ID: 900165775

View in Genome Browser
Species Human (GRCh38)
Location 1:1243794-1243816
Sequence GGCCTCCCAACCCTGACCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 174}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900165766_900165775 11 Left 900165766 1:1243760-1243782 CCGTCTGGGCATAAAGTGTGATC 0: 1
1: 0
2: 1
3: 10
4: 121
Right 900165775 1:1243794-1243816 GGCCTCCCAACCCTGACCCGAGG 0: 1
1: 0
2: 1
3: 27
4: 174
900165764_900165775 19 Left 900165764 1:1243752-1243774 CCCACGCTCCGTCTGGGCATAAA 0: 1
1: 0
2: 0
3: 2
4: 20
Right 900165775 1:1243794-1243816 GGCCTCCCAACCCTGACCCGAGG 0: 1
1: 0
2: 1
3: 27
4: 174
900165765_900165775 18 Left 900165765 1:1243753-1243775 CCACGCTCCGTCTGGGCATAAAG 0: 1
1: 0
2: 0
3: 0
4: 21
Right 900165775 1:1243794-1243816 GGCCTCCCAACCCTGACCCGAGG 0: 1
1: 0
2: 1
3: 27
4: 174
900165761_900165775 26 Left 900165761 1:1243745-1243767 CCGGGGACCCACGCTCCGTCTGG 0: 1
1: 0
2: 2
3: 15
4: 122
Right 900165775 1:1243794-1243816 GGCCTCCCAACCCTGACCCGAGG 0: 1
1: 0
2: 1
3: 27
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900165775 Original CRISPR GGCCTCCCAACCCTGACCCG AGG Intronic
900165775 1:1243794-1243816 GGCCTCCCAACCCTGACCCGAGG + Intronic
900491828 1:2953201-2953223 GGCCACCCAACCCTTCCCAGTGG + Intergenic
900578094 1:3394152-3394174 GGCCTCCCTCCTCTGATCCGCGG - Intronic
901055118 1:6445732-6445754 GGCTTCCCAATCGTGCCCCGAGG - Exonic
902397468 1:16140194-16140216 CCCCTCCCAACCCTGGCCCAGGG + Intronic
903302905 1:22391690-22391712 GGCCTCCCATCCCAGCCTCGTGG - Intergenic
903917279 1:26773642-26773664 TGCCTTCCAACCCAGACTCGGGG + Exonic
904755518 1:32766545-32766567 GGCCTCCTAGCTCTGACCTGTGG + Intronic
905362246 1:37429245-37429267 GTCCTCCCCACCCTGAGCCCTGG - Intergenic
922315136 1:224434914-224434936 GGCCTCCCTCCCCTGACCCCCGG - Intronic
922572229 1:226640950-226640972 GGCTGCCCAACCCTGACTCCAGG + Intronic
1064018089 10:11788146-11788168 AGCCCCCCCACCCAGACCCGGGG + Intergenic
1065920978 10:30392606-30392628 TGCCTCCCCACCCTGATCCTGGG - Intergenic
1067069075 10:43119455-43119477 GGCCTCCCACCCCTGGCTCCTGG + Intronic
1067936078 10:50613262-50613284 GTCATCCCACCCCTGACCCAGGG + Intronic
1069722215 10:70557098-70557120 GGCTTCCAACCCCTGACCCAGGG - Intronic
1070819231 10:79345385-79345407 TGCCTCCCCACCCTGTCCCAAGG + Intergenic
1073073465 10:100809122-100809144 TCCCTCCCAGCCCTGACCCCTGG + Exonic
1074585856 10:114767798-114767820 CGCCTCCCAGCCCAGACGCGCGG + Intergenic
1074878374 10:117632103-117632125 GGCCTTCCAACTGTGATCCGGGG + Intergenic
