ID: 900165770

View in Genome Browser
Species Human (GRCh38)
Location 1:1243773-1243795
Sequence AAGTGTGATCTGGGCCCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 190}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900165759_900165770 13 Left 900165759 1:1243737-1243759 CCCGGCTACCGGGGACCCACGCT 0: 1
1: 0
2: 0
3: 7
4: 75
Right 900165770 1:1243773-1243795 AAGTGTGATCTGGGCCCCCAGGG 0: 1
1: 0
2: 1
3: 26
4: 190
900165761_900165770 5 Left 900165761 1:1243745-1243767 CCGGGGACCCACGCTCCGTCTGG 0: 1
1: 0
2: 2
3: 15
4: 122
Right 900165770 1:1243773-1243795 AAGTGTGATCTGGGCCCCCAGGG 0: 1
1: 0
2: 1
3: 26
4: 190
900165756_900165770 21 Left 900165756 1:1243729-1243751 CCCTGCCTCCCGGCTACCGGGGA 0: 1
1: 0
2: 1
3: 9
4: 238
Right 900165770 1:1243773-1243795 AAGTGTGATCTGGGCCCCCAGGG 0: 1
1: 0
2: 1
3: 26
4: 190
900165766_900165770 -10 Left 900165766 1:1243760-1243782 CCGTCTGGGCATAAAGTGTGATC 0: 1
1: 0
2: 1
3: 10
4: 121
Right 900165770 1:1243773-1243795 AAGTGTGATCTGGGCCCCCAGGG 0: 1
1: 0
2: 1
3: 26
4: 190
900165760_900165770 12 Left 900165760 1:1243738-1243760 CCGGCTACCGGGGACCCACGCTC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 900165770 1:1243773-1243795 AAGTGTGATCTGGGCCCCCAGGG 0: 1
1: 0
2: 1
3: 26
4: 190
900165765_900165770 -3 Left 900165765 1:1243753-1243775 CCACGCTCCGTCTGGGCATAAAG 0: 1
1: 0
2: 0
3: 0
4: 21
Right 900165770 1:1243773-1243795 AAGTGTGATCTGGGCCCCCAGGG 0: 1
1: 0
2: 1
3: 26
4: 190
900165758_900165770 16 Left 900165758 1:1243734-1243756 CCTCCCGGCTACCGGGGACCCAC 0: 1
1: 0
2: 0
3: 6
4: 105
Right 900165770 1:1243773-1243795 AAGTGTGATCTGGGCCCCCAGGG 0: 1
1: 0
2: 1
3: 26
4: 190
900165764_900165770 -2 Left 900165764 1:1243752-1243774 CCCACGCTCCGTCTGGGCATAAA 0: 1
1: 0
2: 0
3: 2
4: 20
Right 900165770 1:1243773-1243795 AAGTGTGATCTGGGCCCCCAGGG 0: 1
1: 0
2: 1
3: 26
4: 190
900165757_900165770 20 Left 900165757 1:1243730-1243752 CCTGCCTCCCGGCTACCGGGGAC 0: 1
1: 0
2: 0
3: 40
4: 984
Right 900165770 1:1243773-1243795 AAGTGTGATCTGGGCCCCCAGGG 0: 1
1: 0
2: 1
3: 26
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900165770 Original CRISPR AAGTGTGATCTGGGCCCCCA GGG Intronic
900165770 1:1243773-1243795 AAGTGTGATCTGGGCCCCCAGGG + Intronic
900282587 1:1880661-1880683 AAGTGTGATCGTGGACCCCTGGG - Intronic
900503027 1:3015967-3015989 AGGTGTGGTCTTGGGCCCCAGGG + Intergenic
900597911 1:3490818-3490840 AAGTATAATCTGGGCCCCACAGG - Intronic
902382627 1:16059797-16059819 TGCAGTGATCTGGGCCCCCAAGG + Intronic
902618659 1:17637951-17637973 AAGCGTGATCTGCTCCACCACGG - Exonic
902984389 1:20146734-20146756 CACAGAGATCTGGGCCCCCAAGG - Intronic
905449729 1:38048308-38048330 TTCTGTGATCTGGGACCCCAGGG - Intergenic
905652779 1:39667688-39667710 AAGTGTGATCCCTGTCCCCATGG + Intronic
906103937 1:43280435-43280457 AAGTGTGAGCTTGGCATCCAAGG + Intergenic
906480221 1:46194675-46194697 AACTGGTGTCTGGGCCCCCATGG - Intronic
