ID: 900165769

View in Genome Browser
Species Human (GRCh38)
Location 1:1243772-1243794
Sequence AAAGTGTGATCTGGGCCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 156}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900165765_900165769 -4 Left 900165765 1:1243753-1243775 CCACGCTCCGTCTGGGCATAAAG 0: 1
1: 0
2: 0
3: 0
4: 21
Right 900165769 1:1243772-1243794 AAAGTGTGATCTGGGCCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 156
900165760_900165769 11 Left 900165760 1:1243738-1243760 CCGGCTACCGGGGACCCACGCTC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 900165769 1:1243772-1243794 AAAGTGTGATCTGGGCCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 156
900165758_900165769 15 Left 900165758 1:1243734-1243756 CCTCCCGGCTACCGGGGACCCAC 0: 1
1: 0
2: 0
3: 6
4: 105
Right 900165769 1:1243772-1243794 AAAGTGTGATCTGGGCCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 156
900165757_900165769 19 Left 900165757 1:1243730-1243752 CCTGCCTCCCGGCTACCGGGGAC 0: 1
1: 0
2: 0
3: 40
4: 984
Right 900165769 1:1243772-1243794 AAAGTGTGATCTGGGCCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 156
900165761_900165769 4 Left 900165761 1:1243745-1243767 CCGGGGACCCACGCTCCGTCTGG 0: 1
1: 0
2: 2
3: 15
4: 122
Right 900165769 1:1243772-1243794 AAAGTGTGATCTGGGCCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 156
900165759_900165769 12 Left 900165759 1:1243737-1243759 CCCGGCTACCGGGGACCCACGCT 0: 1
1: 0
2: 0
3: 7
4: 75
Right 900165769 1:1243772-1243794 AAAGTGTGATCTGGGCCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 156
900165764_900165769 -3 Left 900165764 1:1243752-1243774 CCCACGCTCCGTCTGGGCATAAA 0: 1
1: 0
2: 0
3: 2
4: 20
Right 900165769 1:1243772-1243794 AAAGTGTGATCTGGGCCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 156
900165756_900165769 20 Left 900165756 1:1243729-1243751 CCCTGCCTCCCGGCTACCGGGGA 0: 1
1: 0
2: 1
3: 9
4: 238
Right 900165769 1:1243772-1243794 AAAGTGTGATCTGGGCCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900165769 Original CRISPR AAAGTGTGATCTGGGCCCCC AGG Intronic
900165769 1:1243772-1243794 AAAGTGTGATCTGGGCCCCCAGG + Intronic
900282588 1:1880662-1880684 AAAGTGTGATCGTGGACCCCTGG - Intronic
901578240 1:10218252-10218274 AAAGTGTGAAGTGTGCCTCCTGG - Intronic
901649116 1:10733262-10733284 GAAGGATGATCTGGGGCCCCAGG - Intronic
903885419 1:26538183-26538205 ATAGTGTGGACTGGGCCCCTTGG + Intronic
904743251 1:32694903-32694925 CAAGTGCGATCTGGTCCTCCAGG + Exonic
906684487 1:47754848-47754870 GAAGCGTGCTCTGGTCCCCCGGG - Intergenic
909944689 1:81650282-81650304 AAATTGTGGGCCGGGCCCCCTGG + Intronic
910662791 1:89691419-89691441 AAAATGCCATCTGGGCCCTCCGG - Intronic
911310735 1:96289287-96289309 AAGCTATGATGTGGGCCCCCAGG + Intergenic
912684771 1:111753858-111753880 ATAGTGTGATGTGGGACCCTGGG + Intronic