1076246295 10:128950094-128950116 GGCCTCCCAGGCCTCACCTGGGG - Intergenic
1076311337 10:129509944-129509966 GGCCCTCCAACCCTGACCCCAGG - Intronic
1076942071 10:133616572-133616594 GGCCCCCCACCCCTGCCCCGGGG - Intergenic
1077017433 11:403267-403289 GGGCACCCAACCCAGACCCGAGG + Intronic
1077323584 11:1953609-1953631 GGCCTCCCCACTCTGCCCCTGGG + Intronic
1077541440 11:3148332-3148354 GGGCCCCCACCCCTGACCTGGGG + Intronic
1081663006 11:44899880-44899902 GGCCTCCCACCACTGGCCCCAGG + Intronic
1082812803 11:57488839-57488861 GCCCTCCCAACCCTTCCCTGGGG + Intronic
1083329714 11:61891750-61891772 CGCCACCCAGCCCTGCCCCGGGG + Intronic
1083678883 11:64342329-64342351 GGCCTCCAAACCCTGCACCTCGG - Exonic
1083763654 11:64832166-64832188 GGCCTCCCAGCCCTCTCCCTTGG - Intronic
1083803035 11:65057797-65057819 GTTCTCCCCACCCTGACCCAGGG - Intronic
1086544869 11:87956484-87956506 GGCCTCCCACTCCTGCCCCATGG + Intergenic
1089456280 11:118627785-118627807 GGCCTCCCAGCCCTGGCCTCCGG + Exonic
1202806571 11_KI270721v1_random:8804-8826 GGCCTCCCCACTCTGCCCCTGGG + Intergenic
1094751626 12:33416297-33416319 GGCCTCCAAATCCTGACCTTAGG + Intronic
1096216437 12:49800258-49800280 GGCCTCCCCACACTGTCCCCTGG + Intronic
1097684313 12:62677424-62677446 GGCATCACAACCCTGGCTCGGGG - Intronic
1102375692 12:112419229-112419251 CGGCCCCCAACCCCGACCCGGGG - Intronic
1103565233 12:121812008-121812030 GGCCTCTCAGCCCTGGACCGTGG - Intronic
1103676852 12:122662789-122662811 GGCCTCCCAAACGTGAGCCACGG + Intergenic
1107631166 13:42344058-42344080 ATCCTCCCAACCCTCACCCCTGG - Intergenic
1108559124 13:51625975-51625997 GGCCACCCAACTATGACCAGAGG - Intronic
1115432458 14:33335587-33335609 GAACTTCCAACCCTGACCAGGGG - Intronic
1117253214 14:53955018-53955040 GGCCTCCGCACCCGGACCTGAGG - Intronic
1117574407 14:57083600-57083622 GGCCTCCAAACTCAGACCCAGGG + Intergenic
1118308410 14:64675117-64675139 GGCCTCCCAAACCTGAGAGGCGG - Intergenic
1118349858 14:64965919-64965941 GGCCTCCCACCCCTTCCCCAAGG - Intronic
1118615021 14:67569301-67569323 GGCCAGCCAACCCTGGCCCTGGG - Intronic
1118775512 14:68971705-68971727 GGTCCCCCAGCCCTGACCTGTGG + Intronic
1119323447 14:73744971-73744993 GGTCTGCCAACCCTGCCCCGTGG - Intronic
1119474162 14:74917647-74917669 GACGTCCCAACCCTTACTCGGGG - Intronic
1119859376 14:77925329-77925351 TGCCTCCCAAGCCTCACCAGAGG + Intronic
1122156342 14:99752661-99752683 GGCCTCCAGACCCTGACCCTTGG + Intronic
1122640581 14:103156888-103156910 GCCCTCCCATCCCTCACCCTGGG + Intergenic
1122945344 14:105006085-105006107 TGCCTCCCGACCCTGGCCAGAGG - Intronic
1122982230 14:105196999-105197021 TGCCCCCCGACCCTGCCCCGCGG + Intergenic