910171958 1:84387245-84387267 AAGTTTGATCTTGGTCACCATGG + Intronic
911310736 1:96289288-96289310 AGCTATGATGTGGGCCCCCAGGG + Intergenic
913090878 1:115475789-115475811 AAGTGTGGCCTGGTCCCCGAGGG + Intergenic
914802666 1:150972701-150972723 AAGTGGCATCTGTGCCTCCAAGG - Intronic
915442418 1:155953356-155953378 AAGTTTCATCTGGGCACACATGG + Intronic
919568509 1:199218776-199218798 AGCTGTGATGGGGGCCCCCAGGG + Intergenic
920222557 1:204414662-204414684 AAGTATGGTCTGGGCACCCCTGG + Intergenic
923085059 1:230696857-230696879 GAGTGTGATGGGGGCGCCCAGGG + Intergenic
923156679 1:231285391-231285413 AAGTGTGCTTTGGCCCCCAAAGG - Intergenic
923945969 1:238888068-238888090 AAGGGAGATCTGGGCCCTCTGGG - Intergenic
924596131 1:245446561-245446583 AAGTGTGTTTTTAGCCCCCAAGG + Intronic
1068047274 10:51902927-51902949 AAATGTGGTCTGGGAACCCAGGG - Intronic
1068053673 10:51983425-51983447 ACCTATGATGTGGGCCCCCAGGG + Intronic
1068745934 10:60530643-60530665 AGGTGGGATTTGAGCCCCCATGG + Intronic
1069488040 10:68837616-68837638 AAGGGTGATGTAAGCCCCCATGG + Intronic
1072736335 10:97881969-97881991 CAGTGTGATCAGGGCCCAGATGG - Intronic
1072816785 10:98517333-98517355 AAGTGTGATTTTGCTCCCCAAGG - Intronic
1073215096 10:101831895-101831917 TACTGTGACCTGGGTCCCCATGG + Intronic
1074062250 10:109977525-109977547 AAATGAGATCTGGGCCCTGAAGG - Intergenic
1076997078 11:303106-303128 CAGTGGGACCTGGACCCCCACGG + Intergenic
1077554303 11:3218574-3218596 GAGTGTGTCCTGGGCGCCCAGGG + Exonic
1078936021 11:15951020-15951042 AAGACTGAGCTGGGCCTCCAAGG + Intergenic
1080915655 11:36656135-36656157 AACTCTGATCAGGGCTCCCACGG - Intronic
1082146180 11:48672485-48672507 AAGTGATATCTGGGACCGCATGG + Intergenic
1082589026 11:54982132-54982154 AAGTGATATCTGGGACCGCATGG + Intergenic
1083082428 11:60108198-60108220 AAGCGTGATCTGATCACCCATGG - Intergenic
1083708537 11:64532975-64532997 AAGTGTGGTCTGGGTTCCCACGG + Intergenic
1084245347 11:67853288-67853310 CAGTGTGTTGTAGGCCCCCATGG - Intergenic
1088268557 11:108010074-108010096 AAGGGAGATCTAGGCCCACAGGG + Intronic
1091836219 12:3587999-3588021 AAGTGGGAACTGGGGCCCCTGGG + Intronic
1091958462 12:4669253-4669275 AATAGTGATTTTGGCCCCCAGGG - Intronic
1093731065 12:22566546-22566568 AAGTATGATCTGTGGTCCCATGG - Intergenic
1094776693 12:33737818-33737840 ATGTTTGATCTGAGCCCCCATGG + Intergenic
1094832731 12:34307849-34307871 GAGGGTGGCCTGGGCCCCCAAGG + Intergenic
1094833431 12:34311238-34311260 GAGGGTGGTCTGGGCCCCCACGG - Intergenic
1096478578 12:51923515-51923537 AACTGAGATTTGGGCCCCCGCGG - Intergenic
1096526346 12:52212455-52212477 TAGTGGGACCAGGGCCCCCAGGG + Intergenic
1101969390 12:109302213-109302235 CAATGTGAACTGGACCCCCACGG + Intronic
1102204734 12:111082782-111082804 CAGTCTGCTCAGGGCCCCCAGGG - Intronic
1107412728 13:40172591-40172613 AAGTTTGACCTGGGTCGCCAGGG - Intergenic
1110350508 13:74502076-74502098 CATTGTGAGCTAGGCCCCCAAGG + Intergenic