917063446 1:171066061-171066083 AAGGTGAGATCTGGGACACCTGG - Intergenic
917954445 1:180078591-180078613 ATACTGTGATCTGGACTCCCTGG - Exonic
918654053 1:187002447-187002469 AATGTGTTATCTGGGCTCCTGGG - Intergenic
919568508 1:199218775-199218797 AAGCTGTGATGGGGGCCCCCAGG + Intergenic
919596799 1:199574427-199574449 AAAGTGTGAGCTGGGTGCCGTGG + Intergenic
921999683 1:221463663-221463685 GAAGTGTGATCTGGGCAAGCTGG + Intergenic
923085058 1:230696856-230696878 AGAGTGTGATGGGGGCGCCCAGG + Intergenic
923781905 1:237032273-237032295 AAAGCTTGATATGGGTCCCCTGG - Intergenic
923945970 1:238888069-238888091 TAAGGGAGATCTGGGCCCTCTGG - Intergenic
1064156679 10:12908666-12908688 GAGGTGTGATCTCGGCTCCCAGG + Intronic
1067744936 10:48928571-48928593 AATGTGTCCTCTTGGCCCCCAGG - Intronic
1068047275 10:51902928-51902950 AAAATGTGGTCTGGGAACCCAGG - Intronic
1069842199 10:71346904-71346926 CCAGTGAGATGTGGGCCCCCAGG + Intronic
1071362375 10:84862194-84862216 AAAATATCCTCTGGGCCCCCAGG + Intergenic
1071982251 10:91014957-91014979 ATAGTGTGATCTTGGCTCACTGG - Intergenic
1076640669 10:131914639-131914661 TAAGAGTGTTCTGGGCCCCTCGG + Intronic
1077476473 11:2792718-2792740 ACAGGGTGGTCTGCGCCCCCAGG - Intronic
1077554302 11:3218573-3218595 AGAGTGTGTCCTGGGCGCCCAGG + Exonic
1079547005 11:21644402-21644424 AAAGTGTGGTCCTGGACCCCTGG + Intergenic
1082862269 11:57867858-57867880 AAAGTGTCATCTGAGACTCCAGG + Intergenic
1083981900 11:66178919-66178941 ATAGTGTGATCTGGGACCTGTGG - Intronic
1084475442 11:69386171-69386193 ACTGTGTGAACTGGGACCCCAGG + Intergenic
1084698407 11:70770054-70770076 ACAGTGTGACCTGGGCCCTCTGG + Intronic
1085746258 11:79117191-79117213 ACAGTGTGATCAGGGCCCAGTGG - Intronic
1088340736 11:108763198-108763220 ACAGTGTGATCTGGCCACCAAGG - Intronic
1090239284 11:125170832-125170854 AGAGTCTGCTCTGGGCCCCAGGG - Intronic
1091836218 12:3587998-3588020 GAAGTGGGAACTGGGGCCCCTGG + Intronic
1093316211 12:17653648-17653670 ATAATGTGACCTGGGACCCCAGG - Intergenic
1095098217 12:38159093-38159115 AAAGTGGCAACAGGGCCCCCGGG + Intergenic
1097212836 12:57385795-57385817 AAAGTGTGGCCTGGAACCCCTGG + Intronic
1097606263 12:61758419-61758441 AAATTGTGATCCAGGGCCCCTGG + Intronic
1098965353 12:76782334-76782356 AAAGTATGATTTGGGTCTCCTGG + Intronic
1100282115 12:93127997-93128019 AATGTGTGATCAGGCCCCCCAGG + Intergenic
1102655417 12:114479047-114479069 TAAGTTTGATTTGGGCTCCCAGG + Intergenic
1103308729 12:119988616-119988638 AAATTTAGGTCTGGGCCCCCAGG - Intergenic
1105940373 13:25142251-25142273 GATGTGTGATCCAGGCCCCCGGG - Intergenic
1110512517 13:76367773-76367795 ATAGTGTGTTCTTGGCACCCTGG - Intergenic
1113070850 13:106419770-106419792 AACATGTGATCTTGGCCCCCAGG + Intergenic
1113072136 13:106432220-106432242 AAGGGGTGATTTGGGGCCCCAGG - Intergenic
1113932739 13:113976828-113976850 AGAGTGTGAACGGAGCCCCCTGG + Intergenic