1123034062 14:105464683-105464705 GGCCTCCCAGCCCGGAGCAGCGG + Exonic
1124249704 15:28098852-28098874 GGCCTCCTAGCCATGAGCCGTGG - Intronic
1124321385 15:28714371-28714393 GACCTCCCGACCATGACCAGTGG + Intronic
1126102874 15:45130093-45130115 GCCCTCCCAAATCTGACCTGCGG - Exonic
1127588421 15:60398599-60398621 GGCCTCCCAGCCCAGGCTCGGGG - Intronic
1127850413 15:62907193-62907215 TGCCTGCCAACCCTGTCCCTTGG - Intergenic
1128982878 15:72199286-72199308 GGACTCCCAACCCTGGCTTGGGG - Exonic
1129702460 15:77775668-77775690 AGCCTCCCATGCCTGAGCCGAGG + Intronic
1130342680 15:83012445-83012467 GGCCTCCCAAACCTGTTCCTTGG - Intergenic
1132515063 16:362410-362432 GGCTTCTCAACCGTCACCCGTGG + Intergenic
1132897565 16:2236297-2236319 GGTCTCCCACCCCTTACCCTGGG + Exonic
1132931195 16:2460039-2460061 GGCTGCCCAATCCTGAACCGGGG - Intergenic
1132953816 16:2580349-2580371 GGCACCCCCACCCTGACCCCAGG - Intronic
1134798394 16:17062282-17062304 GGACTCCCACCCCTTACCCAGGG + Intergenic
1136142983 16:28299044-28299066 TGCCTGCCAGCCCTGACCCTAGG + Intronic
1137719645 16:50620487-50620509 GGCCCCTCCACCCTGACCCAAGG - Intronic
1137799285 16:51247564-51247586 GGCCTCCCCACCCAGCCCCCAGG - Intergenic
1139475724 16:67201720-67201742 CGCCACCCAACACTGACCCCAGG + Exonic
1141166055 16:81661748-81661770 GGCCCCCCACCCCTCACCCCAGG + Intronic
1141193576 16:81842662-81842684 GTCCTCCCACCCCTGACACCAGG - Intronic
1143174908 17:4950034-4950056 GGCCTCCCAGCCCCCACCCCAGG - Intronic
1144495059 17:15740818-15740840 GGCCTCCCCAGCCTGGCCCAGGG + Intronic
1147110261 17:38256779-38256801 GGCCGCCCAGCCCCGACTCGAGG + Intergenic
1148419251 17:47531652-47531674 GGCCGCCCAGCCCCGACCCGAGG - Intronic
1149520133 17:57312439-57312461 GGCATCCCAACCCGGGCCCCAGG - Intronic
1150388804 17:64779561-64779583 CGCATCCCAACCCTGACCCCGGG - Intergenic
1150790645 17:68198363-68198385 CGCATCCCAACCCTGACCCAGGG + Intergenic
1151933510 17:77247628-77247650 GCCCTCCCCACCCCGACCCCCGG - Intergenic
1152559794 17:81072223-81072245 GGTCTCCCAACGCTGCCCTGGGG - Intronic
1152587006 17:81193652-81193674 GGGTTCCCAGCCCTGACCCTGGG + Intronic
1153815212 18:8785094-8785116 GGCCTCTAAACCATGAGCCGCGG - Intronic
1155110509 18:22709688-22709710 AGCCTCCCACCCCTGACCCTTGG + Intergenic
1160588462 18:79926323-79926345 GGGCTCCCCACCCAGACCCCAGG - Intronic
1160759390 19:775377-775399 GGCCTCCCAAGCCTTCCCTGGGG + Intergenic
1160775965 19:855879-855901 GACTTCCCAACCCTGACAGGCGG + Intronic
1160846436 19:1168189-1168211 GGGCACCCAACGCTGCCCCGGGG - Intronic
1161021007 19:2011492-2011514 GGCCTTCCATCCCTGAGCCTGGG + Intronic
