ID: 900167075

View in Genome Browser
Species Human (GRCh38)
Location 1:1248105-1248127
Sequence GAGGCTGGACTGAGGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1102
Summary {0: 1, 1: 13, 2: 16, 3: 124, 4: 948}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900167065_900167075 6 Left 900167065 1:1248076-1248098 CCTACAGGCAGGAAAGTGGGCAG 0: 1
1: 0
2: 11
3: 46
4: 303
Right 900167075 1:1248105-1248127 GAGGCTGGACTGAGGGAGGCTGG 0: 1
1: 13
2: 16
3: 124
4: 948
900167062_900167075 16 Left 900167062 1:1248066-1248088 CCAACTCTGACCTACAGGCAGGA 0: 1
1: 2
2: 5
3: 26
4: 301
Right 900167075 1:1248105-1248127 GAGGCTGGACTGAGGGAGGCTGG 0: 1
1: 13
2: 16
3: 124
4: 948

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900167075 Original CRISPR GAGGCTGGACTGAGGGAGGC TGG Intergenic
900123242 1:1058539-1058561 GAGGCTGGACAGAGATGGGCAGG + Intergenic
900124555 1:1063745-1063767 GAAGGAGGCCTGAGGGAGGCAGG - Intergenic
900167075 1:1248105-1248127 GAGGCTGGACTGAGGGAGGCTGG + Intergenic
900167092 1:1248171-1248193 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167114 1:1248237-1248259 GAGGCTAGACCGAGGGAGGCTGG + Intergenic
900167135 1:1248302-1248324 GAGGCTGTACCGAGGGAGGCTGG + Intergenic
900167158 1:1248368-1248390 GAGGCTGGACCAAGGGAGGCTGG + Intergenic
900167176 1:1248434-1248456 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167197 1:1248500-1248522 GAGGCTAGACCGAGGGAGGCTGG + Intergenic
900167218 1:1248566-1248588 GAGGCTGGACCAAGGGAGGCTGG + Intergenic
900167236 1:1248632-1248654 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167258 1:1248698-1248720 GAGGCTGGAGCAAGGGAGGCTGG + Intergenic
900167280 1:1248764-1248786 GAGGCTAGACCGAGGGAGGCTGG + Intergenic
900167301 1:1248830-1248852 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167320 1:1248896-1248918 GAGGCTGGAGCGAGGGAGGCTGG + Intergenic
900167343 1:1248962-1248984 GAGGCTGGAGCGAGGGAGGCTGG + Intergenic
900167366 1:1249028-1249050 GAGGCTGGAGCGAGGGAGGCTGG + Intergenic
900167389 1:1249094-1249116 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167413 1:1249160-1249182 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167437 1:1249226-1249248 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167461 1:1249292-1249314 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167485 1:1249358-1249380 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167509 1:1249424-1249446 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167533 1:1249490-1249512 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167557 1:1249556-1249578 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167580 1:1249622-1249644 GAGGCTAGACCGAGGGAGGCTGG + Intergenic
900329198 1:2125705-2125727 GAGGCTGGAGTGTGGGCGGAGGG + Intronic
900999516 1:6141800-6141822 GAGGCTGGAAGGAGGAAGGAAGG + Intronic
901084187 1:6600847-6600869 GAGGCTGGACTCAGAGCAGCAGG + Intronic
901115528 1:6840805-6840827 GAGGCAGTGCTGAGGCAGGCAGG + Intronic
901500781 1:9651708-9651730 GAGCCTCGAGGGAGGGAGGCGGG - Intergenic
901653133 1:10754542-10754564 GGGGCAGGACTGAGGAAGCCTGG - Intronic
901752847 1:11422108-11422130 GAGGCAGGAGTGAGGAAGGCAGG - Intergenic
901933156 1:12609785-12609807 GAGGAAGAACTGAGGGAGACAGG - Intronic
902490625 1:16778250-16778272 GAGAGTGGACTGAGGGATGAGGG + Intronic
902651217 1:17838862-17838884 GAGGCGGGACTGGGAGAGGCAGG - Intergenic
902704648 1:18196200-18196222 GAGGCTGGAGGCAGGGAGGCCGG + Intronic
902984720 1:20148569-20148591 GGGGCTGGGCTGGGGGAGTCAGG - Exonic
903646724 1:24900675-24900697 GAGGCTGGGCGGAGGTGGGCAGG - Exonic
903663005 1:24990094-24990116 GAGGGAAGACTGTGGGAGGCAGG + Intergenic
903670241 1:25031152-25031174 GAGGCTGGAGAGATGGAGACTGG + Intergenic
903670262 1:25031220-25031242 GAGGCTGGAGGAATGGAGGCTGG + Intergenic
903670313 1:25031412-25031434 GAGGCTGGAAGGATAGAGGCTGG + Intergenic
903670326 1:25031473-25031495 GAGGCTGGAGGGATGGAGGCTGG + Intergenic
903699175 1:25233405-25233427 GAGGCTGGCCTCAGGGAAGAAGG - Intergenic
903761299 1:25700731-25700753 GAGGCTGGGAGGAGGTAGGCTGG + Intronic
903778665 1:25808584-25808606 GAGGCCGGACAGGGCGAGGCGGG - Exonic
903928973 1:26851281-26851303 GAGGCAGGGCTGAGGGAGCCTGG + Intronic
903999599 1:27331323-27331345 GAGGCTGGACTGAAGGGGTGTGG + Intronic
904026072 1:27504591-27504613 GAGGCTTTACAGTGGGAGGCCGG + Intergenic
904260091 1:29283268-29283290 GAGGTGGGGCTGTGGGAGGCGGG - Intronic
904442746 1:30542213-30542235 GAGGCTGGGCTGTGGGTGGGGGG + Intergenic
904597774 1:31657531-31657553 GAGCCTGCAAGGAGGGAGGCAGG + Intronic
904890596 1:33776671-33776693 GAGGATTGACTGAGTGAGGGGGG + Intronic
904919958 1:33999291-33999313 GAGGCAGGGCTGTGGCAGGCTGG + Intronic
905412933 1:37784481-37784503 GAGGGTGGCCTGAGGGAGAGAGG - Intergenic
905440878 1:37996148-37996170 GAGGCGGGAATGAGCGAGGGGGG - Intergenic
905651039 1:39657164-39657186 GAGGCTGGTCCCAGGGAGGAAGG - Intergenic
905790894 1:40788791-40788813 GTGGCTGCACTGGGTGAGGCTGG - Intronic
906041297 1:42789653-42789675 CTGGCTGGACTAAGGGAGACAGG - Intronic
906152727 1:43597556-43597578 GAGGCAGGTCAGAGGGAGTCAGG + Intronic
906530378 1:46520349-46520371 GGGGCTGGGCTGAGGCAGGCTGG + Intergenic
906608188 1:47185344-47185366 GAGGCTGAACTGAGGGCGTCTGG - Intronic
906688718 1:47778922-47778944 CAGCCTGGACTGTGGGGGGCTGG - Intronic
906689684 1:47784414-47784436 GGGGCTGGGCAGAGGGAGGAGGG + Intronic
906695661 1:47821665-47821687 TGGGCTGGACTGAGGCAGGCAGG - Intronic
906950648 1:50332688-50332710 GAGGATGGATTGGGTGAGGCAGG + Intergenic
907050404 1:51326241-51326263 GAGGCTGGGCGGAAGGAGGATGG + Intronic
908495275 1:64688634-64688656 GAGGCTGGACAGAAGGAAGGTGG - Intronic
909060670 1:70875614-70875636 GAGGCTGGAGGGTGGGAGGAAGG - Intronic
909729608 1:78875564-78875586 GAGGCTGGGATGAGGGGTGCAGG - Intergenic
909762124 1:79303076-79303098 GAGGCTAGAATGAGGGAACCAGG - Intergenic
910813325 1:91260366-91260388 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
911429214 1:97762005-97762027 GAGGGTGGACAGTGGGAGGAGGG + Intronic
912151207 1:106860788-106860810 GAGGAGGGACGGAGGGAGGGAGG + Intergenic
912798073 1:112704915-112704937 TGAGCTGGACTGAGGGAGGAAGG - Intronic
913243452 1:116850934-116850956 GAGGCAGGAATCAGAGAGGCGGG - Intergenic
913323935 1:117610026-117610048 GAGGCTGGTGTCAGGGAGGGTGG - Intronic
913535576 1:119768947-119768969 GAGGCGGGGCTTAGGGAGGCAGG - Intergenic
914828969 1:151156913-151156935 GGGGCAGGGCTGAGGGATGCAGG + Intronic
915081326 1:153354660-153354682 GAGGTTGGACTGAGGGATGGTGG - Intergenic
915286429 1:154856236-154856258 GAGGCAGCAGGGAGGGAGGCTGG + Intronic
915307600 1:154989608-154989630 GAGGCTGTACTGAGCCAGGGAGG - Exonic
915471761 1:156129940-156129962 GAGGCAGGAGGGAGGGAGGCAGG + Intronic
915553407 1:156647803-156647825 GAGGCTGGTCTGAGGAGGGGAGG + Intronic
915915674 1:159939151-159939173 GAGGCTGGAGGCAGGGAGACTGG - Intronic
916104327 1:161419885-161419907 GATTCTGGATTGAGGAAGGCGGG + Intergenic
916344749 1:163775276-163775298 GGGGCTGGGGAGAGGGAGGCTGG + Intergenic