1111184341 13:84711861-84711883 AAGTCTGATAGGGGCTCCCATGG - Intergenic
1113072135 13:106432219-106432241 AGGGGTGATTTGGGGCCCCAGGG - Intergenic
1113807030 13:113115932-113115954 AGGTGGGATCTGGGCACCAAGGG + Intronic
1114419674 14:22570873-22570895 AAGGGTGAACTGGGCCCAAAGGG - Intronic
1114621978 14:24101504-24101526 AAGTGTGACCTGGGCTCCTGAGG + Intronic
1115246417 14:31300343-31300365 AGGTGTGATCTTGGCTCACACGG + Intronic
1119436509 14:74600966-74600988 AAGTTTGAGGAGGGCCCCCAAGG + Intronic
1121413488 14:93763383-93763405 AAGGGTGAGCTGGCCTCCCAGGG - Intronic
1122447436 14:101780413-101780435 AAGGGTGATTTTGCCCCCCAAGG + Intronic
1122895907 14:104756835-104756857 GTGTGTGTTCTGGGCCCACATGG - Intronic
1122975472 14:105168983-105169005 AGGTGTGAGCGGGGCCCCCGCGG - Intergenic
1125518514 15:40335928-40335950 AAGGCTGAGCTGGGACCCCATGG + Intronic
1126070518 15:44861649-44861671 AACTGGGATCTGGGCAGCCAGGG + Intergenic
1128409403 15:67379491-67379513 AATTGTGATCTGGGAACCCAAGG - Intronic
1129270487 15:74416975-74416997 AAGTGACATAGGGGCCCCCAGGG - Intronic
1129276635 15:74449900-74449922 AAGTGTAATGTGGGCCCCTCAGG - Intronic
1129851276 15:78795293-78795315 AAGCTTGATCTGGGCCTTCAAGG + Intronic
1129931126 15:79412029-79412051 AGCTGTGATGCGGGCCCCCAGGG - Intronic
1129931138 15:79412090-79412112 AGCTGTGATGCGGGCCCCCAGGG + Intronic
1130916051 15:88305533-88305555 AAATGTGATCTTGGCCTTCAGGG - Intergenic
1130988811 15:88862567-88862589 AAGAGTGACCTGGGACCCCAAGG - Intronic
1132343078 15:101090216-101090238 AATAGTGAGCTGGGCCACCAAGG - Intergenic
1134104636 16:11476983-11477005 AGGTGGGATCTGTGGCCCCAGGG - Intronic
1134596307 16:15498762-15498784 AAGGGTGATTTTGTCCCCCAGGG + Intronic
1136007796 16:27342963-27342985 AAGTGTGGTCTGGGCCCACCAGG - Intronic
1136771565 16:32845890-32845912 AGGAGTGAACTGGGGCCCCAAGG + Intergenic
1138564953 16:57826185-57826207 AACTGTGCTCTGGACTCCCATGG - Intronic
1138778313 16:59752374-59752396 AAGTGTCATGTGGGCACCCTCGG - Intronic
1140142599 16:72272861-72272883 AAGTGAGACCTGAGGCCCCATGG - Intergenic
1141548863 16:84790981-84791003 AAGTGTGAGCTTGGCCTCCAAGG + Intergenic
1203073990 16_KI270728v1_random:1108001-1108023 AGGAGTGAACTGGGGCCCCAAGG + Intergenic
1142495742 17:305425-305447 TGGTGTGAGCTGGGCCTCCAGGG - Intronic
1143434028 17:6909353-6909375 AGCTATGATGTGGGCCCCCAAGG + Intronic
1143696035 17:8619478-8619500 AAGTGTGGTCTGGACCCCCTAGG - Intronic
1143709052 17:8721159-8721181 CAGTGTGTTGTGGGCACCCAAGG - Intergenic
1144669373 17:17124305-17124327 AAGTGGGGTCTGTGCCTCCAGGG + Intronic
1146169454 17:30621585-30621607 AGCTGTGGGCTGGGCCCCCATGG + Intergenic
1146170108 17:30625864-30625886 AGCTGTGGGCTGGGCCCCCATGG - Intergenic
1147989824 17:44325758-44325780 AGGTGGGATCTGGCTCCCCATGG - Intergenic
1149578387 17:57729821-57729843 AGGTGAGCCCTGGGCCCCCAGGG + Intergenic
1152569679 17:81116228-81116250 AGGTGTGATCTGTCCGCCCAAGG + Exonic
