ID: 900165761

View in Genome Browser
Species Human (GRCh38)
Location 1:1243745-1243767
Sequence CCAGACGGAGCGTGGGTCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 122}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900165761_900165775 26 Left 900165761 1:1243745-1243767 CCGGGGACCCACGCTCCGTCTGG 0: 1
1: 0
2: 2
3: 15
4: 122
Right 900165775 1:1243794-1243816 GGCCTCCCAACCCTGACCCGAGG 0: 1
1: 0
2: 1
3: 27
4: 174
900165761_900165770 5 Left 900165761 1:1243745-1243767 CCGGGGACCCACGCTCCGTCTGG 0: 1
1: 0
2: 2
3: 15
4: 122
Right 900165770 1:1243773-1243795 AAGTGTGATCTGGGCCCCCAGGG 0: 1
1: 0
2: 1
3: 26
4: 190
900165761_900165768 -4 Left 900165761 1:1243745-1243767 CCGGGGACCCACGCTCCGTCTGG 0: 1
1: 0
2: 2
3: 15
4: 122
Right 900165768 1:1243764-1243786 CTGGGCATAAAGTGTGATCTGGG 0: 1
1: 0
2: 0
3: 8
4: 162
900165761_900165769 4 Left 900165761 1:1243745-1243767 CCGGGGACCCACGCTCCGTCTGG 0: 1
1: 0
2: 2
3: 15
4: 122
Right 900165769 1:1243772-1243794 AAAGTGTGATCTGGGCCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 156
900165761_900165767 -5 Left 900165761 1:1243745-1243767 CCGGGGACCCACGCTCCGTCTGG 0: 1
1: 0
2: 2
3: 15
4: 122
Right 900165767 1:1243763-1243785 TCTGGGCATAAAGTGTGATCTGG 0: 1
1: 0
2: 1
3: 3
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900165761 Original CRISPR CCAGACGGAGCGTGGGTCCC CGG (reversed) Intronic
900165761 1:1243745-1243767 CCAGACGGAGCGTGGGTCCCCGG - Intronic
900389282 1:2427095-2427117 CCAGGCTGAACGTGGGTCCCAGG - Intronic
902330971 1:15731120-15731142 CCAGGCGGAGCCCAGGTCCCAGG - Intronic
903331072 1:22597555-22597577 GCAGAGGGAGCGTGTGACCCAGG + Intronic
904697459 1:32338241-32338263 CCAGAGGGAGCCTGGTCCCCAGG + Intergenic
912670483 1:111619966-111619988 CCAGAGGGAGCGGGGGGCGCGGG + Intronic
914928623 1:151909795-151909817 CCAGTCGGCGCGCGGGTTCCGGG - Exonic
919761450 1:201100599-201100621 CCTGAGGGAGCTTGGTTCCCTGG - Intronic
922219103 1:223544190-223544212 GCAGAGGGAGCCTGGGTCACAGG + Intronic
1063573770 10:7242375-7242397 CCAGGCAGAGCTTGGGTCCTGGG - Intronic
1066405279 10:35112450-35112472 CCAGACAGAGCATGGCTCTCTGG + Intergenic
1068187962 10:53611647-53611669 CCAGGGGGTGCGTGGGACCCAGG + Intergenic
1069698570 10:70405336-70405358 CCAGAGAGAGGGTGGTTCCCTGG + Intronic
1070558848 10:77550630-77550652 CCAGACGCGGCCTGGTTCCCTGG - Intronic
1073156937 10:101354487-101354509 CCAGGCGGCGCGCGGGGCCCTGG + Intronic
1073178294 10:101569626-101569648 ACAGGCGGAGCGATGGTCCCTGG + Intergenic
1075546928 10:123362168-123362190 CCAGAGGGAGCTTGGGTACCAGG + Intergenic
1076554533 10:131312572-131312594 CCGGGCGGAGCGAGGGTCCTTGG - Intergenic
1077490200 11:2857545-2857567 CCAGAGGCAATGTGGGTCCCAGG + Intergenic
1077582138 11:3423277-3423299 CGAGACGGAGCGAGGGGTCCAGG + Intergenic
