ID: 900165760

View in Genome Browser
Species Human (GRCh38)
Location 1:1243738-1243760
Sequence GAGCGTGGGTCCCCGGTAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 71}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900165760_900165769 11 Left 900165760 1:1243738-1243760 CCGGCTACCGGGGACCCACGCTC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 900165769 1:1243772-1243794 AAAGTGTGATCTGGGCCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 156
900165760_900165770 12 Left 900165760 1:1243738-1243760 CCGGCTACCGGGGACCCACGCTC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 900165770 1:1243773-1243795 AAGTGTGATCTGGGCCCCCAGGG 0: 1
1: 0
2: 1
3: 26
4: 190
900165760_900165768 3 Left 900165760 1:1243738-1243760 CCGGCTACCGGGGACCCACGCTC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 900165768 1:1243764-1243786 CTGGGCATAAAGTGTGATCTGGG 0: 1
1: 0
2: 0
3: 8
4: 162
900165760_900165767 2 Left 900165760 1:1243738-1243760 CCGGCTACCGGGGACCCACGCTC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 900165767 1:1243763-1243785 TCTGGGCATAAAGTGTGATCTGG 0: 1
1: 0
2: 1
3: 3
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900165760 Original CRISPR GAGCGTGGGTCCCCGGTAGC CGG (reversed) Intronic
900165760 1:1243738-1243760 GAGCGTGGGTCCCCGGTAGCCGG - Intronic
900184707 1:1327643-1327665 GAACGTGGGGCCCCCGGAGCAGG + Exonic
901927072 1:12573075-12573097 GAGAGTGGGTCCCCAGTGGGTGG - Intronic
904686150 1:32262166-32262188 GAGCCACGGCCCCCGGTAGCCGG + Intronic
904952706 1:34256952-34256974 GAGCCTGTGTCCCAGTTAGCAGG + Intergenic
906314237 1:44775953-44775975 GCGCGGGGGTCTCCGGGAGCTGG + Intronic
906382173 1:45339891-45339913 CAGCGTGGGCCGCGGGTAGCGGG - Exonic
916607083 1:166353696-166353718 GAGCCTGGGTCTCTGGTAGGTGG + Intergenic
924694182 1:246382370-246382392 GAGCGTGGGTCCATGGGTGCTGG - Intronic
1063099405 10:2936228-2936250 GAGCGTGAGTCCCTGATCGCCGG - Intergenic
1066602570 10:37124735-37124757 GGGGGTGGGTCCCCGGCTGCAGG + Intergenic
1071257966 10:83890903-83890925 CAGCGTGGGTCCTCCATAGCAGG - Intergenic
1075636734 10:124035142-124035164 GAGCCGGGGTCCCCGTTAGGGGG - Intronic
1077048317 11:555706-555728 GACCGCGGGTCCCCGGGATCTGG - Intronic
1077162604 11:1120618-1120640 GAGCGTGGGTCCTCTGGACCTGG - Intergenic
1078090256 11:8260708-8260730 GAGCTTTGGTCCTCGGCAGCTGG + Intronic
1084284451 11:68122032-68122054 GAGGGCTGGGCCCCGGTAGCCGG - Intergenic
1092045839 12:5431478-5431500 GGGTGCGGGTCCCCGGGAGCGGG + Intergenic
1095627757 12:44337539-44337561 GGGCGTGGGTCACTGGAAGCAGG - Intronic
1102315270 12:111882465-111882487 GAGTGTGGGGCCCCAGTGGCAGG + Intronic
1103603052 12:122066268-122066290 GAGTGAGGGTCCCAAGTAGCTGG + Intergenic
1103897105 12:124279990-124280012 CAGTGTGGGTCCCGGGCAGCCGG + Intronic
1103897116 12:124280031-124280053 CAGCGTGGGTCCCGGGCAGCCGG + Intronic
1112041637 13:95553180-95553202 GAGCCTGGGACCCCGGGAGGGGG + Intronic
1112487700 13:99834663-99834685 GAGAGTGGGCCCCGGGGAGCAGG - Intronic
1113911494 13:113843449-113843471 GGGGGTGGGATCCCGGTAGCCGG + Intronic
1126218316 15:46183237-46183259 GAACTTGGGTCCCCTGTGGCAGG + Intergenic
1132498593 16:275103-275125 GAGCGCGGGGCCGCGGAAGCGGG + Intronic
1140357533 16:74319188-74319210 GAGCATGGGTCCCCTGGAGCTGG - Intergenic