1117024765 14:51608170-51608192 AGAGTGTGCTCTGGGCACCCAGG + Intronic
1122630799 14:103106964-103106986 ATGCTGTGACCTGGGCCCCCAGG - Intronic
1124407617 15:29405689-29405711 CAAGCGTGCTCTGGGCCCCCAGG - Intronic
1127098263 15:55535299-55535321 AAACTATGATGTGAGCCCCCAGG - Intergenic
1127995455 15:64151287-64151309 AAATTGTGATCTGGATTCCCCGG - Intergenic
1132193217 15:99887737-99887759 AAATAGTGTTCTGGGCTCCCTGG + Intergenic
1132369798 15:101287684-101287706 ACAGGGTGATCTGGACCCTCTGG - Exonic
1134596306 16:15498761-15498783 AAAGGGTGATTTTGTCCCCCAGG + Intronic
1136515462 16:30765466-30765488 TGAGTGTGATCTGGCCCCCCTGG - Exonic
1138630589 16:58291406-58291428 AAAGCCTGGTCTGGGACCCCTGG + Intronic
1139243791 16:65420792-65420814 AAAGTGTGGTCTGTGCCCCATGG - Intergenic
1140241898 16:73209870-73209892 AACGTGTGGTCTGGGGACCCTGG - Intergenic
1141635776 16:85313141-85313163 AAAGTGAGAGGTGGGGCCCCTGG + Intergenic
1142901912 17:3017506-3017528 AAAGTGTGCTCTGGGCAACTTGG - Intronic
1144669372 17:17124304-17124326 AAAGTGGGGTCTGTGCCTCCAGG + Intronic
1144847012 17:18225445-18225467 CAATGGTGAACTGGGCCCCCGGG - Intergenic
1146683729 17:34826561-34826583 AAGCTGTCAGCTGGGCCCCCGGG - Intergenic
1147552283 17:41452204-41452226 AAAATGTGATCTGAGCCACATGG + Intergenic
1149848978 17:60024300-60024322 AAAGTGTGCTCCGGGACCCTTGG - Intergenic
1149861190 17:60122224-60122246 AAAGTGTGCTCCGGGACCCTTGG + Intergenic
1150245432 17:63671193-63671215 AAAGTGTGTTCTGGGGATCCTGG + Intronic
1152198869 17:78933772-78933794 ACAGTTTGAGCAGGGCCCCCGGG + Intergenic
1153454159 18:5261895-5261917 AAGCTATGATCTGGGCCCCAGGG - Intergenic
1153676987 18:7464621-7464643 AAAATGTGAGCTGGACCCCATGG + Intergenic
1157741748 18:50099627-50099649 TAGGGGTGATTTGGGCCCCCAGG + Intronic
1159498881 18:69242694-69242716 AGAGTGTGATGTGGAACCCCTGG + Intergenic
1161849424 19:6730969-6730991 CAAGTGTGAGCTGGGCACCATGG - Exonic
1161854152 19:6754001-6754023 TAAATTTGGTCTGGGCCCCCAGG + Intronic
1162920917 19:13902344-13902366 AAAGTCTGAGCTGGGCGCGCTGG + Intronic
1162965524 19:14154083-14154105 ATGGTCTGATCTGGGCCCCTCGG - Intronic
1163508293 19:17720747-17720769 GAGGTGTGCTCTGGGTCCCCTGG + Intronic
1163665772 19:18603619-18603641 ACAGGGTGATCCTGGCCCCCAGG + Intronic
1164100584 19:22051289-22051311 AAAGTGTGTTCTCTGCCTCCTGG - Intergenic
1164810978 19:31155579-31155601 AGAGAATGATCTGGGCCCCGAGG - Intergenic
1165108926 19:33489976-33489998 CAAGTGAGTCCTGGGCCCCCAGG - Exonic
1167428676 19:49442433-49442455 AAATTGTGATCCGCACCCCCTGG + Intergenic
1167826194 19:51975797-51975819 ATGGTGTGATCTCGGCCTCCCGG + Intronic
1168407233 19:56117044-56117066 AGGGTGGGATCTGGCCCCCCAGG + Intronic
925170314 2:1745995-1746017 GCAGTGTGAGCTGGGCCCACCGG - Intergenic
925170355 2:1746350-1746372 AGAGTGTGAACTGGACCCACTGG - Intergenic