916556239 1:165896471-165896493 GGGGCTGGACTGACGCAGCCGGG - Intronic
916656079 1:166876331-166876353 GGGGCGGGACTGACGGCGGCCGG - Intergenic
916742443 1:167658181-167658203 GAGGCTGGACACAGGGAGGGGGG - Intronic
916873466 1:168942244-168942266 GAGGCTAATCTGAGGGAGGCTGG - Intergenic
918071364 1:181135292-181135314 GAGGCTGTAATGGGGGTGGCTGG + Intergenic
918158892 1:181878648-181878670 GAGGGTGGAGTGTGGGAGGAGGG - Intergenic
918720784 1:187850144-187850166 GAGGCTGGGCTGGCGAAGGCCGG + Intergenic
919739398 1:200973098-200973120 GAGGCTGGGCTGGGAGAAGCGGG + Intronic
919778209 1:201207510-201207532 GTGGCTGGACTGACGGAGTCTGG + Exonic
919844069 1:201629845-201629867 GGTGCTGGAATTAGGGAGGCAGG + Intronic
919986915 1:202681834-202681856 GAGGCAGGACTCAGGGTGCCTGG + Intronic
920043387 1:203118079-203118101 GAGGCTGGGGGGAGGGAGGTGGG - Intronic
921225456 1:213015307-213015329 GAGGCTGGGTTGGGGGAAGCAGG + Intronic
921423443 1:214975095-214975117 GAGGATGGACTGGGTGAAGCAGG - Intergenic
921940180 1:220830938-220830960 CAAGCTGGAGAGAGGGAGGCTGG - Intergenic
922153888 1:223026844-223026866 GAGGCTGGAACGAGGGGTGCAGG + Intergenic
922698402 1:227743445-227743467 GAGGCGGGGCTCAGGGAGGCTGG - Intronic
922758330 1:228109070-228109092 GAGTCGGGAGGGAGGGAGGCAGG - Intronic
923002293 1:230017310-230017332 GAGGCTGGAGGGCGGGAGGGGGG - Intergenic
923013420 1:230107008-230107030 GGGGCTGGACAGAAGGAAGCTGG + Intronic
923075382 1:230604491-230604513 GAGGCTGGGATGAGGGGTGCAGG - Intergenic
923126595 1:231039666-231039688 GGGGCCGGACTGAGGGCGCCGGG + Intronic
923329592 1:232910373-232910395 AAGGATGGACTCAGGGAGACTGG - Intergenic
923529818 1:234804285-234804307 GAGAGTGGACTGAGGGATGAGGG - Intergenic
923620843 1:235577854-235577876 GAGGAAGGAAAGAGGGAGGCTGG - Intronic
924212545 1:241785808-241785830 GAGGCTGAACTCTGGGATGCAGG + Intronic
924852626 1:247845630-247845652 AAGGCTGCACTGAGGGAGGCTGG - Intergenic
1063561807 10:7135191-7135213 GAGGGTGGAGGGAGGGAGGAGGG - Intergenic
1064304181 10:14150540-14150562 GAGGCAGGATTGGGGGAGGCTGG - Intronic
1064962122 10:20976773-20976795 GAGGAGGGAGGGAGGGAGGCAGG + Intronic
1065177783 10:23095705-23095727 GGGCCGGGACTGGGGGAGGCAGG + Exonic
1065478814 10:26171508-26171530 GAGGTTGGCCTGAGGGATTCAGG - Intronic
1065549962 10:26860564-26860586 GTGGCCGGGCTGAGGGAGTCGGG - Intronic
1066184572 10:32996936-32996958 GAGGCAGGAGAGAGGGAGGGAGG + Intronic
1067147593 10:43704417-43704439 TTGGCTGGGCTGAGGAAGGCAGG - Intergenic
1067225401 10:44372970-44372992 GAGACTGGGCTGAGGGAGCCTGG - Intronic
1067251701 10:44592434-44592456 GAAGCTGGTCTCAGGGAAGCAGG - Intergenic
1067332353 10:45333919-45333941 GAGGGTGAACTGAGGCAGGGTGG - Intergenic
1067416065 10:46104141-46104163 GTTACTGGACTGTGGGAGGCAGG - Intergenic
1067744927 10:48928535-48928557 AAGCCTGCACTCAGGGAGGCAGG - Intronic
1067781698 10:49212425-49212447 GAGGCAGGAGTGAGGGAGTAGGG - Intergenic
1067783135 10:49223451-49223473 GAGGCTGGAGACAGGGTGGCTGG + Intergenic
1068092851 10:52454359-52454381 GAGGCTATACTGAGGAAGGGAGG + Intergenic
1068360943 10:55974470-55974492 GAGGCTGGGATGAGGGGTGCAGG - Intergenic
1068431688 10:56941422-56941444 GAGGATGGAGGGAGGGAGGGAGG + Intergenic
1068573683 10:58659558-58659580 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1068850354 10:61731749-61731771 GAGGGAGGACAGAGGGAGGAAGG + Intronic
1069612191 10:69781589-69781611 GAGGCTGCAGGGAGGGAGGCAGG + Intergenic
1069618657 10:69822612-69822634 GTGGGTGGACTGATGGATGCGGG - Intronic
1069964381 10:72101985-72102007 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1070152061 10:73811311-73811333 GAGGCGGTTCTGAGGGAGGCCGG + Intronic
1070652207 10:78245589-78245611 GAGGCTGGAAAGAGGGAGACAGG + Intergenic
1071227143 10:83543821-83543843 GAGACTGGGGTGAGGGAGGGAGG - Intergenic
1072636498 10:97181767-97181789 GAGGATGGAGGGAGGCAGGCAGG - Intronic
1072750395 10:97974726-97974748 GAAGCTGGACTCAGGGAGCCAGG + Intronic
1072780700 10:98249364-98249386 GAGGGTGGAAGGAGAGAGGCCGG + Intronic
1072790819 10:98316429-98316451 CAGGCTGAGCTGAGGGAAGCAGG + Intergenic
1073412070 10:103350727-103350749 GAGGCTGGAGGGAGGCCGGCAGG - Exonic
1073876343 10:107926451-107926473 GAGGGTGGACGGTGGGAGGAGGG + Intergenic
1074275708 10:111999944-111999966 GAAGCAGGAATGAGGGAGGAGGG + Intergenic
1074480932 10:113820085-113820107 GATGAAGGACTGAAGGAGGCTGG - Intergenic
1075544294 10:123342870-123342892 GAGGCTGGAAAGAAGGAGGCAGG + Intergenic
1075724946 10:124606348-124606370 GGGGCAGGACTGAGCGGGGCAGG - Intronic
1075795544 10:125117055-125117077 GAGACTGCACTGAGGGTGGCTGG - Intronic
1076313987 10:129527918-129527940 GAGGAGAGACTGAGGCAGGCAGG - Intronic
1076316662 10:129546642-129546664 GAGGCTGGAAGGAGAGAGGCGGG + Intronic
1076425516 10:130364679-130364701 GAGGCTGGAATGATGGAGGAAGG + Intergenic
1076649426 10:131977596-131977618 GGGGCTGGATGGAGGGAGGTGGG - Intronic
1076702793 10:132282940-132282962 GAGGCTGGGGTCGGGGAGGCTGG + Intronic
1076963483 10:133786325-133786347 GTCGCTGGGCTGAGGGTGGCGGG - Intergenic
1076988130 11:253973-253995 GAGGCTGGACTTAGGGAGGGTGG - Intergenic
1077054495 11:584352-584374 GGGGCTGGAGTGAAGGTGGCGGG + Intronic
1077274622 11:1698287-1698309 GAGGGTGGACGGTGGGAGGAGGG - Intergenic
1077280515 11:1742952-1742974 GAGGATGGACAGATGGAGGATGG + Intronic
1077280591 11:1743354-1743376 GAGGATGGACAGATGGAGGATGG + Intronic
1077281109 11:1746688-1746710 GAGGCTGGGCAGAGGCTGGCTGG - Intronic
1077316183 11:1920374-1920396 GGGGCTGGACTGGGGCAGGACGG + Intronic
1077339385 11:2019215-2019237 GAGGCTGCACCTGGGGAGGCTGG + Intergenic
1077563056 11:3277401-3277423 GAGGCTGTAGTGACAGAGGCTGG + Intergenic
1077568947 11:3323217-3323239 GAGGCTGTAGTGACAGAGGCTGG + Intergenic
1078005074 11:7526532-7526554 TAGGCTGGAGTGAGGGTGGGAGG + Intronic
1078182286 11:9022168-9022190 GAGGCTCGTCTGAGGGAAGAGGG - Intronic
1078375043 11:10786349-10786371 GAGGCAGGGCTGAAGCAGGCTGG + Intergenic
1078663266 11:13304179-13304201 GAGAGTGGACTGAGGGAGCAAGG + Intronic
1078665900 11:13324922-13324944 GGGGCTGGACTGTAGGAGGGAGG + Intronic
1078737750 11:14036097-14036119 GAGGCTAGAGGCAGGGAGGCAGG + Intronic
1079009167 11:16814401-16814423 CAGGCTGTACAGAGGTAGGCAGG - Intronic
1079097718 11:17521621-17521643 GATGCTGGGCTGTGGGAGGAGGG + Intronic
1079115577 11:17638602-17638624 GAGGAGGGATTGAGGGAGCCCGG + Intronic
1079803036 11:24895504-24895526 GAGTGGGGAGTGAGGGAGGCAGG - Intronic
1080752642 11:35165126-35165148 GGGGCTGGAGTGAGGGTGGAAGG - Intronic
1080791427 11:35525626-35525648 GAGGAGGGACCCAGGGAGGCCGG + Intronic
1081753871 11:45531103-45531125 CAGGCTGGAGTGAGAGAGGAGGG + Intergenic
1081862472 11:46341200-46341222 AAGGCTGGGCAGAGGGAGGGAGG - Intronic
1081994540 11:47355107-47355129 GAGGCAGGACTGTGGCGGGCCGG - Exonic
1082004786 11:47413554-47413576 GAGGCAGGGCTGAGTGGGGCTGG - Intronic
1082131837 11:48499719-48499741 GAGGCAGGAAAGAGGGAGGTGGG - Intergenic
1082245240 11:49913844-49913866 GAGGCAGGAGAGAGGGAGGTGGG + Intergenic
