ID: 900165764

View in Genome Browser
Species Human (GRCh38)
Location 1:1243752-1243774
Sequence TTTATGCCCAGACGGAGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 23
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 20}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900165764_900165775 19 Left 900165764 1:1243752-1243774 CCCACGCTCCGTCTGGGCATAAA 0: 1
1: 0
2: 0
3: 2
4: 20
Right 900165775 1:1243794-1243816 GGCCTCCCAACCCTGACCCGAGG 0: 1
1: 0
2: 1
3: 27
4: 174
900165764_900165769 -3 Left 900165764 1:1243752-1243774 CCCACGCTCCGTCTGGGCATAAA 0: 1
1: 0
2: 0
3: 2
4: 20
Right 900165769 1:1243772-1243794 AAAGTGTGATCTGGGCCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 156
900165764_900165770 -2 Left 900165764 1:1243752-1243774 CCCACGCTCCGTCTGGGCATAAA 0: 1
1: 0
2: 0
3: 2
4: 20
Right 900165770 1:1243773-1243795 AAGTGTGATCTGGGCCCCCAGGG 0: 1
1: 0
2: 1
3: 26
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900165764 Original CRISPR TTTATGCCCAGACGGAGCGT GGG (reversed) Intronic
900165764 1:1243752-1243774 TTTATGCCCAGACGGAGCGTGGG - Intronic
908116974 1:60950164-60950186 ATTATTCCCAGTGGGAGCGTTGG + Intronic
922242568 1:223765499-223765521 TTTCTGCACAGATGGAGGGTGGG + Intronic
923307938 1:232705390-232705412 TTTATGCCCAGACGCACAGTTGG + Intergenic
1063184468 10:3638223-3638245 GTCATGCCCAGATGGAGCGACGG + Intergenic
1063491251 10:6465567-6465589 TTCATGCCCAGACGCACCGAAGG - Intronic
1073091771 10:100947042-100947064 TTTATGCCCAGACAGAGTTCAGG - Exonic
1078921883 11:15838335-15838357 TTTATACTCAGACGGAGCCAGGG - Intergenic
1090310573 11:125733080-125733102 TTTATGCCCAGCCACAGAGTAGG + Intergenic
1091541853 12:1469531-1469553 TTTATTCCCACACGGAGGGGAGG - Intronic
1092661364 12:10741775-10741797 TTTGTTCCCAGAGGGAGGGTGGG - Intergenic
1124338036 15:28871947-28871969 TTTCTGGCCTGATGGAGCGTAGG - Intergenic
1152246897 17:79189523-79189545 TTGCTGCACAGACGGAGCGGTGG - Intronic
937985930 2:127638094-127638116 CTTATGCCCAGACAGACAGTGGG + Intergenic
945514977 2:210752391-210752413 TTTAGGTCCAGAGGGAGCTTTGG + Intergenic
1173281879 20:41635789-41635811 GTTATGCCCAGAAGGAGTGAGGG - Intergenic
985407855 4:189654149-189654171 CACATGCCCAGAGGGAGCGTTGG + Intergenic
997031818 5:130138612-130138634 TTTATGCCCAGAAGCAGTATTGG + Intronic
1001689963 5:173625627-173625649 TTTATTTCCAGAGGGAGCCTGGG + Intergenic
1001933169 5:175687318-175687340 TTTGTCCCCAGACGGAGAGCTGG - Intergenic
1011497629 6:87952143-87952165 TTTAGTCCCAGACGTAGTGTAGG + Intergenic
1043984738 8:86680670-86680692 TCTATGCCCAGACAGTGAGTTGG + Intronic
1189059389 X:37736835-37736857 TTTATATCCAGACAGAGCGTTGG + Intronic