
1180091860 21:45537547-45537569 GTGGGTGCCGGGGTGCCGGGCGG - Intronic
1180091921 21:45537744-45537766 GTGGGTGCCGGGGTGCCGGGCGG - Intronic
1184642139 22:45878378-45878400 GTGGGTCCCAGGTGGCAGGCGGG + Intergenic
1184754736 22:46509388-46509410 GTGGGTCCCAGGTAGAGAGGAGG - Intronic
1185128346 22:49024012-49024034 GTGGGGCTCAGGTAGCCGGGTGG + Intergenic
950107487 3:10397498-10397520 GTGGGTCCCAGGTGGTCAGGGGG + Intronic
951451907 3:22849601-22849623 GTGGGTCGGAGGTAGGCGGGAGG + Intergenic
952347583 3:32502805-32502827 AGAAGTCCCCGGTAGCCGGGAGG + Exonic
961654406 3:128433300-128433322 GTGGGTCACCTGGCGCCGGGGGG - Intergenic
963228821 3:142889269-142889291 GTCGGTCCCGGGGTGCCGGGAGG - Intergenic
968904461 4:3445057-3445079 CTGGGTCCTAGGGAGCCGGGGGG - Intronic
969593746 4:8136606-8136628 GTGGGTCCCGGGTACTCAGGTGG - Intronic
972496448 4:39639030-39639052 GTGCGTCCCGGGAAGCCGGGCGG + Exonic
974177405 4:58342017-58342039 GTAGGTCCCTTGTAGCTGGGTGG + Intergenic
976729101 4:88244535-88244557 GCGGGTCCCCTGGAGCCTGGGGG + Intergenic
979099889 4:116600075-116600097 GTGGGTCCCCAGCCGTCGGGTGG - Intergenic
981920310 4:150078762-150078784 GGGGCTCCCCGGCAGGCGGGAGG + Intronic
991037154 5:62138836-62138858 GTGGGACCCGGGTATCTGGGAGG + Intergenic
1006906740 6:37538006-37538028 GTGGGTCCCCTGTAGCATGCAGG + Intergenic
1007740307 6:44005655-44005677 GGGGGTCCTTGGGAGCCGGGAGG + Exonic
1019358281 7:592230-592252 GTGAGGCCACGGCAGCCGGGAGG - Intronic
1025230560 7:57201176-57201198 GTTGGTCCCTGGTGGCAGGGTGG + Intergenic
1026072049 7:67130540-67130562 GTGGGTCCCAGCTACTCGGGAGG + Intronic
1026704856 7:72681714-72681736 GTGGGTCCCAGCTACTCGGGAGG - Intronic
1032195690 7:129787066-129787088 CTGGGCCCCCGGTAGAAGGGAGG + Intergenic
1034958657 7:155350795-155350817 GTGTGGCCCAGGAAGCCGGGAGG - Intergenic
1035901497 8:3462135-3462157 GTGGGTCCCGAGCAGCTGGGAGG - Intronic
1036808892 8:11853667-11853689 GTGGGTCCCCGGGGGCCAGGCGG + Intronic
1038319754 8:26515103-26515125 GCGGCTCCCCGGTGGTCGGGAGG + Intronic
1040831321 8:51680678-51680700 ATGGGTGCCCTGCAGCCGGGTGG + Intronic
1043954279 8:86342895-86342917 GTCGGCTCCCGGCAGCCGGGCGG - Exonic
1054456833 9:65435926-65435948 GTGGGTACCAGGCAGCCGTGAGG + Intergenic
1056027244 9:82511774-82511796 CTGGGTCCCAGGCAGCAGGGTGG + Intergenic
1056782363 9:89560360-89560382 GTGGGTGCCCAGTACTCGGGAGG + Intergenic
1057782085 9:98058042-98058064 GTGGGTCCCAGCTACTCGGGAGG - Intronic
1060665140 9:125428252-125428274 GTGGGGCCGCGGCAGCTGGGTGG + Intergenic
1061013675 9:127969829-127969851 TTGGGTGCCCGGAAGCCTGGAGG - Intronic
1061040495 9:128138630-128138652 TTGGGACCCCGGTCGCAGGGGGG - Intergenic
1061577070 9:131513944-131513966 GTGAGCCCCGGGCAGCCGGGTGG - Intronic
1061581961 9:131543464-131543486 GTGGGTCCCAGCTAGGCAGGAGG - Intergenic
1062525390 9:136976206-136976228 GTGAGTCCCAGGGAGCCGGGAGG - Intergenic
1185621723 X:1454067-1454089 GGGGGTCCCCGCGGGCCGGGTGG + Intergenic
1195352241 X:104006491-104006513 ATGTGTCCCAGGTAGCCAGGAGG + Intergenic
1197645458 X:129012072-129012094 GAGGGTCCCAGGTACCCAGGTGG + Intergenic