ID: 900166635

View in Genome Browser
Species Human (GRCh38)
Location 1:1246627-1246649
Sequence GCCGCAGCTCGTGCTCCTCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 108}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900166635_900166641 -1 Left 900166635 1:1246627-1246649 CCCCGAGGAGCACGAGCTGCGGC 0: 1
1: 0
2: 2
3: 10
4: 108
Right 900166641 1:1246649-1246671 CCCGAGGAGGACCACGACCGCGG 0: 1
1: 0
2: 0
3: 1
4: 59
900166635_900166643 5 Left 900166635 1:1246627-1246649 CCCCGAGGAGCACGAGCTGCGGC 0: 1
1: 0
2: 2
3: 10
4: 108
Right 900166643 1:1246655-1246677 GAGGACCACGACCGCGGCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 117
900166635_900166646 20 Left 900166635 1:1246627-1246649 CCCCGAGGAGCACGAGCTGCGGC 0: 1
1: 0
2: 2
3: 10
4: 108
Right 900166646 1:1246670-1246692 GGCCCAGGCCCAGCGCCGCATGG 0: 1
1: 0
2: 2
3: 27
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900166635 Original CRISPR GCCGCAGCTCGTGCTCCTCG GGG (reversed) Exonic
900166635 1:1246627-1246649 GCCGCAGCTCGTGCTCCTCGGGG - Exonic
900466014 1:2825841-2825863 GCCGCAGGGCTTGCTCCTCCAGG + Intergenic
901641091 1:10693615-10693637 CCCCCAGCTCCTGCTCCTCTCGG + Intronic
902923174 1:19679317-19679339 GCCGCAGCTCGGGCTCCGCGGGG - Exonic
903628249 1:24746032-24746054 GCCGCAGTTCGGGCTCCGGGCGG - Intronic
904775095 1:32901447-32901469 CCCGCGGCTCGTGCCCCTCCCGG + Intergenic
914950344 1:152108524-152108546 GGCGCAGCTGTTCCTCCTCGCGG + Exonic
914950486 1:152109685-152109707 GCTGCAGCTCCTCTTCCTCGCGG + Exonic
922901455 1:229140050-229140072 GCCGCACCCCTTGCTCCTTGTGG + Intergenic
1072891596 10:99329696-99329718 TCCGCGGCTCGTGTTCATCGAGG + Exonic
1076312020 10:129515265-129515287 GCCGCAGCTGCTGCTCCTGACGG - Intronic
1077063342 11:627101-627123 GCTGCTGCTGCTGCTCCTCGGGG - Exonic
1077632358 11:3819357-3819379 GCAGTAGCTCATGCTCCTGGGGG + Intronic
1078105320 11:8354727-8354749 GCCCCAGCTGCTGCTCCTCAGGG - Intergenic
1081794621 11:45810969-45810991 GCCCCTGCTCCTGCTGCTCGGGG + Exonic
1084681240 11:70667680-70667702 GCAGCAGCACCTGATCCTCGAGG + Intronic
1085045576 11:73351076-73351098 GCTGCTGCTCCTGCTCCTTGTGG + Intronic
1101144747 12:101830699-101830721 GCGGCGGCTCAGGCTCCTCGGGG - Exonic
1101910454 12:108857316-108857338 GCGGCTGCGCGGGCTCCTCGGGG - Intronic
1104049658 12:125186820-125186842 GCCGCCGCTCGGGCTCCTGCTGG + Intronic
1104823958 12:131695212-131695234 TCCCCAGCTCGTGCTCCTGCAGG + Intergenic
1105578036 13:21671013-21671035 GCCGCAGCCCGGGCTCCCCGCGG - Intergenic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1111950758 13:94707436-94707458 CCCGCAACTCGTCCGCCTCGAGG - Intergenic
1127103153 15:55587945-55587967 GCGGCGGCTCCTCCTCCTCGCGG + Intronic
1130115682 15:81002439-81002461 GGCGCGGCCCGTGCTCTTCGAGG + Exonic
1130891187 15:88135356-88135378 GGCGCAGCTCAGGCTCCTCCAGG + Exonic
1132516504 16:368524-368546 CCCGCCGCTCGGGGTCCTCGGGG + Exonic
1132557993 16:580851-580873 GCCACAGCTCCGGCTCCTGGTGG + Exonic
1133225001 16:4336915-4336937 GCAGGAGCTCTTGCTGCTCGTGG - Exonic
1133233441 16:4377028-4377050 GGCGCTGCTCGTGGTGCTCGTGG - Intronic
