ID: 900166584

View in Genome Browser
Species Human (GRCh38)
Location 1:1246464-1246486
Sequence TCGCGGGGCAGCTTCGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 85}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900166584_900166595 10 Left 900166584 1:1246464-1246486 CCAGCTCCGAAGCTGCCCCGCGA 0: 1
1: 0
2: 1
3: 4
4: 85
Right 900166595 1:1246497-1246519 GCGTCCCGGCCGCGTACCTTGGG 0: 1
1: 0
2: 0
3: 2
4: 17
900166584_900166602 19 Left 900166584 1:1246464-1246486 CCAGCTCCGAAGCTGCCCCGCGA 0: 1
1: 0
2: 1
3: 4
4: 85
Right 900166602 1:1246506-1246528 CCGCGTACCTTGGGGGCCTCGGG 0: 1
1: 0
2: 0
3: 5
4: 62
900166584_900166597 12 Left 900166584 1:1246464-1246486 CCAGCTCCGAAGCTGCCCCGCGA 0: 1
1: 0
2: 1
3: 4
4: 85
Right 900166597 1:1246499-1246521 GTCCCGGCCGCGTACCTTGGGGG 0: 1
1: 0
2: 0
3: 4
4: 41
900166584_900166591 -4 Left 900166584 1:1246464-1246486 CCAGCTCCGAAGCTGCCCCGCGA 0: 1
1: 0
2: 1
3: 4
4: 85
Right 900166591 1:1246483-1246505 GCGAGGGCCCACGTGCGTCCCGG 0: 1
1: 0
2: 0
3: 5
4: 73
900166584_900166600 18 Left 900166584 1:1246464-1246486 CCAGCTCCGAAGCTGCCCCGCGA 0: 1
1: 0
2: 1
3: 4
4: 85
Right 900166600 1:1246505-1246527 GCCGCGTACCTTGGGGGCCTCGG 0: 1
1: 0
2: 1
3: 6
4: 58
900166584_900166596 11 Left 900166584 1:1246464-1246486 CCAGCTCCGAAGCTGCCCCGCGA 0: 1
1: 0
2: 1
3: 4
4: 85
Right 900166596 1:1246498-1246520 CGTCCCGGCCGCGTACCTTGGGG 0: 1
1: 0
2: 0
3: 1
4: 31
900166584_900166594 9 Left 900166584 1:1246464-1246486 CCAGCTCCGAAGCTGCCCCGCGA 0: 1
1: 0
2: 1
3: 4
4: 85
Right 900166594 1:1246496-1246518 TGCGTCCCGGCCGCGTACCTTGG 0: 1
1: 0
2: 1
3: 1
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900166584 Original CRISPR TCGCGGGGCAGCTTCGGAGC TGG (reversed) Intronic