1078338604 11:10483336-10483358 CCAGAGGCAGCCAGGGTCCCAGG - Intronic
1084068198 11:66717630-66717652 CCAGGAGGAGCGTGGGTCACAGG + Intronic
1084155585 11:67311005-67311027 CCAGACAGGGCCTGGCTCCCAGG - Intronic
1084189390 11:67492104-67492126 CCAGGCGGAGCGTGAGGGCCCGG - Exonic
1084239053 11:67806094-67806116 CGAGACGGAGCGAGGGGTCCAGG + Intergenic
1084445791 11:69202802-69202824 CCCGACGGAGGGCGGGTCACCGG - Intergenic
1092157871 12:6296106-6296128 CCAGAAGGAGCCTAGGACCCTGG - Intergenic
1092409742 12:8243723-8243745 CGAGACGGAGCGAGGGGTCCAGG + Intergenic
1095097283 12:38155426-38155448 CCAGAGGGGTCGTGGGTCCCTGG + Intergenic
1095833766 12:46615185-46615207 CCACACGCAGCTTGAGTCCCAGG - Intergenic
1102347705 12:112170125-112170147 GCAGAAGGAGCTTGGCTCCCGGG - Intronic
1106460132 13:29961202-29961224 GCAGTTGGAGCGGGGGTCCCCGG + Intergenic
1113803185 13:113096873-113096895 CCAGACAGCGCGCGGGTCTCCGG - Exonic
1121618490 14:95330131-95330153 CCAGAGGGAGAGTGGGTTCTTGG + Intergenic
1122519800 14:102335356-102335378 CCAGAGGGAGTGTGGGGCACAGG - Intronic
1124260208 15:28182896-28182918 CCAGACCCAGCGTGGCTCCTGGG - Intronic
1129200862 15:73998387-73998409 CCAGTCGGTGCGTGAGTTCCTGG + Exonic
1129331549 15:74830416-74830438 CCAAATGGAGTATGGGTCCCTGG - Exonic
1130103866 15:80914529-80914551 CCAGAGGGAGGATGTGTCCCTGG - Intronic
1132548784 16:545707-545729 CCAAAGGGAGGGTGTGTCCCAGG + Intronic
1133350716 16:5098506-5098528 CGAGACGGAGCGAGGGGTCCAGG + Intergenic
1133774228 16:8885102-8885124 CCAGACTCTGCCTGGGTCCCAGG + Intergenic
1133796834 16:9053108-9053130 CAAGCAGGAGCGTGGGTCCCTGG - Intergenic
1135419186 16:22293376-22293398 CCAGCCAGAGAGTGGGTCCCTGG - Intergenic
1135537102 16:23302670-23302692 GCAGACGGGGCCAGGGTCCCCGG + Intronic
1138354117 16:56364087-56364109 CCAGACCGAGCGTGTGCCACTGG - Exonic
1142121478 16:88388627-88388649 CCAGAGGGGGCGTGGGAGCCAGG + Intergenic
1142139607 16:88466987-88467009 CGAGCCGGGGCGAGGGTCCCTGG + Intronic
1142762569 17:2050667-2050689 CCATGCGGGGCGGGGGTCCCAGG + Intergenic
1143898621 17:10156595-10156617 CCAGAGGGTGCGAGGGTCCCTGG - Intronic
1144890433 17:18491128-18491150 CCCCACGGAGGGTGGGTCCAGGG - Intronic
1145141784 17:20453190-20453212 CCCCACGGAGGGTGGGTCCAGGG + Intronic
1147141864 17:38464839-38464861 CCAGCCGGAGGGTGGGGCCCAGG + Intronic
1148225847 17:45897197-45897219 CCAGATGGAGCGAGGGTCTCGGG + Intronic
1148243998 17:46018670-46018692 CCAGTCGAAGATTGGGTCCCTGG + Exonic
1152592458 17:81220359-81220381 CCAGAGGGAGCCTGGGCCACAGG + Intronic
1152610958 17:81314836-81314858 CCAGGCAGAGCTGGGGTCCCAGG - Intronic
1152680855 17:81667037-81667059 CCTGGCGGAGCGTGGGCCGCGGG - Intronic
1152715880 17:81900469-81900491 CCAGCCTGAGGGAGGGTCCCAGG - Intronic
1152741295 17:82019613-82019635 CCGGAGGGAGCGTGGGCCCTGGG + Intronic