1154209536 18:12367759-12367781 AAGTGTGTTCTGGCCACGCACGG + Intronic
1159878477 18:73835350-73835372 ATTTGTGAACTGTGCCCCCAAGG + Intergenic
1161849423 19:6730968-6730990 AAGTGTGAGCTGGGCACCATGGG - Exonic
1161854153 19:6754002-6754024 AAATTTGGTCTGGGCCCCCAGGG + Intronic
1162189017 19:8930191-8930213 GAGGGTGAACTGGGCACCCAGGG + Intronic
1162322520 19:9978590-9978612 AAGGGTGATAAGGGCCCCCCAGG - Exonic
1162721382 19:12664900-12664922 AAGTGTCATCTGGTCCACGATGG + Exonic
1162812231 19:13171221-13171243 AAGAGTGATCTGGCCCCACATGG - Intergenic
1163665773 19:18603620-18603642 CAGGGTGATCCTGGCCCCCAGGG + Intronic
1165108925 19:33489975-33489997 AAGTGAGTCCTGGGCCCCCAGGG - Exonic
925133427 2:1510416-1510438 AAGTGTTTCCTGGGGCCCCATGG - Intronic
925405665 2:3604187-3604209 AAGGGCTGTCTGGGCCCCCATGG - Intronic
926103015 2:10132667-10132689 AAGTGTGATCTGTGTCCCAGAGG + Intergenic
931055139 2:58461174-58461196 CAGTATGGTCTGGGCCTCCATGG + Intergenic
932413025 2:71558446-71558468 AGGTGGGATCTGGGGCCCCGGGG - Intronic
934659015 2:96133266-96133288 AAGTGTGAGCTGGACCTCCAGGG - Intronic
936495286 2:113015146-113015168 CAGAGTGATCTAGGTCCCCAGGG + Intergenic
936909102 2:117572216-117572238 AGCTATGATGTGGGCCCCCAGGG + Intergenic
937003594 2:118490748-118490770 GAGTTTGATCGGGGCCCCGAGGG - Intergenic
937293025 2:120793428-120793450 TAGTCTCATCTGGGCCTCCAGGG - Intronic
939486622 2:142820787-142820809 TAGTTTGATCTATGCCCCCAAGG + Intergenic
940165550 2:150766517-150766539 AAGTGTGAACTGAGCTCCCAGGG - Intergenic
943386363 2:187208038-187208060 AGTTATGATGTGGGCCCCCAGGG - Intergenic
944370770 2:198980957-198980979 AAGGATGATTTGGGCCCCCAGGG + Intergenic
945320898 2:208422325-208422347 AAATGTAATCTGGGCACCCATGG + Intronic
946103763 2:217351638-217351660 AGCTGTGATGTAGGCCCCCAGGG + Intronic
946630465 2:221662095-221662117 AAGTGTGGTCTGGGCCTACTAGG - Intergenic
946668412 2:222075572-222075594 AACTGTGGTCTGGGGTCCCATGG + Intergenic
948284134 2:236770802-236770824 AAGAGCTATCTGTGCCCCCATGG + Intergenic
948680542 2:239631321-239631343 AAGTGTGATCTTTGCCTGCAAGG + Intergenic
1171414716 20:24969772-24969794 AAGTTTGAGCAGGGCACCCAGGG - Intronic
1171446423 20:25207553-25207575 AAGAGTGATCTGGGACTCCCGGG - Intronic
1171994957 20:31723751-31723773 AAGGGGGATGTGGCCCCCCACGG - Intronic
1173422020 20:42909764-42909786 AATGGTGATCTGGTCCCCCAAGG - Intronic
1173600070 20:44288479-44288501 GAGTGTCCTCTGGGCCCCCCTGG + Intergenic
1175753482 20:61514921-61514943 AGGTGTGCCCTGGGCCTCCAGGG - Intronic
1176707297 21:10125842-10125864 AAGCGGGGACTGGGCCCCCACGG + Intergenic
1178902175 21:36606547-36606569 AAGTGGGATCTGGGCCCAGATGG - Intergenic
1179257110 21:39726626-39726648 AAGTGTTTGCTGGTCCCCCAGGG - Intergenic
1179818432 21:43922664-43922686 CAGTGTGCTCTGGGCTTCCATGG + Intronic
1181019594 22:20092365-20092387 AGGTGTGATGAGGGCACCCAAGG - Intronic
1181882406 22:25991467-25991489 AAGAGTGATTTTGCCCCCCAGGG - Intronic