1141784728 16:86191527-86191549 GGGAGTGGGACCCCGGTACCGGG - Intergenic
1141948476 16:87325671-87325693 GATCGTGGGTCCCCGGTGGTGGG - Intronic
1141948493 16:87325720-87325742 GATCGTGGGTCCCCGGCGGTGGG - Intronic
1143431827 17:6893712-6893734 GGGCGTGGTTCCCTGGGAGCTGG + Intronic
1147885477 17:43681405-43681427 GAGCTTTGCTCCCAGGTAGCTGG - Intergenic
1148690896 17:49526306-49526328 GAGCATGGGGCCGGGGTAGCGGG - Intergenic
1152622032 17:81369791-81369813 GAGCGAGGCTCCCCAGGAGCAGG - Intergenic
1152932843 17:83119113-83119135 GAACGAGGGTCCTCGGCAGCAGG + Intergenic
1162935161 19:13978474-13978496 GAGCCTGGGGCCCCGGTTGGTGG + Intronic
1163843571 19:19626574-19626596 GAGCGTGGTCTCTCGGTAGCGGG + Exonic
1165015051 19:32874745-32874767 CAGCCTGGGTCCTCAGTAGCAGG + Intergenic
1165081096 19:33306386-33306408 GAGCGTGAGTCCCCGGGAAACGG + Intergenic
1167008140 19:46788460-46788482 GAGCCTGGGTCCCCTGTTTCCGG - Exonic
1167499430 19:49836860-49836882 GAGCGGGGGTCCCCGGGGCCCGG + Exonic
1167944721 19:52978815-52978837 GAGCGTGGAGACCCGGGAGCTGG + Intergenic
933712983 2:85341342-85341364 GAGCTCGGGGCCCCGGTGGCTGG - Intergenic
936077624 2:109411724-109411746 GAGCGTGGCTCCCGTGTGGCCGG - Intronic
936392525 2:112088019-112088041 GAGCCTGGGCCCCCGGGGGCCGG - Intronic
937738348 2:125318858-125318880 GAGCCTGGGTCCACAGGAGCTGG + Intergenic
937868231 2:126769704-126769726 GGGCATGGGTCCCGGGTAGTGGG - Intergenic
946395446 2:219441906-219441928 GAGCCTGGGGCCTCGGGAGCCGG - Intronic
1172941418 20:38657072-38657094 CAGTGTGGGTCCCCAGAAGCAGG + Intergenic
1175997027 20:62816582-62816604 GAGGGTGAATCCCCGGTACCAGG - Intronic
1176082666 20:63281842-63281864 GAGCATGGGCCCCCGGGGGCTGG + Intronic
961457471 3:127031317-127031339 GAGAGGGGCTCCCCTGTAGCAGG - Intronic
969277663 4:6147789-6147811 GAGCTTGGGTGCCCTGCAGCAGG - Intronic
983334897 4:166379054-166379076 GAGCCTGGTGCCCCGGGAGCTGG + Intergenic
985529195 5:423982-424004 GTGCGTGGGTCCCTGGCAGGGGG + Intronic
1001936918 5:175711984-175712006 GATCGTGAGTCCCCTGCAGCAGG + Intergenic
1011643122 6:89433392-89433414 AAGCGGGGGTCCCAGGGAGCCGG - Intronic
1019159932 6:170062964-170062986 GAGCGTGGCTCCTCGGTAAGTGG - Intergenic
1022327780 7:29347623-29347645 GAGGGAGGGACCCCGGTAGGAGG - Intronic
1023583031 7:41701601-41701623 GTGAGTGGGTCCCCGGCAGAAGG - Intronic
1024452443 7:49563546-49563568 GAGTGTGGGGGCCCTGTAGCTGG - Intergenic
1024656482 7:51455120-51455142 GAGTGTGGGACCCAGGAAGCTGG + Intergenic
1024965688 7:55020214-55020236 GAGCTGGGGTCCCCGGGAGGTGG - Intronic
1028288896 7:89041068-89041090 GAGCCTTGGTCCTTGGTAGCTGG + Intronic
1029537425 7:101164597-101164619 GGGCGTGGATCCCCGGGCGCTGG - Exonic
1030733178 7:113014138-113014160 GAGCTTGGGTCCACAGGAGCTGG + Intergenic
1037724127 8:21468979-21469001 GAGTGTGGGCCACCTGTAGCAGG - Intergenic
1037821717 8:22138371-22138393 GAGGGTGGGGCCCAGGCAGCTGG + Exonic
1057886858 9:98836365-98836387 GGGCGTGAGTCCTCGGTAGAAGG - Intronic
1062480519 9:136748786-136748808 GAGCGTGGGTCCCCAGGAACGGG - Intergenic
1185880041 X:3732709-3732731 AAGCGAGAGTCCCCGCTAGCTGG + Intergenic
1187739741 X:22342483-22342505 GAGCCCAGGTCCCCAGTAGCTGG + Intergenic
1191956962 X:66652231-66652253 GAGCCTGGGTTCACTGTAGCAGG - Intergenic
1200120652 X:153788722-153788744 GCGCGGGGGTCCCCTGTGGCTGG + Intronic