ID: 900165759

View in Genome Browser
Species Human (GRCh38)
Location 1:1243737-1243759
Sequence AGCGTGGGTCCCCGGTAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 75}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900165759_900165767 3 Left 900165759 1:1243737-1243759 CCCGGCTACCGGGGACCCACGCT 0: 1
1: 0
2: 0
3: 7
4: 75
Right 900165767 1:1243763-1243785 TCTGGGCATAAAGTGTGATCTGG 0: 1
1: 0
2: 1
3: 3
4: 99
900165759_900165770 13 Left 900165759 1:1243737-1243759 CCCGGCTACCGGGGACCCACGCT 0: 1
1: 0
2: 0
3: 7
4: 75
Right 900165770 1:1243773-1243795 AAGTGTGATCTGGGCCCCCAGGG 0: 1
1: 0
2: 1
3: 26
4: 190
900165759_900165768 4 Left 900165759 1:1243737-1243759 CCCGGCTACCGGGGACCCACGCT 0: 1
1: 0
2: 0
3: 7
4: 75
Right 900165768 1:1243764-1243786 CTGGGCATAAAGTGTGATCTGGG 0: 1
1: 0
2: 0
3: 8
4: 162
900165759_900165769 12 Left 900165759 1:1243737-1243759 CCCGGCTACCGGGGACCCACGCT 0: 1
1: 0
2: 0
3: 7
4: 75
Right 900165769 1:1243772-1243794 AAAGTGTGATCTGGGCCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900165759 Original CRISPR AGCGTGGGTCCCCGGTAGCC GGG (reversed) Intronic
900165759 1:1243737-1243759 AGCGTGGGTCCCCGGTAGCCGGG - Intronic
904329094 1:29746274-29746296 ATCCTGGGTCCCCTGTGGCCGGG - Intergenic
913366821 1:118048115-118048137 AGCCTGGGTCCACTGGAGCCTGG - Intronic
920338317 1:205259591-205259613 AGCCTGGATCCCCGATATCCGGG - Intronic
1068954911 10:62813751-62813773 AGCGAGGGACCCCGGCTGCCTGG - Exonic
1076797485 10:132805250-132805272 AGTGTGAGTTCCCGGCAGCCCGG - Intergenic
1077337402 11:2011575-2011597 AGCCTGGGTCCCCAGTCGCCTGG + Intergenic
1077489152 11:2852575-2852597 AGCCAGGGTCCCAGGCAGCCAGG + Intergenic
1081576494 11:44321744-44321766 AGCTTGGGGACCCGGGAGCCGGG - Intergenic
1091237359 11:134031189-134031211 AGCGTGGGCTCGAGGTAGCCAGG - Intergenic
1202820386 11_KI270721v1_random:66757-66779 AGCCTGGGTCCCCAGTCGCCTGG + Intergenic
1091448340 12:557663-557685 AGTGTGGGTCACCGGTGACCTGG - Exonic
1096143764 12:49264493-49264515 AGCCGGGGTGCCCGGCAGCCAGG + Intronic
1103564895 12:121810599-121810621 GGCGTGGGGCCCCGGAAGCCTGG - Exonic
1109123602 13:58489040-58489062 AGCCTGGGTCCCGCCTAGCCTGG - Intergenic
1111035359 13:82665433-82665455 AGTTTGGGTCCCCTGAAGCCAGG - Intergenic
1113626344 13:111850681-111850703 AGTGTGGGTGCCCGGGAGGCTGG + Intergenic
1113885407 13:113656258-113656280 AGCGTAGGTCCCCGGGGGACAGG - Intronic
1113911495 13:113843450-113843472 GGGGTGGGATCCCGGTAGCCGGG + Intronic
1117651992 14:57917086-57917108 AGCGTGGGAGCCTGGGAGCCTGG - Intronic
1121639362 14:95475083-95475105 AGGGTGGGTCGCCCGTGGCCTGG - Intronic
1133556999 16:6915186-6915208 GGAGTGGGTCTCCGGGAGCCTGG - Intronic
1134876127 16:17700622-17700644 AGCCTGAGTCTCCTGTAGCCAGG + Intergenic
1143200440 17:5109676-5109698 AGAGTGGTTCCCAGGTAGCCTGG + Exonic
1143522230 17:7451394-7451416 AGCCTCCCTCCCCGGTAGCCGGG + Intronic
1152677281 17:81648164-81648186 AGCGAGGGCCCCGAGTAGCCGGG - Exonic
1160681548 19:413698-413720 AGCCTGGGTCCCCAGACGCCTGG - Intergenic
1161264743 19:3359094-3359116 AGCATGGGTCCCCGTGTGCCCGG + Intergenic
1161707692 19:5829695-5829717 GCTGTGGGTCCCCGGGAGCCAGG - Intergenic
1163245207 19:16089232-16089254 AGCGTTGGTGCCTGGCAGCCAGG + Intronic
1166007092 19:39915400-39915422 AGTGTGGGTCCCCGGACCCCTGG + Exonic
1167053619 19:47095228-47095250 TGGGTGGGTCCCAGGTAGCTTGG - Intronic
1167299539 19:48670929-48670951 AGCATGGGTCCGCAGTGGCCTGG + Exonic
1167761413 19:51452254-51452276 GGGATGGGTCCCTGGTAGCCGGG + Exonic