1185035648 22:48475268-48475290 ATGTGTGATCAGAGCCCACATGG - Intergenic
1185152058 22:49169438-49169460 CAGGGTGATCTGGCCCCCGAGGG + Intergenic
950405206 3:12799993-12800015 CAGGCTGAGCTGGGCCCCCATGG + Intronic
950791267 3:15474235-15474257 AAGGGTGACCTGGGTCCCAAAGG - Exonic
950799280 3:15536415-15536437 AAGTTTGTTCTGGGCCACGATGG - Intergenic
953787046 3:45919084-45919106 AAGAGTGATCTGGGATCCCAAGG + Exonic
954564123 3:51583967-51583989 AAGTGTGGTCTGGGAACCCCTGG - Intronic
962251822 3:133840437-133840459 AGGTGGGAGCTGGGCCCGCAAGG - Intronic
964768247 3:160198685-160198707 CAGTGTGATTTGGCCCACCAGGG - Intergenic
965259126 3:166457485-166457507 AAATGTGATCTGTGCCTTCAAGG + Intergenic
965515154 3:169613572-169613594 GTCTGTGACCTGGGCCCCCATGG - Intronic
965672032 3:171157373-171157395 AGGTGGGATGTGGGCCCCCAGGG + Intronic
967135405 3:186508862-186508884 TCCTGTGATCTGGGTCCCCATGG + Intergenic
968185967 3:196633843-196633865 AAGTGTGAACTGGACCCTCCTGG - Intergenic
970177351 4:13352763-13352785 AAGTGTGAGCTGTGCTCCAAAGG - Intergenic
974581947 4:63814744-63814766 ATCTATGATGTGGGCCCCCAGGG + Intergenic
974663016 4:64919715-64919737 AACTATGGTGTGGGCCCCCAGGG - Intergenic
978160485 4:105541234-105541256 AAATGTGATCAGTGCCACCAAGG + Intergenic
981350423 4:143723000-143723022 AGGGGTGATCTTGACCCCCAGGG - Intergenic
981781718 4:148438310-148438332 AAGGGTGATTTTGCCCCCCATGG - Intronic
981924606 4:150124894-150124916 CAGTATGATTTGTGCCCCCAAGG + Intronic
982227697 4:153181351-153181373 AACTGTGACCAGGGCCCACAGGG - Intronic
982924764 4:161321483-161321505 CATTGTGAGCTGGTCCCCCAAGG - Intergenic
983195306 4:164799696-164799718 ATGTTTAATCTGGGCACCCATGG + Intergenic
983559249 4:169084646-169084668 ATGTATTATATGGGCCCCCAGGG - Intergenic
985137577 4:186802386-186802408 AAGGGAGATCTGGGCCCCCGTGG + Intergenic
985576850 5:677568-677590 ACGTGCCATCTGGGCCCCCAGGG - Intronic
985714621 5:1448431-1448453 AAGTCTGAGCTGGGCTCCCTGGG - Intergenic
985900575 5:2786783-2786805 AAGGATGATCTGAGCCCTCAAGG - Intergenic
988461027 5:31438025-31438047 AAGTGTGATCTGTGCACTGAGGG - Intronic
993178499 5:84518815-84518837 AGCTGTGATGTGGGCCACCAGGG + Intergenic
994154008 5:96481987-96482009 AAGAGTGATGTGGGGCACCAAGG - Intergenic
996954277 5:129164425-129164447 AACTATGATATGGGCCCCTATGG + Intergenic
1001340046 5:170834812-170834834 AAATGGGATCTGGCCCCCCGTGG + Intergenic
1002070498 5:176676592-176676614 AAGTGTGACCTGGGCCCTGGCGG - Intergenic
1004674678 6:17830165-17830187 AAGTGTGATCTGAGAACCCCCGG + Intronic
1013992131 6:116265633-116265655 AGGTATGGTGTGGGCCCCCAGGG + Intronic
1019183841 6:170209499-170209521 GCGTGTGATCGGGACCCCCACGG - Intergenic
1020381944 7:7556958-7556980 AGCTGTGAAGTGGGCCCCCAGGG - Intergenic
1025320437 7:58088332-58088354 AGGAGTGAACTGGGGCCCCAAGG - Intergenic
1025878266 7:65508704-65508726 AGGAGTGAACTGGGGCCCCAAGG + Intergenic
1028875571 7:95819382-95819404 AAATGTGTTCTGGGGCCACATGG + Intronic