1153219315 18:2847706-2847728 CCAGACCGAGCGAGGGTCGGGGG - Intronic
1153774008 18:8437141-8437163 CCAGGCACAGAGTGGGTCCCTGG - Intergenic
1157175053 18:45443985-45444007 ACACATGGAGAGTGGGTCCCTGG + Intronic
1161735775 19:5991350-5991372 TCAGAAGGAGCCTGGGTCCCTGG - Intergenic
1163630727 19:18416898-18416920 CCCGACGCCGCGTGGGACCCAGG + Intergenic
1164034466 19:21440536-21440558 CCCGGCGGTGCCTGGGTCCCAGG + Intronic
1165449021 19:35871711-35871733 CCAGATGGGTCGGGGGTCCCTGG - Exonic
925947871 2:8882443-8882465 ACAGAAGGAACGTGGGTCCTAGG + Intronic
926052076 2:9751769-9751791 CCAGAGGGACCGTGGCCCCCAGG + Intergenic
926779126 2:16451393-16451415 ATAGAAGGAGCCTGGGTCCCTGG + Intergenic
928118224 2:28563362-28563384 CCAGAGGGAGTGTGGGTGACAGG + Intronic
929587809 2:43127172-43127194 CCAGACGGGGCGTGGGGAACCGG - Intergenic
929938720 2:46314392-46314414 CCAAAGGGAGTGTGGGTCCTAGG + Intronic
932297521 2:70639437-70639459 CCAGGAGGAGCCTGAGTCCCTGG - Intronic
936444826 2:112587158-112587180 CAAGATGGAGCATGGGGCCCAGG - Intronic
942042710 2:172081501-172081523 GCAGACAGAGCGTGGGCCCTTGG - Exonic
944020192 2:195093733-195093755 CCAGAAGGAGCCTAAGTCCCTGG + Intergenic
1168796803 20:615676-615698 ATAGACAGAGCCTGGGTCCCCGG - Intergenic
1168903836 20:1388730-1388752 CCAGAAGGAGCGTGGGTTGGGGG + Intronic
1170150413 20:13221447-13221469 GGAGACGGAGACTGGGTCCCGGG - Intergenic
1170381955 20:15770816-15770838 CCAGGAGGAGGGTGTGTCCCAGG - Intronic
1172118744 20:32585575-32585597 CCAGACGGAACGCGGTTCCTGGG - Intronic
1173548451 20:43916078-43916100 CCAGTCGGTGCGTCGGTCCCGGG + Intronic
1174442877 20:50569953-50569975 CCAGCAGGAGCGTGTGGCCCAGG + Intronic
1176123880 20:63466500-63466522 CCGGACGGAGCGTGGAGGCCAGG - Intronic
1176146941 20:63569678-63569700 CCAGACGGTGAGGGGGGCCCAGG + Intronic
1176148142 20:63574441-63574463 CTGGACGGGGCGTGGGGCCCTGG - Intergenic
1176379896 21:6107182-6107204 CCACACGGAGCGTGGCTCCCGGG - Intergenic
1179587790 21:42384672-42384694 CCAGACTGCAGGTGGGTCCCGGG + Intronic
1179656710 21:42850402-42850424 CCAGCCAGGGTGTGGGTCCCAGG - Intronic
1179743578 21:43431056-43431078 CCACACGGAGCGTGGCTCCCGGG + Intergenic
1179981949 21:44900284-44900306 CCAGGCGGTGCCTGGGTGCCTGG + Intronic
1183688712 22:39376276-39376298 CCAGAGGCAGAGCGGGTCCCAGG - Intronic
1185173230 22:49305374-49305396 CCAGACCCAGGGTGGGACCCCGG - Intergenic
1185220544 22:49627264-49627286 CTGCACGGAGCGTGGGCCCCCGG - Intronic
1185420643 22:50732468-50732490 CCAGCCTGAGCGGGGTTCCCTGG + Intergenic
957054981 3:75435853-75435875 CGAGACGGAGCGAGGGATCCAGG + Intergenic
961299859 3:125915821-125915843 CGAGACGGAGCGAGGGGTCCAGG - Intergenic
961888655 3:130112252-130112274 CGAGACGGAGCGAGGGGTCCAGG + Intronic
961888725 3:130112465-130112487 CCAGTTAGAGCGAGGGTCCCTGG + Intronic