1082711533 11:56559221-56559243 GAGGTTGGGAAGAGGGAGGCAGG - Intergenic
1083252967 11:61480296-61480318 GAGGCTGGACTGAGCTATGATGG + Intronic
1083255969 11:61495733-61495755 GAAGCTGGACTTAGGGACGGGGG - Intergenic
1083272548 11:61579731-61579753 GAGGCTGGCAGGAGGGAGCCTGG + Intronic
1083305187 11:61758317-61758339 GAGAGGGGAGTGAGGGAGGCCGG - Intronic
1083362372 11:62119576-62119598 GAGACTGGAGTGTGGGAGGAGGG - Intergenic
1083720817 11:64602713-64602735 GAGGCTGGGTTGGGAGAGGCTGG - Intergenic
1083812732 11:65114835-65114857 GAGGCTGGACTGGACGAGGGTGG + Intronic
1084006568 11:66326429-66326451 GAGGGTGGAGGGAGGGAGGGAGG + Intergenic
1084383100 11:68825956-68825978 GTGTCTGGAGTGAGTGAGGCTGG - Intronic
1084529164 11:69717023-69717045 GAGGGTGGCCAGAGGGAGCCAGG + Intergenic
1084542534 11:69796598-69796620 GGGGCTGGGATGACGGAGGCAGG - Intergenic
1084627968 11:70323426-70323448 GAGGCTGGACAGAGGTAGGAAGG + Intronic
1084927245 11:72523324-72523346 GTGGCTGCAGTGATGGAGGCAGG + Intergenic
1085302847 11:75468461-75468483 AAGGCTGGGTTGAGGGAGTCTGG + Intronic
1085319219 11:75563959-75563981 TGGGCTGGGCTGTGGGAGGCTGG + Intronic
1085329719 11:75637877-75637899 AAGGAAGGACTGAGGGAGGGAGG + Intronic
1085392657 11:76190347-76190369 GAGGCTGGGCTGAGGTAGATGGG - Intronic
1085787598 11:79468762-79468784 GAGGGTGGAGGGAGGGAGGGAGG + Intergenic
1086357863 11:86024120-86024142 GAGGCTGGAGTAAGAGAGACCGG - Intronic
1087205117 11:95386363-95386385 GAGGATAGACTGGAGGAGGCTGG + Intergenic
1087376662 11:97351238-97351260 GAGGCTGGAAGGTGGGAGGAGGG + Intergenic
1089177795 11:116561011-116561033 CAGCCCGGCCTGAGGGAGGCAGG + Intergenic
1089318813 11:117611118-117611140 GAGGCTGACATGAGGTAGGCTGG - Intronic
1089330058 11:117682804-117682826 GAGGCTGGCTGGAGGGAGGAAGG + Intronic
1089356199 11:117855573-117855595 GAAGCTGGGCTGCTGGAGGCTGG + Intronic
1089397333 11:118145005-118145027 GAGGCATGGGTGAGGGAGGCTGG + Intronic
1089467823 11:118696961-118696983 GTGGCTGGAGGGAGGGTGGCAGG + Intergenic
1089541742 11:119193434-119193456 AAAGCTGGACTGGGGGAGGTAGG - Intronic
1089645422 11:119875698-119875720 GAGGCGGGGCTGATGGAGGGAGG - Intergenic
1089651962 11:119920407-119920429 CAGGCTGGGCTGAGGGCTGCTGG - Intergenic
1089804197 11:121068505-121068527 AAGGGTGGACTCAGGGAGACTGG - Intronic
1090183712 11:124722346-124722368 GAGGCTGGGATGCGGGTGGCTGG - Intergenic
1090664389 11:128905272-128905294 GAGGCGGGGCTGGGGGATGCGGG - Intronic
1090668512 11:128930631-128930653 GAGGCCGGGGTTAGGGAGGCTGG + Intergenic
1090668519 11:128930646-128930668 GAGGCTGGGGTTAGGGAGGCCGG + Intergenic
1090668550 11:128930721-128930743 GAGGCCGGGGTTAGGGAGGCCGG + Intergenic
1090668557 11:128930736-128930758 GAGGCCGGGGTTAGGGAGGCCGG + Intergenic
1090668577 11:128930781-128930803 GAGGCCGGGGTTAGGGAGGCCGG + Intergenic
1090668584 11:128930796-128930818 GAGGCCGGGGTTAGGGAGGCTGG + Intergenic
1090668591 11:128930811-128930833 GAGGCTGGGGTTAGGGAGGCCGG + Intergenic
1090668597 11:128930826-128930848 GAGGCCGGGGTTAGGGAGGCCGG + Intergenic
1090668604 11:128930841-128930863 GAGGCCGGGGTTAGGGAGGCCGG + Intergenic
1090668626 11:128930888-128930910 GAGGCTGGGGTTAGGGAGGCCGG + Intergenic
1090668632 11:128930903-128930925 GAGGCCGGGGTTAGGGAGGCCGG + Intergenic
1090668639 11:128930918-128930940 GAGGCCGGGGTTAGGGAGGCCGG + Intergenic
1090668646 11:128930933-128930955 GAGGCCGGGGTTAGGGAGGCAGG + Intergenic
1090727847 11:129543858-129543880 GAGCCTACACTGAGGGAGGGAGG + Intergenic
1090947949 11:131448365-131448387 GAGGCTGGCCTGTGTGGGGCAGG - Intronic
1091221105 11:133930634-133930656 AGGGCTGGAATGAGGGAGACGGG - Intronic
1202822370 11_KI270721v1_random:74404-74426 GAGGCTGCACCTGGGGAGGCTGG + Intergenic
1091392854 12:136442-136464 ACGGCTGGGCTGTGGGAGGCAGG + Intronic
1091416854 12:295380-295402 GAGGAAGGAGGGAGGGAGGCAGG + Intronic
1091556064 12:1574387-1574409 GAGGCTGGGGTGGGGGAGGCTGG + Intronic
1091556105 12:1574509-1574531 GAGGCTGGGGTGGGGGAGGCTGG + Intronic
1092045482 12:5429727-5429749 GAGGAGGGACTGAGGGAAGGAGG - Intergenic
1092101401 12:5886921-5886943 AAGGCTGGGTTGAGGGTGGCCGG + Intronic
1092268406 12:7001585-7001607 GAGGCAGGCCTGAGGAGGGCTGG + Intronic
1092493947 12:8973024-8973046 CCAGCTGGGCTGAGGGAGGCTGG + Intronic
1092724391 12:11470798-11470820 GAGGGTGGACGGTGGGAGGAGGG + Intronic
1093167175 12:15817503-15817525 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1093554509 12:20454617-20454639 GAGGCTGGAGGGTGGGAGGAAGG - Intronic
1095735576 12:45552975-45552997 GAGGCAGGAGTGAGGGAGCCAGG - Intergenic
1095976207 12:47942538-47942560 GAGGGAGGTCTGAGAGAGGCTGG - Intronic
1096346396 12:50850789-50850811 AAGGCTGCAATGAGGGATGCTGG - Intronic
1096478868 12:51924775-51924797 AAGGCAGGACTGAGGGAGGATGG - Intergenic
1096653550 12:53074511-53074533 GAGGCTGGACTGGAGGAGATGGG + Intronic
1096791721 12:54049091-54049113 GAGGCTGGGATGAGGGAGGAAGG + Intronic
1096836564 12:54354977-54354999 GAGGTGGGACTGAGGTAGGAGGG + Intergenic
1096864574 12:54554662-54554684 GTGGCTGGAGGGAGGGAAGCAGG + Intronic
1097921979 12:65085727-65085749 TGGGCTGGACTGAGGGAGTGAGG + Intronic
1098895977 12:76061272-76061294 GAGGGTGGAGTGTGGGAGGAGGG - Intronic
1099927228 12:89032828-89032850 GGAGCTGGACTGAGTGAGTCTGG - Intergenic
1100260687 12:92929402-92929424 GAGGCGGGGCTGAAGGGGGCCGG + Intergenic
1100858889 12:98783885-98783907 GAGGCTGGATGCAGGGAGTCAGG + Intronic
1101000533 12:100353276-100353298 GAGGCTGGAGGGTGGGAGGAGGG - Intergenic
1101676579 12:106922418-106922440 GGGGCTGGAGTGAGGGAGGTGGG - Intergenic
1102157446 12:110742601-110742623 GAGGCGGGCCTGAGGGCGGCAGG - Intronic
1102392943 12:112564068-112564090 GAGTTTGGGCTGAGGAAGGCAGG - Intergenic
1102419844 12:112794842-112794864 CAGGCTGGACTGGGGGAGTAGGG - Intronic
1102771438 12:115480650-115480672 GAGACTGGAGTGTGGGAGGAGGG - Intergenic
1102886400 12:116525383-116525405 GGGGAGGGACTGAGGGAGGGAGG - Intergenic
1102972263 12:117178592-117178614 GTGGCTGGACTGAGGGGGAGTGG - Intronic
1103208072 12:119145755-119145777 GGGGGTGGAGTGGGGGAGGCTGG - Intronic
1103566756 12:121819917-121819939 GAGGGTGGTGGGAGGGAGGCAGG + Intronic
1104517945 12:129445308-129445330 GAGGGTGGAGTGTGGGAGGAAGG + Intronic
1104605537 12:130184934-130184956 GAGGCTGGACTGAGGGCTGAGGG - Intergenic
1104676528 12:130715346-130715368 GCGGCTGGCCGGAGGGAGGGAGG - Intronic
1104737721 12:131148352-131148374 GAGAGTGGAGGGAGGGAGGCAGG - Intergenic
1104756435 12:131272525-131272547 GAGCCTGGGCGCAGGGAGGCAGG + Intergenic
1104833060 12:131767832-131767854 GAGGGTGGAGGGAGGGAGGGAGG + Intronic
1104896546 12:132167702-132167724 GAGGCTGCAGAGAGGGAGGGTGG - Intergenic
1104946679 12:132417748-132417770 GAGGCTGGGCCGTGGGAGGAGGG - Intergenic
1104980442 12:132570998-132571020 GATGCTGGCCTGCGGGTGGCTGG + Intronic
1105056503 12:133104940-133104962 GAGGGTGGAATGTGGGAGGAGGG - Intronic
1105584797 13:21733968-21733990 GAAGCTTAACTGAGGGAAGCTGG - Intergenic
1105599603 13:21875047-21875069 GAGGGAGGAATGGGGGAGGCCGG - Intergenic