1134180349 16:12042928-12042950 GCTGCAGCTCGTGCTTGTTGAGG - Exonic
1136604724 16:31325567-31325589 GCTGCAGCTGGTGCTCTTCAAGG - Exonic
1139488168 16:67271096-67271118 GCTGCAGCTCCTGCTGCTGGGGG - Exonic
1140094090 16:71860368-71860390 GCCTCACCTCCCGCTCCTCGGGG + Exonic
1140481992 16:75266877-75266899 GCCGCAGCCCGGGCTCATGGCGG + Intronic
1140727849 16:77830048-77830070 GGCGCATCTCATGTTCCTCGAGG - Intronic
1141184728 16:81779254-81779276 GCCGCGCCACGTGATCCTCGGGG - Exonic
1142128388 16:88421308-88421330 GGAGCCGCTCGTGCTCCTCCGGG + Intergenic
1143473412 17:7190326-7190348 CCTGCAGCGGGTGCTCCTCGAGG + Exonic
1143717551 17:8785835-8785857 GCAGCAGCACCTGATCCTCGGGG + Intergenic
1145018798 17:19414787-19414809 GCAGCAGCTCCTGCACCTTGGGG - Exonic
1145243565 17:21253186-21253208 GCCGGCGGTCGTGCTCCACGCGG + Exonic
1149726495 17:58899702-58899724 ACTACAGCTCATGCTCCTCGAGG + Intronic
1149994599 17:61400044-61400066 GGCGCAGCAGCTGCTCCTCGGGG - Exonic
1151732224 17:75918220-75918242 GCCGCTGCAGCTGCTCCTCGTGG + Exonic
1152196465 17:78921297-78921319 GCTGGAGCTGGAGCTCCTCGGGG + Intronic
1154954435 18:21241554-21241576 GCCGGAGGGCGTGCTCCTCCGGG + Intergenic
1155720943 18:29011081-29011103 GCAGCAGCTCCTGCTTCTCCTGG - Intergenic
1157281148 18:46347130-46347152 GCTACAGCTCTTCCTCCTCGGGG - Intronic
1157713224 18:49864212-49864234 TGCGCACCTCGAGCTCCTCGTGG + Exonic
1162471191 19:10872527-10872549 GCCGCAGGGTGAGCTCCTCGTGG + Intronic
1165342844 19:35224914-35224936 GCTGAAGCTGGTGCTGCTCGTGG - Exonic
1166986141 19:46660926-46660948 GCCGCAGCGCCTGCTGCACGCGG + Exonic
1167078032 19:47260735-47260757 CCCCCAGCTCCTCCTCCTCGAGG - Exonic
926111713 2:10188108-10188130 GCTGCAGCTCGGGGTCCTCAGGG - Intronic
927706093 2:25297364-25297386 GGCGCATCCCGTGCCCCTCGTGG - Intronic
932567366 2:72918194-72918216 GCCCGAGCTCGTGTTCCCCGAGG + Exonic
938152847 2:128901769-128901791 GCCGGAGCTCGTGGTGCTCTGGG + Intergenic
938319834 2:130355651-130355673 GCCCCAGCTCGGACTCCGCGCGG + Intergenic
942713612 2:178865862-178865884 GCAGCAGCTGGAGCTCCTTGAGG - Exonic
947795146 2:232889909-232889931 CCCTCAGCTCATGCTCCTCAGGG + Intronic
948498061 2:238367562-238367584 GTGACAGCTCTTGCTCCTCGTGG + Intronic
949022615 2:241750015-241750037 GCCAGTCCTCGTGCTCCTCGTGG + Intronic
1169664527 20:8019514-8019536 GCGGCAGCGCGGCCTCCTCGGGG + Exonic
1171512483 20:25696642-25696664 GCCGTAGCGCGCGCTCCTCCAGG - Intronic
1171771222 20:29324779-29324801 TCCGCAGCTCGCGCTCATGGAGG + Intergenic
1178922457 21:36747707-36747729 GCCGCAGCTCGGGAAGCTCGGGG - Exonic
1178922466 21:36747735-36747757 GGCCCAGCGCGGGCTCCTCGCGG - Exonic
1185347010 22:50314863-50314885 GTGGGAGCTCATGCTCCTCGGGG - Exonic
949916420 3:8968076-8968098 GCCCCAGCTTGTGATCCTCCTGG + Intergenic
950097450 3:10338223-10338245 GCCGCAGCTCCCGCTCCGCGTGG + Exonic
950428151 3:12935743-12935765 GCCGCAACTCAGGCTCCTCCCGG + Exonic
950747185 3:15099798-15099820 TCTGCAGCTCTTGCTCCTAGAGG - Intergenic
963335586 3:143971354-143971376 CCCTCAGCTCGTGCTCCTCGCGG - Intergenic
967270459 3:187728463-187728485 GCCGCAGGACGTGCACTTCGGGG + Exonic