1161261222 19:3338870-3338892 GGGGTCCCATCCCTGACCCCAGG + Intergenic
1161338577 19:3728337-3728359 GGACTCCCCACCCTGAGCTGGGG + Intronic
1162158279 19:8694633-8694655 GGCCCCCCACCCCTGAGCTGAGG + Intergenic
1162401260 19:10447969-10447991 GAGCTTCCAAGCCTGACCCGAGG - Intronic
1163311867 19:16519664-16519686 CGCCTCCCATCCCTGACTCAAGG - Exonic
1163671749 19:18633429-18633451 GGCCTCCAAGCTCTGACCTGAGG + Intergenic
1165067098 19:33235764-33235786 TGCCTCCCAGCCCTGCCCCGAGG - Intergenic
1166338134 19:42121516-42121538 GGACTCCAGACCCTGACCAGTGG - Intronic
1166673620 19:44725964-44725986 GGAAACCCAACCCTGACCCCTGG + Intergenic
1167609003 19:50497199-50497221 GGCCCCCCAGCCCTGATCCTGGG - Intergenic
1168292452 19:55363133-55363155 GGCCCACCAGCCTTGACCCGTGG + Exonic
926236172 2:11045880-11045902 AGCCTCCCTTCCCTAACCCGTGG - Intergenic
927173397 2:20388912-20388934 GCACCCCCAACCCAGACCCGGGG + Intergenic
928484747 2:31718413-31718435 GACCTCCCAACCCTCACTGGAGG + Intergenic
934240581 2:90268522-90268544 GGCCTCCTGAGCCTGACCAGTGG + Intergenic
934272611 2:91548237-91548259 GGCCTCCTGAGCCTGACCAGTGG - Intergenic
934854168 2:97718633-97718655 GGGCTGCCATCCATGACCCGAGG - Intronic
935250067 2:101253102-101253124 GGCCTCCGCTCCCGGACCCGGGG - Exonic
938233185 2:129679279-129679301 GGCCTCCCAGCCCAGACTTGGGG + Intergenic
940896036 2:159082285-159082307 TGCCACCCAACCCTGTACCGAGG + Intronic
941260115 2:163287017-163287039 GGCCCACCAACCTTGACCAGAGG - Intergenic
945106840 2:206324148-206324170 GGCCTCTCAACCCAGACCTGGGG + Intergenic
1172790373 20:37500730-37500752 GGCCTCCCCAGCCTGACCTCAGG - Intronic
1173227113 20:41168454-41168476 GGCCTGCCAGCCCTGACTCCTGG + Intronic
1173248103 20:41349948-41349970 GTCCCTCCAACCCTGACCCATGG - Intronic
1173404848 20:42755639-42755661 GGCCTCCCAACTCTACCCCCAGG + Intronic
1175924795 20:62466392-62466414 GGCCTCCCCGCCCTGCCCCGGGG + Intronic
1175953916 20:62598473-62598495 GTCCTCCCACCCCTGTCCCCAGG - Intergenic
1176073483 20:63238305-63238327 GGGGGCCCAACCCTGACCCCCGG + Intronic
1176310078 21:5144830-5144852 GGCCCCCCAACCCCGCCCTGGGG - Intronic
1179584597 21:42366521-42366543 GGCCTCTCATCCCTGACTCGGGG - Exonic
1179617986 21:42593949-42593971 TGGCTCCCACCCCTGAGCCGTGG - Intergenic
1179846978 21:44117202-44117224 GGCCCCCCAACCCCGCCCTGGGG + Intronic
1179884385 21:44307185-44307207 TGCCTCACCACCCAGACCCGGGG + Intronic
1183951336 22:41354733-41354755 TGGCCCCCAACCCTGTCCCGGGG + Intronic
952128580 3:30332752-30332774 GACCTCCCAACCCTCACTCCAGG - Intergenic