1105776026 13:23661184-23661206 GAGGGTGGAGTGTGGGAGGAGGG - Intronic
1105795077 13:23843682-23843704 GAGGGTGGAATGCAGGAGGCAGG + Intronic
1106588810 13:31080459-31080481 GGGGCTGGAGGGAGGGAGTCTGG + Intergenic
1107932358 13:45316556-45316578 AAGGCTGGGCTGCGGAAGGCAGG + Intergenic
1108430194 13:50345838-50345860 GAGGGGGGAGTGAGGGAGGGAGG - Intronic
1108970188 13:56364669-56364691 GAGGCTGTAGTGTGGGAGGAGGG + Intergenic
1109295284 13:60523639-60523661 GAGGCTGCAGTGAGGGAAGATGG - Intronic
1109308449 13:60664485-60664507 GGGGATGGAGAGAGGGAGGCAGG + Intergenic
1109499467 13:63216386-63216408 GAGGCTGGGATGAGGGGTGCAGG - Intergenic
1109890902 13:68613252-68613274 GAGGGTGGAGTGTGGGAGGAGGG - Intergenic
1110523324 13:76506240-76506262 GAGGGTGGAGGGAGGGAGGAGGG + Intergenic
1110781647 13:79472864-79472886 GAGGCTGGACTAAGCGAGGTAGG + Intergenic
1111540957 13:89666730-89666752 GAGGCTGGAAGGAGGGAATCAGG + Intergenic
1111856437 13:93643482-93643504 TAGGCTGAACAGAGGTAGGCAGG + Intronic
1112184409 13:97114406-97114428 GGGGTTGGAGTGAGGGTGGCCGG - Intergenic
1112442015 13:99431503-99431525 AAGGCTGGGCTGAGCGAGCCAGG + Intergenic
1112721217 13:102248087-102248109 GAGGGTGGAGTGTGGGAGGAGGG + Intronic
1113109107 13:106802858-106802880 GAGGCGGGGTTGCGGGAGGCAGG + Intergenic
1113397109 13:109958133-109958155 GAGGGTGGAGAGAGGGAGGAAGG - Intergenic
1113439565 13:110317525-110317547 GAGGCTGGACAGAGGCGGGAGGG + Intronic
1113729210 13:112627501-112627523 GAGGCAGCCCTGAGCGAGGCTGG + Intergenic
1113767938 13:112892676-112892698 GAGGCTGGGCTCAGGGAAGGAGG - Intergenic
1113784045 13:112993164-112993186 GAGGCTGTACTGACAGAGGCTGG + Intronic
1113989918 13:114353166-114353188 GTCGCTGGGCTGAGGGTGGCGGG - Intergenic
1114269972 14:21094550-21094572 GAGGCTGGAGTGAGGGACGGGGG + Intronic
1114484520 14:23054951-23054973 GAGGCTGAATTGAAGGGGGCAGG + Intronic
1114646145 14:24257272-24257294 GAGGCTGGACAGAAGGTAGCTGG + Intronic
1114650899 14:24284110-24284132 GAGGCTTGACAGAGAAAGGCAGG + Intergenic
1115591493 14:34869981-34870003 GAGGCTAGGCTGAGGCAGGTTGG - Intronic
1116252937 14:42509987-42510009 GAGGGTGGAAGGAGGGAGGAGGG + Intergenic
1116324104 14:43509083-43509105 GAGGCGGGAGGGAGGGAGGGAGG + Intergenic
1116558690 14:46347590-46347612 GAGGGTGGAGAGAGGGAGGAGGG + Intergenic
1116919657 14:50560009-50560031 GGGGGTGGACTGAGGTAGGGAGG + Exonic
1117079101 14:52133083-52133105 GAGGCTGAGCTGAGGGAGGAGGG + Intergenic
1117202652 14:53408369-53408391 GAGGCAGGAGTGGGGGAGGGAGG - Intergenic
1117202674 14:53408426-53408448 GAGGCAGGAGTGGGGGAGGGAGG - Intergenic
1117245986 14:53887196-53887218 CAGGCATGACTCAGGGAGGCCGG - Intergenic
1118073398 14:62271120-62271142 GAGGATGGAGAGAGGGAGGATGG - Intergenic
1118249651 14:64147232-64147254 GAGGGTGGTCTGAAGGAAGCCGG - Intronic
1118594555 14:67425692-67425714 GAGGCTGGTCCCTGGGAGGCAGG - Intergenic
1118912522 14:70073409-70073431 GGGGCTGGGGTGAGGGAGACAGG + Intronic
1118937084 14:70298238-70298260 GAGGCTGGGATGAGGGGTGCAGG + Intergenic
1119046285 14:71320994-71321016 GAGGGGGGCCCGAGGGAGGCGGG - Intronic
1119109949 14:71962285-71962307 GTGGCTGGGCAGAGGGAGGCCGG + Intronic
1119675511 14:76550701-76550723 GAGGCAGGAATGGGGTAGGCTGG - Intergenic
1119714261 14:76847537-76847559 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1120526157 14:85579197-85579219 GAGGCTGGAGTGGGGGAACCAGG + Intronic
1120659788 14:87237477-87237499 GAGGCTGGGATGAGGGGTGCAGG + Intergenic
1120974285 14:90235247-90235269 GAGCCTGGACAGAGAGAGGGAGG + Intergenic
1121259572 14:92556237-92556259 GAGGCAGGACTGATGCAGTCAGG + Intronic
1121289598 14:92763141-92763163 GAGGCTGGGATGAGGGGTGCAGG - Intergenic
1121338525 14:93091650-93091672 GAGGGTGGAATGAATGAGGCTGG + Intronic
1121340097 14:93099966-93099988 GTGGCTGGCCAGAGTGAGGCTGG - Intronic
1121837816 14:97107679-97107701 GAGGGTGGAGTGAGGGAGGAGGG + Intergenic
1122219424 14:100226874-100226896 GAGGCTGGATTGCTTGAGGCAGG + Intergenic
1122280763 14:100620969-100620991 GAGGCTGGCTGGAGGGAGGATGG - Intergenic
1122288605 14:100667576-100667598 GAGGCTGGAGAGGGCGAGGCAGG + Intergenic
1122632319 14:103112611-103112633 GAGGATGCAGTCAGGGAGGCTGG + Intergenic
1122805895 14:104256833-104256855 GAGTCTGGGCTCTGGGAGGCTGG + Intergenic
1122854394 14:104553218-104553240 GAGCCTGGACTCAGGGTGGTGGG + Intronic
1122972769 14:105159094-105159116 GAGGCTGGGCTGGGTGTGGCTGG - Intronic
1123105031 14:105837317-105837339 GAGGCAGGGCTGAGGGAGCCTGG - Intergenic
1123224059 14:106883596-106883618 GTCGCTGGGCTGAGGGTGGCGGG - Intergenic
1123407384 15:20029374-20029396 GAGAGTGGACTGAGAGATGCCGG + Intergenic
1123516711 15:21036030-21036052 GAGAGTGGACTGAGAGATGCCGG + Intergenic
1123996061 15:25718750-25718772 GAGGCAGGACAGAGGGTGGCAGG + Intronic
1123996370 15:25720632-25720654 GAGGCTGGTGGGAGGGAGGATGG + Intronic
1124366159 15:29072809-29072831 GCAGCAGGACTGGGGGAGGCAGG + Intronic
1124458810 15:29870075-29870097 GAGGCTGGGCGGTGGGGGGCGGG - Intronic
1124465576 15:29936386-29936408 CAGGCTGGACCGGGGAAGGCAGG - Intronic
1124633092 15:31348310-31348332 GAGGCTGGGCTGACAGAGCCAGG - Intronic
1125173225 15:36790991-36791013 GAGGGTGGACAGTGGGAGGAGGG - Intronic
1126434715 15:48624826-48624848 GAGCCTGCACAGAGAGAGGCCGG + Intronic
1126670860 15:51113864-51113886 GTGGCTGATCTGAGGGAGGCTGG - Intergenic
1127474610 15:59321680-59321702 GAGGCAGGAGAGAGGGAGGTGGG + Intronic
1127483759 15:59400629-59400651 GAGGCTGGAGTGAAGGGAGCAGG - Intronic
1127899704 15:63331803-63331825 CTTGCTGGACTGAGGGATGCTGG + Intronic
1128082457 15:64864760-64864782 AAGCCAGGACAGAGGGAGGCTGG + Intronic
1128501438 15:68229780-68229802 GAGGCGGGGCGGAGGGAGACGGG + Intronic
1128726630 15:69992705-69992727 CAGGCTGGAGTGAGTGAGGAGGG - Intergenic
1129172307 15:73815699-73815721 GAGGCAGGACAGAAGGAAGCAGG + Intergenic
1129332409 15:74834463-74834485 GAGGCTGGGGCGAGGGGGGCAGG - Intergenic
1129868491 15:78926231-78926253 GAGGCAGGACTGAGGGAGGCTGG - Intronic
1129872228 15:78947860-78947882 GAGGCTGGTGGGGGGGAGGCGGG - Intronic
1130055883 15:80525544-80525566 GAGGATGGAAGGAGGGAGGGAGG + Intronic
1130059194 15:80557453-80557475 GAGGGTGGACAGTGGGAGGAGGG + Intronic
1131097985 15:89667785-89667807 CAGGCTGCTCTGAGGGAGGATGG + Exonic
1131121766 15:89827508-89827530 GTGGCTGGAAGGAGGGAGCCAGG + Intergenic
1131585824 15:93691699-93691721 GAGGATTAACTGAGGGAGGAGGG + Intergenic
1131714338 15:95091832-95091854 AAGGCTGGACTGAGGGCAGGTGG + Intergenic
1131968144 15:97867142-97867164 GGGGCTGGGCTGAGCGTGGCAGG + Intergenic
1132226997 15:100150571-100150593 GAGGAGGGACAGAGGGAGGAAGG - Intronic
1132734165 16:1377458-1377480 GAGGGAGGACTCAGGGAGGGAGG - Intronic
1132804869 16:1770824-1770846 CAGGCTGAACAGGGGGAGGCCGG + Intronic
1132826947 16:1909868-1909890 GAGGCCAGACTCAGGCAGGCTGG - Intergenic
1132882436 16:2168347-2168369 GTGGCTGGACTGTGGGTGGCAGG + Intronic
1132888259 16:2191946-2191968 GAGGTTGGACCGAGGGATGTGGG - Intronic
1133309546 16:4835202-4835224 GAGGCTGGGTAGTGGGAGGCAGG - Intronic