1029425785 7:100493467-100493489 AAGTTGGATTTTGGCCCCCATGG + Intronic
1033527053 7:142226504-142226526 AAGTTAGATCTGGGCCCCAAAGG + Intergenic
1034232977 7:149547217-149547239 TAGGGTGAACTGGTCCCCCAAGG + Intergenic
1034272990 7:149812283-149812305 CAGTGGGACCAGGGCCCCCATGG - Intergenic
1035677583 8:1466148-1466170 AAGTGTGCTCTTGACCCACATGG + Intergenic
1037710255 8:21349624-21349646 CACTGTGAGCTGGTCCCCCAAGG - Intergenic
1041695915 8:60736060-60736082 AAATGTGGTCTTGGCCCCCTTGG + Intronic
1047574013 8:126133160-126133182 CAGTTTGATCTGGGCTGCCAAGG - Intergenic
1048216069 8:132496481-132496503 ATGTGTGATATGGGCCACCAGGG + Intergenic
1048844516 8:138594123-138594145 AAGGCAGACCTGGGCCCCCAGGG - Exonic
1048979039 8:139693280-139693302 ATGTGTGATCTTGGTCCCCAAGG - Intronic
1049278871 8:141733955-141733977 ATGGGAGCTCTGGGCCCCCAGGG - Intergenic
1049370461 8:142261839-142261861 CACTGTGACCTGTGCCCCCAGGG - Intronic
1049470292 8:142772277-142772299 AAGTGGGAACTGGGCCCCCATGG + Intronic
1050016522 9:1239718-1239740 TAGTGTTATCTGGGCCTCCGTGG - Intergenic
1050545799 9:6707693-6707715 TATTGTGAGCTGGTCCCCCAAGG - Intergenic
1051852763 9:21528345-21528367 AGCTATGATGTGGGCCCCCAGGG + Intergenic
1055322160 9:75092945-75092967 AACTGTTATCTGTGCCACCATGG + Intronic
1056602145 9:88054767-88054789 AAGTGTGATTTGGGAGCCCCGGG + Intergenic
1058484970 9:105434622-105434644 AAGGATGTTCTGGGCTCCCAAGG + Intronic
1058723788 9:107783336-107783358 AAGTGTGGTCTGGGGACCCCAGG + Intergenic
1059296885 9:113279077-113279099 AAGTGTGATGGGTTCCCCCAAGG - Exonic
1059324511 9:113496136-113496158 AGGAGTGCTCTGGGCCCCAAGGG - Intronic
1060173384 9:121479589-121479611 GTGTGTGATGTGGGCCCCCTTGG - Intergenic
1061485259 9:130917376-130917398 AAGGGAGAGCTGGGCCCACATGG + Intronic
1062004595 9:134232922-134232944 CACTGTGCTCTGGCCCCCCAGGG + Intergenic
1062275068 9:135726575-135726597 GAGTCTGATCTGGGTCTCCAAGG - Intronic
1186232093 X:7466380-7466402 ACATGTGCTCTGGGCCCCTAGGG + Intergenic
1186485867 X:9933911-9933933 GAGTGTGATTTTGGCCCCCAGGG + Intronic
1188084608 X:25888037-25888059 AAGTGTAGTCTGGGCACCCTTGG - Intergenic
1189384064 X:40522236-40522258 ATGTGTGTCCTGGGCTCCCAGGG - Intergenic
1190382553 X:49853859-49853881 CAGTGTTTTCTGGGCCCCTATGG + Intergenic
1192633379 X:72793728-72793750 CAGTGGCATCTGAGCCCCCAGGG + Intronic
1192648330 X:72927073-72927095 CAGTGGCATCTGAGCCCCCAGGG - Intronic
1195548356 X:106138646-106138668 AGCTGTGATGTGGGCCCCCAGGG - Intergenic
1196339738 X:114583129-114583151 AAGGGTGAACGGGGCCCCCTTGG - Intergenic
1197890934 X:131269707-131269729 CAGTGTGATCTGGCTGCCCAAGG + Intergenic
1198735835 X:139784390-139784412 AAGTGGGATATGTTCCCCCAAGG + Intronic
1199265037 X:145818818-145818840 CAGGGTGAACTGGGACCCCAAGG - Exonic
1199742217 X:150746087-150746109 AAATGTGATCTGTGACCCGATGG - Intronic
1200842227 Y:7794296-7794318 GAGTGTGATCTGGGGACCCCTGG - Intergenic