967919417 3:194603337-194603359 GATGTAGCTGGTGCTCCTCGGGG + Intronic
975409993 4:74038533-74038555 GCTGCTGCTCCTGCTCCTGGTGG - Exonic
975415381 4:74099042-74099064 GCTGCTGCTCCTGCTCCTGGTGG - Exonic
982198527 4:152937766-152937788 GACGCAGCTGGGGCTCCGCGCGG + Intronic
982202565 4:152974686-152974708 GCCTCAGCTCCTGCGCCTCCCGG - Exonic
992102352 5:73419676-73419698 GCCGCAGCCGGCGCTCCTCTGGG + Intergenic
995854247 5:116575829-116575851 GCCGCGGCTCTTGCTCCCCAAGG + Intergenic
998279117 5:140787862-140787884 GCAGCAGCTCCAGCTCCTCGTGG - Exonic
998280534 5:140802769-140802791 GCAGCAGCTCTAGCTCCTCGTGG - Exonic
998281160 5:140808759-140808781 GCAGCAGCTCTAGCTCCTCGTGG - Exonic
998282927 5:140829663-140829685 GCAGCAGCTCTAGCTCCTCGTGG - Exonic
998283551 5:140835955-140835977 GCAACAGCTCCAGCTCCTCGTGG - Exonic
998284235 5:140842893-140842915 GCAGCAGCTCTAGCTCCTCGTGG - Exonic
998284913 5:140850067-140850089 GTAGCAGCTCCAGCTCCTCGTGG - Exonic
998285610 5:140857617-140857639 GTAGCAGCTCCAGCTCCTCGTGG - Exonic
998286830 5:140870672-140870694 GTAGCAGCTCCAGCTCCTCGTGG - Exonic
998287467 5:140877044-140877066 GCAGCAGCTCCAGCTCCTCGTGG - Exonic
998288137 5:140883840-140883862 GCAACAGCTCCAGCTCCTCGTGG - Exonic
998399222 5:141839478-141839500 GCCCCAGCTCCAGCTCCTCAGGG - Intergenic
1001476954 5:172057363-172057385 GCAGCAGCTCGTGCCGCTGGAGG + Exonic
1002033388 5:176447436-176447458 GCCGCCGCCCCTTCTCCTCGAGG - Intergenic
1002691440 5:181053252-181053274 GCCGCTGCTGTTGGTCCTCGCGG + Exonic
1015366531 6:132402158-132402180 GCCGCAGAGCTTGCTCCTCACGG + Intergenic
1018669492 6:166167435-166167457 GCCACAGCTCGCTCTCCTCCAGG + Exonic
1019475327 7:1241541-1241563 GCCACAGCCCCGGCTCCTCGTGG - Intergenic
1025651673 7:63475570-63475592 GCCCCAGCGGGTGCTCCTTGGGG - Intergenic
1026806682 7:73433648-73433670 GCCCCACCCCGTGCTCCGCGTGG + Intergenic
1029169342 7:98619690-98619712 GCCGCTGCTGGAGCACCTCGCGG - Exonic
1029489328 7:100861793-100861815 GCCCCAGCTGCTGCTCCTGGTGG + Exonic
1031051990 7:116953900-116953922 GGCGCAGCTCTTCCTCCGCGGGG - Exonic
1033288613 7:140062766-140062788 GCCGCAGCTCGGGCAACTCCAGG + Exonic
1034351120 7:150415332-150415354 GACGCTGCTCCTGCTCCTCTAGG + Intergenic
1042524824 8:69753263-69753285 ACCGCAGCTCCTGCCCCTCTTGG - Intronic
1049271555 8:141698783-141698805 GCCTCTGCTCCTGCCCCTCGTGG - Intergenic
1050455752 9:5832730-5832752 GCAGCAGCTCGTGCTACGCGGGG - Exonic
1053056586 9:34996560-34996582 CCCGCAGCTCGTGCACCACTGGG - Exonic
1053428440 9:38026327-38026349 GCCCGATCTCGTGCTCCTCCAGG - Intronic
1061327774 9:129874653-129874675 GGCGCAGGTCGAGCCCCTCGAGG - Exonic
1061713878 9:132506476-132506498 GCAGCAGCTGGCGCTCCTGGTGG + Intronic
1062384308 9:136303068-136303090 GCCGCCTCTCGTGCTCTTCGGGG - Exonic
1203364919 Un_KI270442v1:248559-248581 TCCGCAGCTCGTGCCCATGGAGG + Intergenic
1202161130 Y:21938127-21938149 GCCCCACCACGTGCCCCTCGGGG + Intergenic
1202230226 Y:22648246-22648268 GCCCCACCACGTGCCCCTCGGGG - Intergenic
1202312930 Y:23547919-23547941 GCCCCACCACGTGCCCCTCGGGG + Intergenic
1202557872 Y:26122675-26122697 GCCCCACCACGTGCCCCTCGGGG - Intergenic