1133605158 16:7379805-7379827 GAGGAGGGAGGGAGGGAGGCAGG - Intronic
1133831940 16:9331414-9331436 GAGGCTGGATCACGGGAGGCAGG - Intergenic
1134058072 16:11182593-11182615 CAGGCTGGGCCGAGGGAAGCAGG + Intergenic
1134112641 16:11524741-11524763 GTGGCTGGAGGGAGGGAGGGAGG - Intergenic
1134449222 16:14353740-14353762 GAGGCAGGAGGGAGGGAGGGAGG + Intergenic
1134656182 16:15949824-15949846 CCGGCGGGACGGAGGGAGGCCGG + Intronic
1135074720 16:19383364-19383386 GAGGGTGCACGGAGGGAGCCGGG - Intergenic
1135293776 16:21262056-21262078 GAGGCTGCCCTGAAGGAGTCTGG - Exonic
1135862096 16:26065472-26065494 GAGGCTGGAGGGTGGGAGGAGGG + Intronic
1135899757 16:26446179-26446201 GTGGACAGACTGAGGGAGGCTGG - Intergenic
1136054048 16:27674759-27674781 GAGGGTGGGCTGTGGTAGGCTGG - Intronic
1136068094 16:27771924-27771946 GTGGCTGGACTGGGGAAGGGGGG + Intronic
1136072416 16:27795840-27795862 GATTCTTCACTGAGGGAGGCGGG - Intronic
1136231467 16:28888095-28888117 GAGGTTGCACTGAGCAAGGCCGG - Intronic
1136268022 16:29132159-29132181 GAGGATGGAGGGAGGGAGGAAGG + Intergenic
1136343849 16:29663067-29663089 GGGGCTCACCTGAGGGAGGCAGG - Intronic
1137369940 16:47895885-47895907 GAGGCTGGGGAGAGGGAGACAGG + Intergenic
1137794387 16:51203031-51203053 GAAGGTGTTCTGAGGGAGGCAGG - Intergenic
1138201407 16:55091405-55091427 GAGCCAGGGCTGAGGGAGGCGGG + Intergenic
1138524097 16:57591934-57591956 GAGGCTGGACGGATGGATGACGG - Intergenic
1138534494 16:57652815-57652837 GAGCCTGGAGTCAGGGAGGCTGG + Intronic
1138554618 16:57764252-57764274 GAGGGTGGTGGGAGGGAGGCTGG + Intronic
1138600882 16:58053321-58053343 GAGCCTGGCCTGATGGCGGCAGG - Intergenic
1138613716 16:58147764-58147786 CAGGCAGCACTGAGGGAGGAGGG - Intergenic
1138633637 16:58319413-58319435 GAGGGTGGATTGGAGGAGGCAGG - Intronic
1138792719 16:59926466-59926488 GAGGTTGGAGTGTGGGAGGTGGG - Intergenic
1138976596 16:62214838-62214860 GAGACTGGACAGAAGGAAGCTGG - Intergenic
1139673325 16:68506501-68506523 GAGTCAGGACTGAGGCAGCCTGG + Intergenic
1139967446 16:70753688-70753710 GAGGGACGACTGAGGAAGGCCGG + Intronic
1140456529 16:75109041-75109063 AAGGCTGGAAGGAGGGGGGCTGG - Exonic
1140936936 16:79680854-79680876 GAGGTTGGACAGTGGGAGGTGGG + Intergenic
1141557109 16:84843483-84843505 CTGGCTGGACGGAGGCAGGCTGG - Intronic
1141881713 16:86864575-86864597 GAGGGTGGAGGGAGGGAGGAGGG - Intergenic
1142070806 16:88090537-88090559 GTGGCTGGCGTGGGGGAGGCAGG + Intronic
1142252609 16:88999633-88999655 GGGGCGGGACAGAGGGAGGAGGG + Intergenic
1142485612 17:245957-245979 GAGGCTGCTATGAGGGAGTCGGG + Intronic
1142507046 17:371091-371113 GGGGCTGGACTGGCGGGGGCAGG + Intronic
1142604635 17:1074677-1074699 AAGGCTGGAGGCAGGGAGGCTGG + Intronic
1142805550 17:2369484-2369506 CAGGCTGGACGGGGGGAGGGGGG - Intronic
1143149509 17:4798883-4798905 GAGGCTGGGCTGGAGGAGGCTGG - Intergenic
1143551461 17:7632880-7632902 GAGCCAGGCCTAAGGGAGGCAGG - Exonic
1143577312 17:7801785-7801807 GAGGCGGGAAGGAGAGAGGCCGG - Intronic
1143602393 17:7956743-7956765 GAGGCTGGAGGGTGGGAGGAGGG - Intergenic
1143633282 17:8150774-8150796 GAGGCTTGGCTGAGGGAGTGAGG + Exonic
1143673728 17:8415111-8415133 GAGGCAGGAGGGAGGGAGGGAGG - Intronic
1143816603 17:9521190-9521212 GAGGCTGCAGTCAGAGAGGCAGG + Intronic
1144278787 17:13703318-13703340 GAGGGGGGACTGAGGGAGCGGGG + Intergenic
1144375794 17:14639814-14639836 GAGGCTGGATGAAGGGAGGAAGG + Intergenic
1144484208 17:15651530-15651552 GAGTCTGGGCTGAGAGGGGCTGG + Exonic
1144727890 17:17511000-17511022 GAGGTTGGACCGATGGAGCCAGG - Intronic
1144779341 17:17800006-17800028 GAGGGTGGAGTGAGGTGGGCAGG - Intronic
1144809494 17:17989589-17989611 GAAGCTGGAGTAAGGGAGGCAGG + Intronic
1145254347 17:21314493-21314515 GATCCTGGACTGAGGGGGCCTGG + Exonic
1145723195 17:27090998-27091020 GAGGCTGGACTTTGGAAGGTGGG + Intergenic
1145780007 17:27556770-27556792 GAGGCAGGACTAGGGCAGGCTGG - Intronic
1145783309 17:27577948-27577970 GGGGCTGGAATGTGGGAAGCTGG - Intronic
1146307836 17:31744146-31744168 GAGGGTGGAGGGAGGGAGGGAGG + Intergenic
1146479682 17:33195009-33195031 AAGACTGGACTGAGAGAGGTAGG + Intronic
1146532177 17:33617498-33617520 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1146538019 17:33670060-33670082 GAGGCTGGACTTTGGGAACCAGG + Intronic
1146739054 17:35265300-35265322 GATACTGGTCTGAGGGAGGGGGG - Exonic
1147157624 17:38552192-38552214 AAGGCTGCTCTGAGGGAGGTGGG + Intronic
1147168207 17:38604496-38604518 GAGGCTGGACCGAGGGACCCTGG - Intronic
1147349636 17:39830771-39830793 GAGGCTGGGCTGAAGTAGGGAGG + Intronic
1147670265 17:42172993-42173015 GAGCAGGGACTGAGGGAGGCTGG + Intronic
1147725274 17:42562919-42562941 GATTCTGGACTGAGGTGGGCAGG - Exonic
1148200861 17:45749281-45749303 GAGGCTGGATTGAGAGATGGTGG - Intergenic
1148679486 17:49465562-49465584 AAGGCAGGACTGCGGGTGGCGGG - Intronic
1148758700 17:49988076-49988098 GAGGAAGGAAGGAGGGAGGCAGG - Intergenic
1149302917 17:55321197-55321219 GAGGCAGGAGTGAAGGAGGGAGG - Exonic
1149308406 17:55371302-55371324 AAGGCTTGACTGAGGCAGCCTGG + Intergenic
1149531975 17:57402738-57402760 AAGGCTGGGCTGGAGGAGGCTGG - Intronic
1149652384 17:58284077-58284099 GAGGGTGGACAGGGTGAGGCTGG + Intergenic
1149754316 17:59174885-59174907 GAGGCTGGACAAGGGGAGGGAGG - Intronic
1150136285 17:62697055-62697077 CAGGCTGGAGGGAGGGAGGGCGG + Intergenic
1150525945 17:65922911-65922933 GAGGCTGGAATTGGGGAGGAAGG - Intronic
1151152132 17:72097301-72097323 GAAGGTGGACGGAGGGTGGCCGG + Intergenic
1151237696 17:72733516-72733538 GAGGCTGGACTGGCTGAGTCTGG + Intronic
1151319165 17:73342429-73342451 GATGCTGGGCCGAGTGAGGCTGG + Intronic
1151322140 17:73358723-73358745 TAGGCAGGAATGAGGGAGGGCGG - Intronic
1151530343 17:74700290-74700312 GAGGCTGGAGTGAAGCAGGCAGG - Intronic
1151536586 17:74742305-74742327 GAGGCTGGAGTTGGGGAGGGAGG + Intronic
1151802088 17:76384659-76384681 GAGGCCGGAGGGAGCGAGGCCGG + Exonic
1151825287 17:76520618-76520640 CAGGATGGACTGGGGAAGGCAGG + Intergenic
1151829371 17:76540583-76540605 GAGTCTGGGCTGGGGGAGGGAGG + Intronic
1151836414 17:76585578-76585600 GAGGTTGGGCTGAGGGCTGCGGG + Intronic
1152081478 17:78190228-78190250 GAGGCTGGGCTGGAGGAGGAGGG - Intronic
1152099513 17:78292778-78292800 GAAGCTGGACACAGAGAGGCAGG - Intergenic
1152282150 17:79391108-79391130 GAGGCTGGTATCAGGGAGCCTGG - Intronic
1152335094 17:79696158-79696180 GAGGCTGGGCTGCAGGAGCCTGG + Intergenic
1152404078 17:80086670-80086692 GTGCCTGGAATGATGGAGGCGGG + Intronic
1152425737 17:80217670-80217692 GAGGCTGGACTGATAGATGGTGG + Intronic
1152534560 17:80942994-80943016 GAGGCTGCACTCACAGAGGCAGG - Intronic
1152588089 17:81197968-81197990 GAGGCTGGGCTCTGGGAGGGAGG + Intronic
1152641790 17:81452365-81452387 GAGGCTGGCCGCAGGGTGGCGGG + Intronic
1152710783 17:81869716-81869738 GAGTCTGGGCTGCGGGAGCCGGG - Intronic
1153329152 18:3855280-3855302 GAGGGTGGAGGGAGGGAGGAAGG + Intronic
1153359511 18:4177608-4177630 GAGGGTGGATGGAGGGAGGAAGG - Intronic
1153932203 18:9887857-9887879 GAGGCATCACTGAAGGAGGCCGG + Exonic
1155547539 18:26930800-26930822 GAGGCTGGGCTGCTGGTGGCAGG - Intronic