925923662 2:8654984-8655006 AGCTTGGGTGCCAGGAAGCCTGG - Intergenic
929802543 2:45116709-45116731 AGCCTGGGTGCCGGGTGGCCAGG - Intergenic
933724467 2:85418763-85418785 AGGGTGGGATCCCGGTAGCTAGG + Intronic
937238224 2:120443185-120443207 AGCGTGAGGCCCCAGAAGCCCGG - Intergenic
937990959 2:127662099-127662121 AGGGTGTGTCCCCTATAGCCAGG + Intronic
937998485 2:127713605-127713627 AACGTGGGTCCTCGGGATCCCGG + Exonic
946395445 2:219441905-219441927 AGCCTGGGGCCTCGGGAGCCGGG - Intronic
946688789 2:222295679-222295701 GGCGTTGGTACCCGGTACCCTGG + Intronic
1173523174 20:43713829-43713851 AGCCTGGGTCCCCAGAAGCCAGG + Intronic
1175969193 20:62675351-62675373 CGCGTGGGTGGCCGGCAGCCCGG - Intronic
1176110184 20:63407501-63407523 AGCCTGGGTCCCCCGTTTCCTGG - Intronic
1178561587 21:33643135-33643157 AACGCGGGTCCCCGGGAGGCCGG - Intronic
1179569407 21:42269247-42269269 CGCGTGGGTCCCCGGGGGCCTGG + Intronic
1180014569 21:45074082-45074104 AGCGCGGGGGCCCGGGAGCCTGG + Intronic
1180082861 21:45494551-45494573 ACCGGGGGTCCTCGGAAGCCCGG - Exonic
1181636086 22:24175517-24175539 AGCATCGGTCCCCGGTTCCCAGG - Intronic
1183038491 22:35158463-35158485 AGCGTGGATCCCTGGTTGGCAGG + Intergenic
1184141746 22:42581755-42581777 CGCGTGGGTCCTCGGGACCCCGG + Intergenic
950210130 3:11117055-11117077 AGGGTGGGGCCCTGATAGCCAGG - Intergenic
952335732 3:32401673-32401695 AGCGTGCGGCCCTGGAAGCCTGG + Intronic
963176113 3:142299315-142299337 AGTGTGGGGAGCCGGTAGCCTGG + Intergenic
966346156 3:178982823-178982845 AGTGTGGGTCCCCTGTATCAAGG + Intergenic
968632573 4:1659617-1659639 AGCCAGGGTCCCCGGGAGACAGG + Intronic
975503226 4:75110178-75110200 AGCGTGGGACCCCCTGAGCCAGG - Intergenic
993619090 5:90147107-90147129 AGCATGGGACCCTTGTAGCCAGG - Intergenic
997453995 5:134004528-134004550 GGCGAGGGGCCCCGGCAGCCCGG - Intronic
999173812 5:149617782-149617804 AGCGTGGCTCCCAGCTGGCCTGG + Intronic
1001655286 5:173344528-173344550 AGCCTGGGTCTCCTGTATCCTGG + Intergenic
1019232986 6:170584438-170584460 GGCCTGGGGCCCCGGCAGCCCGG + Exonic
1019298267 7:290324-290346 TGCAAGGGTCCCAGGTAGCCGGG + Intergenic
1030068603 7:105679398-105679420 GGCCTGGGTCCCCGGTCCCCAGG + Intronic
1031393753 7:121247660-121247682 ATGTTGGGTCCCCTGTAGCCAGG - Intronic
1036808891 8:11853664-11853686 CGTGTGGGTCCCCGGGGGCCAGG + Intronic
1037667056 8:20978871-20978893 AGCCTGGATGCCCGGGAGCCAGG + Intergenic
1038975821 8:32694864-32694886 AGCGAGGGTCCACGGGAGCTAGG + Intronic
1041928257 8:63260242-63260264 AGCAGGGGTCCCCAGTCGCCTGG + Intergenic
1042534357 8:69843645-69843667 GGCGTGGGACCCTGGGAGCCAGG - Intergenic
1045649140 8:104326609-104326631 AGCGTGGGTCTCCTGAAGGCTGG + Intergenic
1045653435 8:104364059-104364081 AGCGTGGGTTCCAGGTGGACGGG - Intronic
1047422442 8:124718343-124718365 AGCGGGGGTCCCCTGGAACCTGG - Intronic
1054788224 9:69230119-69230141 AGCGTGGGCCTCCGGTTGGCTGG + Exonic
1058504718 9:105656111-105656133 AGAGTTGGTCTCCGGAAGCCAGG + Intergenic
1059102178 9:111482763-111482785 AGCGTGGGTCCGCGGCGCCCCGG + Intronic
1062226948 9:135457640-135457662 AGCCAGGGTCCCTGGTAGGCAGG + Intergenic
1062480518 9:136748785-136748807 AGCGTGGGTCCCCAGGAACGGGG - Intergenic
1062653737 9:137591196-137591218 AGCGTGGCTCCCCTGCAGCCTGG + Intergenic
1192229963 X:69257779-69257801 GGCCTGGGTCTCCGGGAGCCTGG + Intergenic
1195135886 X:101906879-101906901 AGCCTGGGTCCTCTGGAGCCTGG - Intronic
1200213209 X:154356062-154356084 AGCGTGGGCAGCCGGCAGCCAGG - Intronic