927048287 2:19302100-19302122 CACCTGTGCTCTGGGCCCCCTGG - Intergenic
929803895 2:45127928-45127950 AAAGGATGATCTGGGAGCCCTGG - Intergenic
932413026 2:71558447-71558469 CAGGTGGGATCTGGGGCCCCGGG - Intronic
932463788 2:71899985-71900007 AAAGGGTGATCTGGGGCTGCAGG - Intergenic
932756357 2:74412695-74412717 AAGGTGAGATCCAGGCCCCCTGG + Intergenic
934659016 2:96133267-96133289 CAAGTGTGAGCTGGACCTCCAGG - Intronic
936614936 2:114038973-114038995 GAAGTGTGATTTTGTCCCCCTGG + Intergenic
937293026 2:120793429-120793451 ATAGTCTCATCTGGGCCTCCAGG - Intronic
939961938 2:148572797-148572819 AAAGTGTGTTTAGGGCACCCTGG - Intergenic
940128910 2:150359305-150359327 AAAGTGTCCTCTGGGGTCCCTGG + Intergenic
940165551 2:150766518-150766540 CAAGTGTGAACTGAGCTCCCAGG - Intergenic
942239391 2:173945751-173945773 AGTGTGTGATCTGAGACCCCTGG - Intronic
942858487 2:180581417-180581439 AAAGTGTGATCTGAGAACCCTGG - Intergenic
943386364 2:187208039-187208061 AAGTTATGATGTGGGCCCCCAGG - Intergenic
944157294 2:196620798-196620820 AAAGTGTTTTCTGGGCCTTCTGG + Intergenic
944370769 2:198980956-198980978 CAAGGATGATTTGGGCCCCCAGG + Intergenic
945809771 2:214534568-214534590 ACATTGTGAACTGTGCCCCCTGG + Intronic
947039191 2:225895776-225895798 AAAGTGTGGTCCCGGCCCCAGGG - Intergenic
947710132 2:232308814-232308836 AGAGTGTGTTCTGAGACCCCGGG - Intronic
948253763 2:236551389-236551411 AAAGTGTGCTCCTGGCCCCCAGG + Intergenic
1171446424 20:25207554-25207576 TAAGAGTGATCTGGGACTCCCGG - Intronic
1172687906 20:36771017-36771039 AAATTGTGATCTCAGCCACCAGG - Exonic
1178604556 21:34024623-34024645 TAAGTGTGATTTGGGCAGCCAGG + Intergenic
1180597537 22:16988442-16988464 GGAGTGTGGTCCGGGCCCCCAGG + Intronic
1181756819 22:25029742-25029764 AAATTGGGCTCCGGGCCCCCCGG - Intronic
1185095083 22:48801936-48801958 AAACTGTGCTCTGAGCACCCTGG + Intronic
949219125 3:1608500-1608522 AAAATGTTATCAGGGCTCCCTGG + Intergenic
952119524 3:30225671-30225693 AAAGTATGATCTGGGGCTCAGGG - Intergenic
956272211 3:67459979-67460001 AAAGTGTAATGTGGGACCTCTGG - Intronic
956505499 3:69934148-69934170 AAAGTGTGATCAGAGGGCCCTGG + Intronic
961543671 3:127617567-127617589 AAAGTGGGACCTGGGACACCTGG + Intronic
965347800 3:167573693-167573715 ACAGTGTGATCTTGGACCTCTGG - Intronic
965672031 3:171157372-171157394 CAGGTGGGATGTGGGCCCCCAGG + Intronic
974581946 4:63814743-63814765 AATCTATGATGTGGGCCCCCAGG + Intergenic
974663017 4:64919716-64919738 AAACTATGGTGTGGGCCCCCAGG - Intergenic
982227698 4:153181352-153181374 AAACTGTGACCAGGGCCCACAGG - Intronic
984418436 4:179489552-179489574 AATGTTTAATCTGGGCACCCTGG + Intergenic
985576851 5:677569-677591 AACGTGCCATCTGGGCCCCCAGG - Intronic
985673229 5:1217057-1217079 ACAGTGGGAGCTGGGCCTCCCGG - Intronic
985714622 5:1448432-1448454 AAAGTCTGAGCTGGGCTCCCTGG - Intergenic
986663550 5:10080452-10080474 GAAGAGTGAGCTGGGCCTCCAGG + Intergenic