1155907497 18:31469279-31469301 CAGGCCGCACTCAGGGAGGCTGG + Exonic
1156087203 18:33420281-33420303 GAGGGTGGGGTGAGGGAGGAAGG + Intronic
1156458530 18:37308182-37308204 GAAGCTGGACTTAGGAAGACAGG - Intronic
1156461912 18:37326045-37326067 GAGTCAGGGCTGAGTGAGGCTGG - Intronic
1157052531 18:44183989-44184011 GAGGTTGGAGGGAGGGAGGAGGG + Intergenic
1157504879 18:48219102-48219124 GGGACTGGACTGAGGAATGCTGG + Intronic
1157550368 18:48577062-48577084 CAGGCTGGCCTGGGGGAGCCAGG + Intronic
1158095870 18:53770084-53770106 GAGGCTGGAGGGTGGGAGGAGGG + Intergenic
1159505422 18:69329061-69329083 GAGGGTGGAATATGGGAGGCGGG + Intergenic
1159553949 18:69925704-69925726 GAGACTGGAGTGAAGGAGGCTGG - Intronic
1159988802 18:74877391-74877413 GAGGCTGGGCAGAGGTAGACTGG + Intronic
1160229333 18:77034571-77034593 GAGGCTCCACTGTGGGAGGCAGG - Intronic
1160317319 18:77859768-77859790 GAGGCTGGAGGGAGGCAGGTAGG + Intergenic
1160416122 18:78712220-78712242 GAGGCTGGAAAGCTGGAGGCTGG - Intergenic
1160483507 18:79265054-79265076 GAGGCTGGAGGGTGGGAGGAGGG - Intronic
1161301765 19:3546218-3546240 CAGGCTGGGGTGGGGGAGGCCGG - Intronic
1161453697 19:4360100-4360122 AAGGCTGGGGTGAGGGTGGCTGG + Intergenic
1161664718 19:5568234-5568256 GAGGCTCCAGGGAGGGAGGCTGG + Intergenic
1161712288 19:5855692-5855714 GAGGCTGGGATGAGGGGTGCAGG - Intergenic
1162539586 19:11286502-11286524 GAGGCTGGACTGAGCTATGATGG + Intergenic
1162717043 19:12640726-12640748 GAGGGTGGAAGGAGGGAGGAAGG + Intergenic
1162937606 19:13989193-13989215 GAGGCAGGACTGAGCCTGGCGGG + Intronic
1163213111 19:15856475-15856497 GAAGCTGAAATGATGGAGGCGGG - Intergenic
1163632166 19:18423081-18423103 CAGAGTGGGCTGAGGGAGGCTGG + Intronic
1163691102 19:18738967-18738989 GCGGCTGGAGGGAGTGAGGCTGG + Intronic
1163783340 19:19261767-19261789 GGGGCAGGACTGAGGGCGGGGGG - Intronic
1163786338 19:19276855-19276877 CTGGCTGGACTGAGGAAGGAAGG + Intronic
1164581770 19:29439193-29439215 GAGGGGGGAGAGAGGGAGGCAGG + Intergenic
1164730967 19:30504302-30504324 GAGGCTGGTGGGAGGGAGGAAGG - Intronic
1164933018 19:32189717-32189739 GAGCCTGGAATTAGGGAGGGAGG - Intergenic
1165116619 19:33532883-33532905 GGGGTTGGAGTGAGGCAGGCAGG - Intergenic
1165156867 19:33794599-33794621 GAGGGTGGAATGAGGGAAGGTGG - Intergenic
1165281137 19:34798490-34798512 GATGCTGGACAGTGGGAGCCAGG - Intergenic
1165333141 19:35152468-35152490 GAAGCGGGACAGAGGGAGGGAGG + Intronic
1165438786 19:35812176-35812198 GAGGCTGGCCTCAGCCAGGCTGG + Exonic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
1166231433 19:41427472-41427494 GAGGCAGGAGAGAGGGAGGGAGG + Exonic
1166251725 19:41576067-41576089 GAGGCAGGACTGAGAGGGGAGGG + Intronic
1166415933 19:42595002-42595024 GAGGCAGGACTGAGAGGGGAGGG - Intronic
1166420590 19:42633208-42633230 GAGGCAGGACTGAGAGGGGAGGG - Intronic
1166432684 19:42740557-42740579 GAGGCAGGACTGAGAGAGGAGGG - Exonic
1166435792 19:42765754-42765776 GAGGCAGGACTGAGAGAGGAGGG - Intronic
1166448654 19:42879754-42879776 GAGGCAGGACTTAGAGAGGAGGG - Intronic
1166453063 19:42917965-42917987 GAGGCAGGACTGAGAGAGGAGGG - Intronic
1166455552 19:42937249-42937271 GAGGCAGAACTGAGAGAGGAGGG - Intronic
1166465337 19:43026546-43026568 GAGGCAGGGCTGAGAGAGGAGGG - Intronic
1166471466 19:43082742-43082764 GAGGCAGGACTGAGAGAGGAGGG - Intronic
1166482609 19:43186577-43186599 GAGGCAGGACTGAGAGAGGAGGG - Intronic
1166485091 19:43205709-43205731 GAGGCAGAACTGAGAGAGGAGGG - Exonic
1166492235 19:43269604-43269626 GAGGCAGGACTGAGAGAGAAGGG - Intergenic
1166707188 19:44914588-44914610 GTGGGTGGACAGAGGGAGGCAGG + Intronic
1166909216 19:46139194-46139216 GAGAGTGGAGTGAGGGAGGCAGG - Intergenic
1167004475 19:46766705-46766727 GAGGCTGGAGTAAGAGAGGGAGG + Intronic
1167042813 19:47032582-47032604 GCGGCTGGACAGAGGGACACCGG + Intronic
1167043280 19:47035445-47035467 GGGCCTGCATTGAGGGAGGCAGG + Intronic
1167080691 19:47274684-47274706 GGGGCTGGAGCGAGGGGGGCGGG + Exonic
1167240031 19:48338257-48338279 GAGGCTGGAGTGATGCAGGCGGG - Intronic
1167260312 19:48454414-48454436 GAGGCTGGATGGAGGGGGGCCGG - Exonic
1167303842 19:48695906-48695928 GTGGCTGGGCTGCGGGAGGGAGG - Intergenic
1167379500 19:49130359-49130381 GAGTCTGGAGTGAGGGAAGGAGG - Exonic
1167411657 19:49347628-49347650 GAGGCTGGGGTGAGGGTGGGAGG - Intronic
1167704034 19:51067839-51067861 GAGCCTGGAGTGAGGGTGGTTGG + Intergenic
1168135655 19:54349492-54349514 GAGGGTGGACGGATGGAGGGAGG + Intergenic
1168298071 19:55387510-55387532 GGGACTGGCCTGAGTGAGGCTGG + Intronic
1168383905 19:55946703-55946725 GAGGCTGGAGGGTGGGAGGAGGG - Intergenic
1168450555 19:56463083-56463105 GAGGGTGGGCTAAGGCAGGCAGG + Intronic
1168728619 19:58606779-58606801 GTCGCTGGGCTGAGGGTGGCTGG - Intergenic
924989029 2:295429-295451 GAGGGTGGGCAGAAGGAGGCAGG - Intergenic
925017620 2:543734-543756 GAGGCTGGAGGGTGGGAGGCAGG + Intergenic
925017628 2:543757-543779 GAGGCAGGAAGGTGGGAGGCTGG + Intergenic
925017634 2:543772-543794 GAGGCTGGAGGGTGGGAGGCAGG + Intergenic
925017675 2:543887-543909 GAGGCGGGAAGGTGGGAGGCAGG + Intergenic
925017691 2:543933-543955 GAGGCTGGAGGGTGGGAGGCTGG + Intergenic
925017696 2:543948-543970 GAGGCTGGAGGCAGGGAGGCAGG + Intergenic
925017705 2:543971-543993 GAGGCAGGAGGGTGGGAGGCAGG + Intergenic
925018580 2:551291-551313 GAGGCTGCAGTGAAGGAGGTGGG + Intergenic
925120725 2:1415804-1415826 GAGGCTGGGCTGGGTGTGGCTGG - Intronic
925194363 2:1911543-1911565 GGGGGTGGTCTGTGGGAGGCTGG - Intronic
925425110 2:3742940-3742962 GATGATGGACTGAAGGTGGCAGG + Intronic
926059244 2:9794895-9794917 GAGGGTGGAGGGAGGGAGGGAGG - Intergenic
926156067 2:10454631-10454653 TTGGATGGACTGATGGAGGCTGG - Intergenic
926165661 2:10521142-10521164 GAGGCTGGAGGGAGGGAGGGAGG + Intergenic
926316206 2:11712100-11712122 GAGGCAGGGGTGAGTGAGGCCGG - Intronic
926640983 2:15236482-15236504 GAGGCTGCAGTGAGTGAGCCTGG + Intronic
926714509 2:15913573-15913595 GAGGCTAGGCAGAGGGAGGGAGG + Intergenic
926783610 2:16498545-16498567 GAGGGTGGACGGTGGGAGGAGGG - Intergenic
926878901 2:17518591-17518613 GAGGAGGGACTGAGGGAGGCGGG - Intergenic
927128231 2:20033475-20033497 GAGGGTGGAGAGAGGGAGGTGGG + Intronic
927573723 2:24182863-24182885 ATGGCTGAACTGAGGGAGGGAGG - Intronic
927636390 2:24820155-24820177 GAGCCTAGACTGAGGGCGGGTGG + Exonic
927963279 2:27254223-27254245 CAGGCTGGCTGGAGGGAGGCTGG - Intronic
927997125 2:27494458-27494480 GAGGCCGGTCTGCGGGAGCCAGG + Exonic
928114447 2:28537120-28537142 GAGGCTGGCTTCTGGGAGGCCGG - Intronic
928693117 2:33821000-33821022 TAGGCTGGGCTGAGGACGGCAGG - Intergenic
928704486 2:33933307-33933329 AAAGCAGAACTGAGGGAGGCAGG - Intergenic
929137455 2:38638065-38638087 GAGACAGGAGGGAGGGAGGCAGG + Intergenic
929557616 2:42935398-42935420 GAGGGTGGAGGGTGGGAGGCGGG - Intergenic
929622443 2:43369162-43369184 AAGGCAGGACTGAAGGAAGCAGG - Intronic
929826141 2:45310787-45310809 GAGGATGGACTGAGGGGGCTCGG - Intergenic
929887568 2:45892506-45892528 CAAGCTGGAGTGAGGGAGGAGGG + Intronic
930061383 2:47292025-47292047 GAGGCTGCAGTGAGCTAGGCTGG + Intergenic
