ID: 900165765

View in Genome Browser
Species Human (GRCh38)
Location 1:1243753-1243775
Sequence CTTTATGCCCAGACGGAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 22
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 21}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900165765_900165769 -4 Left 900165765 1:1243753-1243775 CCACGCTCCGTCTGGGCATAAAG 0: 1
1: 0
2: 0
3: 0
4: 21
Right 900165769 1:1243772-1243794 AAAGTGTGATCTGGGCCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 156
900165765_900165770 -3 Left 900165765 1:1243753-1243775 CCACGCTCCGTCTGGGCATAAAG 0: 1
1: 0
2: 0
3: 0
4: 21
Right 900165770 1:1243773-1243795 AAGTGTGATCTGGGCCCCCAGGG 0: 1
1: 0
2: 1
3: 26
4: 190
900165765_900165775 18 Left 900165765 1:1243753-1243775 CCACGCTCCGTCTGGGCATAAAG 0: 1
1: 0
2: 0
3: 0
4: 21
Right 900165775 1:1243794-1243816 GGCCTCCCAACCCTGACCCGAGG 0: 1
1: 0
2: 1
3: 27
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900165765 Original CRISPR CTTTATGCCCAGACGGAGCG TGG (reversed) Intronic
900165765 1:1243753-1243775 CTTTATGCCCAGACGGAGCGTGG - Intronic
921714242 1:218401826-218401848 CTTGATGCCCAGTCGGGACGCGG - Intronic
1076749811 10:132537158-132537180 CTCTCCGCGCAGACGGAGCGTGG - Intergenic
1078921884 11:15838336-15838358 GTTTATACTCAGACGGAGCCAGG - Intergenic
1096098773 12:48956611-48956633 CTTCCTCCCCAGGCGGAGCGGGG - Intronic
1127631997 15:60836271-60836293 CTTTATGTGCAGATGGAGAGAGG + Intronic
1130971762 15:88739354-88739376 CTGTCTGCCCAGATGGACCGAGG - Intergenic
1147628073 17:41912750-41912772 ATTTGTGCCCAGATGGAGCCTGG + Intronic
1153174685 18:2357624-2357646 CTTTATGCCCAGGCTTAGCCAGG + Intergenic
1153619465 18:6963377-6963399 CTTCCTGCCAAGACGGAGCCAGG - Intronic
926887294 2:17609920-17609942 CTTTATCCCCACATGGAGCCCGG + Intronic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
936093883 2:109517301-109517323 CTTTATCCCCGGACTGTGCGGGG + Intergenic
1173281880 20:41635790-41635812 GGTTATGCCCAGAAGGAGTGAGG - Intergenic
1178903415 21:36615861-36615883 CTTTATGTCCAGATGGAGAAAGG - Intergenic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
973312654 4:48726273-48726295 CATTATGCCCAGAAGGAGAAGGG - Intronic
991648627 5:68828526-68828548 CTTGATGAGCAGACGGATCGTGG - Intergenic
1002897513 6:1388273-1388295 CTTTCAGCCTAGACGCAGCGGGG + Intergenic
1009369684 6:62883187-62883209 CCTAATACCCAGACGGAGAGAGG + Intergenic
1022535963 7:31098680-31098702 CATTATGCACAGATGCAGCGGGG + Intronic
1061589231 9:131588122-131588144 CTCTCTGCCCAGCAGGAGCGTGG + Intronic