988461028 5:31438026-31438048 AAAGTGTGATCTGTGCACTGAGG - Intronic
988869211 5:35370229-35370251 AAATTGTCTTCTGGGTCCCCTGG + Intergenic
988966173 5:36420240-36420262 AAAATGAGATCTGGGCACACTGG + Intergenic
994795016 5:104286441-104286463 AAAGTGTGATTTTGACCCCAGGG - Intergenic
997014279 5:129913013-129913035 AAAGTGTGATCTTTGCCAACAGG - Intronic
1002050211 5:176566397-176566419 AATGTGGTATCTAGGCCCCCTGG - Intronic
1004693924 6:18016417-18016439 AAAGTGTGATCTCAGCCTCCAGG - Intergenic
1006368209 6:33628359-33628381 AATGTGAGCTCTGAGCCCCCTGG + Intronic
1013586394 6:111582570-111582592 AACTGGTGATCTGGACCCCCTGG - Intronic
1013992130 6:116265632-116265654 AAGGTATGGTGTGGGCCCCCAGG + Intronic
1018721959 6:166580081-166580103 ACAGTGGGCTTTGGGCCCCCGGG + Intronic
1024005523 7:45222604-45222626 AACCTTTGCTCTGGGCCCCCCGG + Intergenic
1024282374 7:47730109-47730131 AAAGTGGGAGCTGGGACACCTGG - Intronic
1029254053 7:99257127-99257149 AACATCTGATCTGGGCCCCTTGG + Intergenic
1033044330 7:137947616-137947638 AACCTGTGATCTGGGAGCCCAGG - Intronic
1033304957 7:140218549-140218571 AAGGTGTTTTGTGGGCCCCCGGG + Intergenic
1034545230 7:151784900-151784922 GGAGTGTGATCTGGCCCCCAAGG - Intronic
1036423463 8:8619602-8619624 ATAGCGTGATCTGGGCTCCCTGG - Intergenic
1039861363 8:41461292-41461314 AAAGTGGTATCTGAGACCCCTGG + Intergenic
1048216068 8:132496480-132496502 TATGTGTGATATGGGCCACCAGG + Intergenic
1049674337 8:143883092-143883114 CCAGTGTGATCTGGGCCTCCAGG + Intergenic
1051852762 9:21528344-21528366 AAGCTATGATGTGGGCCCCCAGG + Intergenic
1051866936 9:21694618-21694640 AAAGTGTGACCTGGAGCTCCTGG - Intergenic
1053217331 9:36283112-36283134 AAAGTGTGGTCTGGGGACCTCGG - Intronic
1056602144 9:88054766-88054788 CAAGTGTGATTTGGGAGCCCCGG + Intergenic
1061744581 9:132730278-132730300 AAAGGCTGGTCTGGGCCCCATGG - Intronic
1062186256 9:135220194-135220216 AAAGTGTGAAATTGGCCCTCGGG + Intergenic
1185836673 X:3351001-3351023 ATAGTGTGTTCTAGGCCCTCTGG - Intergenic
1186485866 X:9933910-9933932 GGAGTGTGATTTTGGCCCCCAGG + Intronic
1186815928 X:13238108-13238130 AAAGTGTGATCTTGGACCAGCGG + Intergenic
1188797213 X:34481668-34481690 GAGGTATGATGTGGGCCCCCAGG + Intergenic
1188857530 X:35214971-35214993 ATAGTGTGATCTTGGCTCACTGG - Intergenic
1192633378 X:72793727-72793749 ACAGTGGCATCTGAGCCCCCAGG + Intronic
1192648331 X:72927074-72927096 ACAGTGGCATCTGAGCCCCCAGG - Intronic
1192810190 X:74540467-74540489 AAAGGGTGAGCTGGGCCCTAGGG - Intergenic
1195548357 X:106138647-106138669 GAGCTGTGATGTGGGCCCCCAGG - Intergenic
1198428925 X:136546490-136546512 AAACTGTGCTCTGGGGCACCTGG + Intronic
1200065075 X:153500351-153500373 AAAGTGTGCCCTGAGCTCCCTGG - Intronic
1200122206 X:153796444-153796466 AAGGGGTGATCTGGGGCTCCAGG - Exonic
1201239943 Y:11949054-11949076 ATAGTGTGTTCTAGGCCCTCTGG + Intergenic