930098902 2:47588102-47588124 GAGGCTGGGATGAGGGGTGCAGG + Intergenic
930572725 2:53107422-53107444 GAGGGTGGAGGGAGGGAGGAGGG + Intergenic
931014671 2:57962563-57962585 GAGGATGGAGGGAGGGAGGAGGG - Intronic
931138788 2:59434178-59434200 GAGGACGGACTGAGTGAGGAGGG + Intergenic
931206358 2:60149381-60149403 GAGGATGGAATGAAGGAGGGTGG - Intergenic
931539897 2:63318763-63318785 GAGGCTGGAGTGTGGGAGGAGGG + Intronic
931553172 2:63469697-63469719 GAGGATGGAGTGTGGGAGGTGGG + Intronic
931649222 2:64453929-64453951 GAGGCTGGAGGGAGGGGCGCGGG + Intergenic
932131016 2:69187237-69187259 GAGTCTGGAATGAGGAAGGGGGG - Intronic
932787248 2:74617525-74617547 GAGGGTGGAGTGTGGGAGGAGGG + Intronic
932799848 2:74731445-74731467 GTGGCTGGACCGAGGGAGAGAGG + Intergenic
933319489 2:80755926-80755948 AAGGGTGGAGTGAGGGAGGAGGG - Intergenic
933726701 2:85431125-85431147 GAGGCTGGTCGGGGGGAGGCGGG + Intronic
934150121 2:89138434-89138456 GAGGATAGACAGAGTGAGGCTGG - Intergenic
934217175 2:90043595-90043617 GAGGATAGACAGAGTGAGGCTGG + Intergenic
934681018 2:96284001-96284023 CAGGCTGGAAAGAGGGAGGGAGG + Exonic
934708921 2:96502897-96502919 GGGGCTGCACTGGGTGAGGCTGG - Intronic
935027104 2:99287375-99287397 GAGGGTGGAGTGTGGGAGGAGGG + Intronic
935141114 2:100353876-100353898 GAGGGTGGCTGGAGGGAGGCTGG + Intergenic
935213280 2:100956355-100956377 GAGGCTGGAGGGAGGAAGGAAGG - Intronic
935237653 2:101151621-101151643 GAGGCGGGAGGGAGGGAGCCTGG - Intronic
935287604 2:101579267-101579289 GAGCCTGAAGTGAGGGAGTCAGG + Intergenic
935345350 2:102102996-102103018 GAGGATGGAGTGTGGGAGGAGGG + Intronic
935696248 2:105773372-105773394 GTGCATGGACTGATGGAGGCCGG - Intronic
936083730 2:109452778-109452800 GAGGCTGGTCCCTGGGAGGCTGG + Intronic
936083748 2:109452835-109452857 GAGGCTGGTCCCTGGGAGGCTGG + Intronic
936083790 2:109452948-109452970 GAGGCTGGTCCCTGGGAGGCTGG + Intronic
936376016 2:111942108-111942130 GCAGCTGGACTCAGGGAGACAGG - Intronic
936537246 2:113321888-113321910 GAGCATGGGCAGAGGGAGGCCGG + Intergenic
936569885 2:113603925-113603947 GTCGCTGGGCTGAGGGTGGCGGG + Intergenic
936778402 2:116002355-116002377 GAGGCTGGACACCGGGAGGAGGG - Intergenic
936973964 2:118201389-118201411 GAGGCTGGTGTGATGAAGGCCGG - Intergenic
937098513 2:119250990-119251012 GTGGGTGGTCGGAGGGAGGCAGG + Intronic
937463883 2:122112331-122112353 GCGGCAGGAAGGAGGGAGGCAGG - Intergenic
937993558 2:127677139-127677161 TTGGCTGAACTGTGGGAGGCTGG - Intronic
938716679 2:134027906-134027928 GAGGCTGAGCTGAGGGGGACCGG + Intergenic
939940689 2:148347475-148347497 GAGGATGGCATAAGGGAGGCTGG - Intronic
940290503 2:152073915-152073937 GAGGCAGGACTGTAAGAGGCAGG + Intronic
941043321 2:160647391-160647413 GGGGCTAGAGTCAGGGAGGCAGG + Intergenic
943058821 2:183016786-183016808 GAGGTTGGAGGGAGGGAGGAAGG + Intronic
944394311 2:199250203-199250225 GAGGCTGGGATGAGGGGTGCAGG - Intergenic
945253518 2:207784688-207784710 GAGCCTGGAATGAGCAAGGCGGG + Intergenic
945608968 2:211974080-211974102 GAGGGTGGACGGTGGGAGGAGGG + Intronic
946002158 2:216491443-216491465 GAGGTAGGGCTGAGGGAGGGAGG - Intergenic
946309951 2:218877917-218877939 GGGGCTGGACTGGGCTAGGCTGG + Intergenic
946311186 2:218883503-218883525 GGGGCTGGGCTGGTGGAGGCTGG - Intronic
946386502 2:219387395-219387417 GGGGCGGGACTTAGGGAGTCGGG - Intronic
947434739 2:230063402-230063424 GAGGCTGGAAGGAGAGAGGAGGG - Intronic
947744298 2:232499765-232499787 AAGGCTGAAGAGAGGGAGGCTGG - Intergenic
948612080 2:239176271-239176293 GAGGCCGGGCAGAGGGAGGGAGG - Intronic
948792466 2:240386076-240386098 TGGGCTGGACTGAGGTGGGCTGG + Intergenic
949079064 2:242082222-242082244 GAGGCTGGAGGGTGGGAGGAGGG + Intergenic
949079775 2:242087991-242088013 GCGGCTGGAGGGAGAGAGGCAGG - Intergenic
949088879 2:242182416-242182438 GTCGCTGGGCTGAGGGTGGCGGG - Intergenic
1169367636 20:5003749-5003771 GAGGTTGGGCAGAGGAAGGCAGG - Intronic
1169384520 20:5136934-5136956 GAGGGTGGAGAGTGGGAGGCTGG - Intronic
1169514672 20:6303039-6303061 GAGGGTGGAGGGTGGGAGGCAGG - Intergenic
1170657742 20:18305588-18305610 AAGGCTGCCCTGGGGGAGGCAGG - Intronic
1170842392 20:19934516-19934538 GAGAAAGGACTGAGTGAGGCTGG - Intronic
1171227885 20:23456552-23456574 GAGGCTGGGCAGAGGCAGGAAGG - Intergenic
1171412913 20:24958609-24958631 GGGGCTGGAGTGAGGGCTGCAGG + Intronic
1171440172 20:25154221-25154243 GAGGCTGGAAGGAGGAAGGAAGG - Intergenic
1171453876 20:25255586-25255608 GCGGCTGGTCTGAGGCATGCTGG + Intronic
1172110957 20:32544598-32544620 GAGGCTGGAAGGAGAGAGGCAGG + Intronic
1172114010 20:32563130-32563152 GAGGCTGGAGGGAGGGAGAGTGG + Intronic
1172119226 20:32588026-32588048 GAGACTGAAGTGAGGGAGGAGGG + Intronic
1172271759 20:33659158-33659180 GAGGATGGAGACAGGGAGGCTGG - Intronic
1172320614 20:33993288-33993310 GAAGCGGGCCTGAAGGAGGCGGG - Intergenic
1172468986 20:35176836-35176858 GGGGCTGGATTGATGGAGGCTGG + Exonic
1172836949 20:37879207-37879229 GAGGCAGGGCTGAGGGTGGGCGG - Intergenic
1172884567 20:38222536-38222558 GAGGCTGTGCTGAGGGACCCCGG - Exonic
1172967596 20:38848809-38848831 GAGGGTGGATTGTGGGAGGAGGG + Intronic
1172973465 20:38889759-38889781 GAGGAGGGAATGAGGGAGGGAGG + Intronic
1173066070 20:39713290-39713312 GAGGCAGGACTAAGGGAAGATGG + Intergenic
1173188234 20:40857459-40857481 AGGGCTGGAGTGAGAGAGGCGGG - Intergenic
1173511388 20:43631841-43631863 GAGCCCTGAGTGAGGGAGGCGGG - Intronic
1173696554 20:45020622-45020644 TAGGTTGGACTCAGGTAGGCAGG + Intronic
1173898910 20:46572443-46572465 GAGGCTGGGCTGCGGGACGCTGG - Intronic
1174066105 20:47867277-47867299 GTGGCTGCACAGAGCGAGGCTGG - Intergenic
1174114467 20:48217510-48217532 GAGGAGGGAGTGAGGGAGGAAGG + Intergenic
1174528537 20:51192675-51192697 GAGACTGGAGTCAGGGAGGCTGG - Intergenic
1174782885 20:53406406-53406428 GAGGCTGGATTTGGAGAGGCAGG + Intronic
1174904164 20:54532541-54532563 GAGCCTGGTGTGTGGGAGGCTGG + Intronic
1175119311 20:56706132-56706154 GAGGCTGGACTCTGGGGGACGGG + Intergenic
1175187726 20:57190261-57190283 GAGGCTGGAGAGAGTGAGCCAGG + Intronic
1175273893 20:57754446-57754468 GAGGCAGGAAGGAGGGAGGGAGG - Intergenic
1175273899 20:57754461-57754483 GAGGGAGGAGGGAGGGAGGCAGG - Intergenic
1175984067 20:62755461-62755483 GAGGATGGATGGAGGGAGGGAGG - Intronic
1175984137 20:62755663-62755685 GAGGATGGATGGAGGGAGGGAGG - Intronic
1175984197 20:62755834-62755856 GAGGATGGATGGAGGGAGGGAGG - Intronic
1176049128 20:63107414-63107436 GAGGCTGGACTGGGGACAGCTGG + Intergenic
1176286650 21:5022341-5022363 GAGGCGGGACAGAGGCAGGTCGG - Intergenic
1178108014 21:29342644-29342666 GAGGCAGCACTGCTGGAGGCCGG - Exonic
1178628422 21:34238296-34238318 GAGGCTGGAGGGTGGGAGGAGGG + Intergenic
1179488401 21:41725687-41725709 GAGGCTGAGCTGAGGGGGGTGGG - Intergenic
1179544515 21:42105362-42105384 GAGGATGGGAGGAGGGAGGCAGG - Intronic
1179643162 21:42760314-42760336 GACGCAGAACTGCGGGAGGCAGG - Exonic
1179870531 21:44241134-44241156 GAGGCGGGACAGAGGCAGGTCGG + Intergenic
1179875206 21:44263452-44263474 GAGGCTGGGCTGTGGGTGGGGGG - Intergenic