966877081 3:184328574-184328596 CCAGAAGGAGAGTGGGGACCTGG + Intronic
968131177 3:196193823-196193845 CCAGATGGAGCATGGGTGTCAGG + Intergenic
968511510 4:997745-997767 CCAGGCGGAGGGTGGGCCCTCGG + Intronic
968945840 4:3663752-3663774 CCAGGCAGAGCCTGCGTCCCTGG + Intergenic
968985354 4:3871818-3871840 CCAGAGGGAGCGGGGTTCGCGGG + Intergenic
969086778 4:4662475-4662497 ACAGAGGAAGCTTGGGTCCCTGG + Intergenic
969756206 4:9152495-9152517 CGAGACGGAGCGAGGGGTCCAGG - Intergenic
969816530 4:9691661-9691683 CGAGACGGAGCGAGGGGTCCAGG - Intergenic
979608946 4:122670102-122670124 CCAGAGTGGGCGTGGGGCCCAGG - Intergenic
981486049 4:145287434-145287456 ACAGAAGGAGCCTGGGTCCCTGG - Intergenic
986736145 5:10668797-10668819 ACAGAAGGAGCCTGGGTCCCTGG - Intergenic
997256440 5:132431932-132431954 CCAGAAGAAGCGTAGGTCCCTGG + Intronic
1001902770 5:175444919-175444941 CGAGTCGGGGCGCGGGTCCCTGG - Intergenic
1003021296 6:2511820-2511842 CCAGCCGAAGCCTGGGTTCCCGG + Intergenic
1003177083 6:3759950-3759972 ACTGACGGAGGGTGGGTCGCTGG + Intergenic
1006162632 6:32047156-32047178 CCAGTCTGGGCCTGGGTCCCTGG - Intronic
1006421280 6:33935652-33935674 CCAGCTGGAGCGCGGGGCCCGGG + Intergenic
1009439803 6:63663774-63663796 GTAGAAGGAGCTTGGGTCCCTGG - Intronic
1009723135 6:67501936-67501958 CCAGACGGAGCTTGTGTTGCAGG - Intergenic
1016936291 6:149451255-149451277 CCCGCCGGCGCGGGGGTCCCCGG - Exonic
1017073828 6:150600116-150600138 CCGGGCGGAGCGTGGTACCCGGG + Intronic
1019143348 6:169961976-169961998 CCGGACAGAGCGGGGGTCGCGGG + Intergenic
1019602154 7:1890117-1890139 CCAGACAGAGCGTGTGGTCCAGG - Intronic
1019879503 7:3846072-3846094 CCAGAAGGAAAGTGCGTCCCAGG + Intronic
1026794772 7:73359255-73359277 CATGAGGGAGCGTGGGACCCTGG - Intergenic
1027173236 7:75887684-75887706 CCAGATGGAGCGTTGGGACCAGG - Intronic
1034136012 7:148770706-148770728 TCAGGGGGAGCGTGGGTGCCCGG + Intronic
1036130823 8:6108234-6108256 ACAGAAGGAGCCTGGGTCCCTGG + Intergenic
1036379448 8:8227801-8227823 CGAGACGGAGCGAGGGGTCCAGG - Intergenic
1036850111 8:12194812-12194834 CGAGACGGAGCGAGGGGTCCAGG + Intergenic
1036871475 8:12437085-12437107 CGAGACGGAGCGAGGGGTCCAGG + Intergenic
1037559194 8:20056669-20056691 ATAGAAGGAGCCTGGGTCCCTGG + Intergenic
1039069437 8:33636222-33636244 CCAGAGGGATAGTTGGTCCCAGG + Intergenic
1049210680 8:141385139-141385161 CCTGCCTGAGCCTGGGTCCCTGG + Intergenic
1049644497 8:143730008-143730030 CCAGCTGGAGTGGGGGTCCCTGG - Intronic
1055980941 9:81999835-81999857 CCATACAGAGTGTGGGTACCTGG - Intergenic
1061327849 9:129875003-129875025 CCAGAAGGCCCATGGGTCCCAGG - Intronic
1061718632 9:132537563-132537585 CCAGACAGAGCTTGAGGCCCCGG - Intronic
1062309237 9:135927064-135927086 GCAGAGGGAGCGGGAGTCCCCGG - Intergenic
1196846251 X:119898839-119898861 CCAGAGAGAGAGTGGGTCACTGG + Intronic