958041507 3:88231459-88231481 GGCCTCGCAACCCCCACCCGAGG - Intergenic
959548152 3:107622098-107622120 TTCCTCCCAACCCTAACCCCTGG + Intronic
961455598 3:127022440-127022462 GTCCTCCCACCCCTGCCCGGTGG - Intronic
962271212 3:133979245-133979267 AGCCTCCCATGCCTGACCTGGGG - Intronic
962967732 3:140370133-140370155 GGCCTCTCAACCCTGGCCCTGGG + Intronic
966735297 3:183182320-183182342 GGCATCCCCACCCTCACCTGTGG - Intronic
966767779 3:183478532-183478554 GGCATCCCCACCCTCACCTGTGG + Intergenic
966877567 3:184331884-184331906 GGCCTCCCAGTTCTGAACCGGGG + Intronic
967171085 3:186824425-186824447 GGCGTCCCCACCCTCACCTGTGG + Intergenic
967840867 3:194003637-194003659 GGCCTCCCCTCCTTGCCCCGGGG + Intergenic
969244357 4:5922859-5922881 CTCCTCCCAACCCTGTCCCATGG + Intronic
969329320 4:6463962-6463984 GGCCACCTAACCCTGCCCTGTGG + Intronic
984665372 4:182421832-182421854 GTCCTCCCAACCATGACCTCAGG + Intronic
985229427 4:187799068-187799090 GGCCTCACAACCCTGACTGGTGG - Intergenic
985539917 5:483100-483122 AGCCTCCCACCCCAGCCCCGAGG + Intronic
985542551 5:493652-493674 GGTCTCCCGACCCTGTCCCCAGG + Intronic
985951472 5:3224866-3224888 GGCCTCCCAACCCAGACTGGAGG - Intergenic
994709304 5:103247262-103247284 TACCTCCCAACCCTGTCCCCAGG + Intergenic
995802753 5:116017167-116017189 GGCCTCCCAACTCTGCCTCCAGG - Intronic
1000313019 5:160063040-160063062 GGCCTCCCAAACCTAAACCTGGG - Intronic
1000454892 5:161437324-161437346 GGCCTCATAACTCTGACCAGTGG - Intronic
1000911186 5:167024516-167024538 GCCTTCCCAGCCCTGACCCTTGG - Intergenic
1001436332 5:171702550-171702572 GGCCCCCAGACCCTGCCCCGGGG + Intergenic
1002405108 5:179024177-179024199 GGGCTCCGGACCCTGAACCGAGG - Intronic
1003422941 6:5974350-5974372 GGACTCCCAACCCTGTCCTGGGG + Intergenic
1008921086 6:56844194-56844216 GGCCTCCTCACCCTGTCCCCGGG - Intronic
1013747086 6:113358744-113358766 GCCGTCCCCACCCTGACCAGTGG + Intergenic
1017442653 6:154478153-154478175 GGCCTCCCAAAGCTGGCCCGAGG + Intronic
1017462690 6:154666249-154666271 GACCTCCCCACCCTGTCCTGGGG - Intergenic
1017978047 6:159375245-159375267 GACCTCCCTGCCCTGCCCCGGGG + Intergenic
1019099095 6:169613135-169613157 GCCCTCCCAACTGTGACCTGAGG + Intronic
1019230055 6:170553004-170553026 GGCCTCAGAACCCTGAGCTGAGG - Intronic
1019694703 7:2438788-2438810 GGCCTCCCTACCCAGGCCCAAGG + Intergenic
1023606716 7:41937999-41938021 GGCCTCGAACCCCTGACCCCAGG + Intergenic
1023828818 7:44027855-44027877 GCCCTGCCCACCCTGCCCCGGGG + Intergenic
1028229779 7:88292702-88292724 GAACTACCAACCCTAACCCGTGG + Intronic
1028852534 7:95552725-95552747 GGCCGGCCAACCCTGCCCCCCGG - Intergenic
1029432406 7:100539610-100539632 GGCCTCCCCACCCCGCCCCCGGG - Intronic
1029436960 7:100568908-100568930 GGCCTCTCCTCCCTGACCCTCGG + Intergenic
1029739117 7:102482112-102482134 GCCCTGCCCACCCTGCCCCGGGG + Intergenic
1029757118 7:102581291-102581313 GCCCTGCCCACCCTGCCCCGGGG + Exonic
1029870007 7:103680704-103680726 GGTCTCCCCAGCCTGACCCTGGG + Intronic
1034385080 7:150734325-150734347 GGCCTCCCAACATTGACTTGGGG + Intronic
1034496885 7:151428478-151428500 GGCCTCCCTCCCATGCCCCGAGG - Intergenic
1034535805 7:151724977-151724999 GGCCTCCCAACCCTGGCCTGTGG + Intronic
1035227818 7:157443289-157443311 CGCCCCCCCACCCCGACCCGGGG + Intergenic
1035336240 7:158128794-158128816 GGCCGCCCATCCCTGCCCCGGGG - Intronic
1041910768 8:63086154-63086176 GGCCTCGCACGCCGGACCCGCGG + Intergenic
1043050307 8:75377357-75377379 GGACTCCCAACTCTGGCCTGGGG + Intergenic
1044631582 8:94284817-94284839 GGCCTCCCACCCCTGGCCCCAGG - Intergenic
1049105345 8:140609104-140609126 GGCCTCCCAGCCCTTCCCTGGGG + Intronic
1049571350 8:143371623-143371645 AGCCCCCCAACCCTGACACTGGG - Intronic
1051746181 9:20297370-20297392 GGCCACCTCACCCTGACCCCTGG - Intergenic
1052940109 9:34126337-34126359 GGCCTCTCAACCCTCACCTGCGG + Exonic
1059431716 9:114254484-114254506 GGGCTCCCAGCCCTGACCCCTGG - Intronic
1060050406 9:120374555-120374577 GGCCCCCCAACACTGACTCCAGG - Intergenic
1061496235 9:130976139-130976161 GGCCTCCCAGCCCTGCCCTGTGG - Intergenic
1061955992 9:133961599-133961621 GGCCTCCCAAACCAGCCCCGTGG - Intronic
1062242424 9:135547527-135547549 GGCTTCCCATCCCTAACCCTCGG - Intronic
1062388212 9:136323366-136323388 CGCCTCCCACCGCAGACCCGGGG + Intergenic
1062484055 9:136765344-136765366 GGACTCCCGCCCCTGACCAGAGG - Intronic
1062528080 9:136986207-136986229 GCGCTCCCAACTCTGACCCAGGG + Intronic
1187274133 X:17803810-17803832 TGCCTCCCAACTCTGTCCCAAGG - Intronic
1187789811 X:22937835-22937857 GAGCACCCAACCCTGACCCTTGG - Intergenic
1190509453 X:51161400-51161422 GGCCTCCCATGCCTGACCAAAGG + Intergenic
1190911106 X:54773569-54773591 GGCCTCAGAACTCTGACCCATGG + Intronic
1190920101 X:54842632-54842654 GGCCTCAAAACTCTGACCCATGG - Intergenic
1191942960 X:66499764-66499786 GGACTCCCAACCCTGTCCCAGGG + Intergenic
1194078220 X:89424016-89424038 GGCCTCCCTACCCCAACCCATGG - Intergenic
1198190444 X:134299357-134299379 GGCCTCACAACTCTGACTGGTGG - Intergenic
1198254811 X:134915314-134915336 CGCCTCCCACCCCCGAGCCGCGG - Intergenic
1199976164 X:152896079-152896101 GGCCCCCCACCCCTGACTCAGGG + Intergenic
1200430867 Y:3079562-3079584 GGCCTCCCTACCCCAACCCATGG - Intergenic