1179945223 21:44669598-44669620 GAGCCTGGACTGAGGCTGCCAGG + Intronic
1180151559 21:45950797-45950819 AGGGCTGGAGGGAGGGAGGCGGG - Intergenic
1180844783 22:18975136-18975158 CAGGCTGCTCTGAGTGAGGCTGG - Intergenic
1181051353 22:20239613-20239635 GAAGCTGGCCTGAGGGCGACAGG + Intergenic
1181056684 22:20263576-20263598 CAGGCTGCTCTGAGTGAGGCTGG + Intronic
1181084142 22:20431609-20431631 GCGGCTGGAGTGCGGGACGCGGG - Intronic
1181295504 22:21835201-21835223 GAGGCTGAACTGAGGGAGGAAGG + Intronic
1181458122 22:23070850-23070872 GAGGGTGGACAGAGGGCGCCGGG + Intronic
1181884597 22:26010254-26010276 GAGGATGGACTAAAGGAGGGTGG - Intronic
1182026222 22:27121345-27121367 AATGCTGGAGTCAGGGAGGCTGG - Intergenic
1182624185 22:31634050-31634072 GTGGCTTGACTGAGGCAGGGAGG - Intronic
1182638773 22:31750266-31750288 GGGGCGGGGTTGAGGGAGGCTGG - Intergenic
1182715511 22:32353967-32353989 GTGGCTGTACTGCCGGAGGCAGG - Intergenic
1182862936 22:33576455-33576477 GAGGTGGGAGTGAGGGAGGTGGG + Intronic
1183107757 22:35627213-35627235 GAGGCAGGGCAGAGGGAGACAGG + Intronic
1183179904 22:36253005-36253027 GGGGCTGGACTGAAGGTGGAGGG + Intronic
1183348608 22:37321588-37321610 GAGGGTGGACAGTGGGAGGACGG + Intergenic
1183379545 22:37484161-37484183 GGGGGTGGGCTGGGGGAGGCGGG - Intronic
1183391106 22:37546136-37546158 GGGGCGGGGCTGAGGGAGCCAGG - Intergenic
1183411106 22:37655493-37655515 GAGGCCGGGCTGGGGGAGGCTGG - Exonic
1183411114 22:37655508-37655530 GAGGCTGGACCTGGGGAGGCCGG - Exonic
1183411119 22:37655523-37655545 GAGACTGGGCTGGGGGAGGCTGG - Exonic
1183470760 22:38005223-38005245 GAGGCTGGAGTGAAGGACGTTGG - Intronic
1183579067 22:38712407-38712429 GAGGCTGGGCAGAGGAAGGCAGG + Intronic
1183598617 22:38827029-38827051 GAGGCAGGGCTGAGGAGGGCTGG + Intronic
1183636652 22:39067719-39067741 GAGGCTGGTATGAGGGGTGCAGG + Intronic
1183742405 22:39676060-39676082 GAGGCTGGAGGCAGGGAAGCTGG + Intronic
1183931035 22:41236424-41236446 GGGGCTTGACTGAGAGTGGCTGG + Intronic
1184002029 22:41682135-41682157 GAGGCTGGACATAGGGTGGACGG + Intronic
1184113095 22:42406601-42406623 GCACCTGGAATGAGGGAGGCAGG - Intronic
1184258520 22:43301255-43301277 GAGGATGGACAGAGGCAGGATGG - Intronic
1184293244 22:43509158-43509180 GATGATGGACGGAGGGAGGGAGG - Intergenic
1184326842 22:43794754-43794776 GAGACTGGAATGGGGGAGGAGGG - Intronic
1184465982 22:44669044-44669066 GAGGCTGGGGTGGGAGAGGCTGG - Intronic
1184995997 22:48208070-48208092 GAGGCTGGTGTGACGCAGGCAGG - Intergenic
1185005917 22:48276997-48277019 GAGGATGGGCTGGAGGAGGCAGG - Intergenic
1185017697 22:48354503-48354525 TAGGTTAGGCTGAGGGAGGCAGG + Intergenic
1185041285 22:48505733-48505755 GAGGGTGGTCTCAGGGATGCTGG - Intronic
1185058333 22:48592654-48592676 GAGGAGGGAGTGAGGGAGGGAGG - Intronic
1185332251 22:50257044-50257066 GAGGCTGCAGGGAGGCAGGCAGG - Intronic
1185410374 22:50678506-50678528 GAGGCTTGCCGGAGGAAGGCGGG + Intergenic
950043444 3:9934377-9934399 GAGGCTTCACTGAAGGAGTCAGG - Intronic
950202805 3:11056889-11056911 GAGGCTGGACTGGAGGGGGCGGG - Intergenic
950654723 3:14429411-14429433 GATCCTGGACTTAGTGAGGCTGG + Intronic
950969672 3:17173812-17173834 GAGGTGGGATTAAGGGAGGCAGG + Intronic
951617705 3:24566884-24566906 GAGGGTGAACTGAAGCAGGCGGG + Intergenic
951703880 3:25524625-25524647 GAGGGAGGAAGGAGGGAGGCAGG - Intronic
952430221 3:33216565-33216587 GAGCCTGGAGTGAGGGAAGCTGG - Intronic
952622161 3:35358797-35358819 GAGGCTGGGTTTAGAGAGGCAGG + Intergenic
952760088 3:36905823-36905845 GAAAGGGGACTGAGGGAGGCAGG - Intronic
953357346 3:42266211-42266233 GAGGGTGGAGTGGGCGAGGCGGG + Intergenic
953745214 3:45568782-45568804 GAGGGTGGAGGGAGGGAGGAGGG - Intronic
953755560 3:45643081-45643103 GTGGCCTGTCTGAGGGAGGCTGG + Intronic
953880940 3:46690996-46691018 GAGGCTGCAGAGAGAGAGGCAGG + Intronic
953913958 3:46906304-46906326 CAGCCTGGGCTGAGGGAGACAGG - Intergenic
954143790 3:48623999-48624021 GAGGCAGGCCTGTGGGAGGCAGG - Intergenic
954291755 3:49653634-49653656 GAGGCTGAGCTGGGGGAGGCAGG - Exonic
954292323 3:49656186-49656208 GCCGCAGGACTGAGGCAGGCTGG - Exonic
954849859 3:53591062-53591084 GAGGCAGGACTGAGTGATGTGGG - Intronic
956241428 3:67134991-67135013 AAGGATGGATAGAGGGAGGCAGG - Intergenic
957201853 3:77146278-77146300 GAGGGTGGAGAGAGGGAGGAAGG + Intronic
957444280 3:80294883-80294905 GAGGCTGAGGTGGGGGAGGCGGG - Intergenic
958616054 3:96494430-96494452 GAGGCAGGGCTGAAGGAGGAGGG - Intergenic
958751146 3:98194204-98194226 GAGGCTGGAATGAGGGGTGCAGG - Intronic
960506553 3:118501321-118501343 CAGGAGGGAGTGAGGGAGGCAGG - Intergenic
960658135 3:120028750-120028772 GAGGCTGGGCAGAGAGAGGTTGG + Intronic
961377429 3:126476048-126476070 GAGGCTGGGCTGCGGGGCGCCGG + Intergenic
961379608 3:126488330-126488352 GAGGCTGGCCTGACTGAGCCAGG - Intronic
961483978 3:127204764-127204786 GAGGCTGGGCTGAGGTAACCTGG - Intergenic
961490482 3:127253870-127253892 GAGGCTGGACTGTGCTGGGCAGG - Intergenic
961543818 3:127618333-127618355 GAGGCAGAAGTGAGGGAGGTGGG - Intronic
961645201 3:128389126-128389148 GAGGCTGGAGGGAGGCAGGCAGG + Intronic
965211650 3:165797328-165797350 GAGACTGGAGGGAGGGAGGGAGG - Intronic
965590751 3:170358080-170358102 GCTGCTGGACTGGGGGAGGGGGG - Intronic
965605042 3:170489955-170489977 GGGGCTGGACGGGGGGAGGTGGG + Intronic
966815212 3:183884814-183884836 GAGGCTGGGCGCAGAGAGGCTGG - Exonic
967122125 3:186391526-186391548 AAGGCTGGAATGAGTGATGCAGG + Intergenic
967244012 3:187468709-187468731 GAGGCTGGTATGAGGGGTGCAGG + Intergenic
967640430 3:191856340-191856362 GAGAGTGGACTGTGGGAGGAGGG - Intergenic
967818663 3:193819797-193819819 GAAGCTTGACTGAAGAAGGCAGG - Intergenic
967959060 3:194904995-194905017 GAGGGTGGACGGTGGGAGGAGGG - Intergenic
968010638 3:195271639-195271661 GAGGCCGAGCGGAGGGAGGCTGG + Intergenic
968074246 3:195807886-195807908 GAGGCTGGCCTGGCAGAGGCTGG - Intronic
968529972 4:1086579-1086601 GAGGATGGCATGAGGGTGGCAGG + Intronic
968567579 4:1322304-1322326 GAGGCTGGGGTGTGGGAGGGTGG + Intronic
968892154 4:3375114-3375136 GGGGCCAGACTGAGGGAGACAGG + Intronic
969208690 4:5669629-5669651 GAAGCAGGAGGGAGGGAGGCAGG - Intronic
969379224 4:6783104-6783126 GGGGCCAGCCTGAGGGAGGCCGG + Intronic
969423595 4:7111121-7111143 GAAGCTGGACTCAGGAGGGCTGG + Intergenic
969653914 4:8485215-8485237 GAGGCTGGGATGAGGGGTGCAGG + Intronic
969709984 4:8837190-8837212 GAGGCTGGACTGGAAGATGCTGG + Intergenic
969733873 4:8974061-8974083 GATATTGGACTGAGGGAGACCGG + Intergenic
969967088 4:11008068-11008090 GAGGCTGGACAGAGGGAGTGAGG + Intergenic
970379765 4:15495064-15495086 GAGGGTGGAGGGTGGGAGGCAGG - Intronic
970444844 4:16115018-16115040 CAGGCTGGTCTGCGAGAGGCAGG + Intergenic
970900229 4:21150341-21150363 GAGGCAGGACTGAGGCAGAGAGG + Intronic
971028000 4:22607523-22607545 GAGGCTGGGCTGCAGGTGGCAGG - Intergenic
971217660 4:24675934-24675956 GTGGCTGGGCTGAGGGTGGCAGG - Intergenic
973818618 4:54642048-54642070 GAGGCGGGAATGATGGAGGATGG + Intergenic
973844107 4:54893472-54893494 TAAGGTGGACTGAAGGAGGCTGG - Intergenic
974239760 4:59231658-59231680 GAGGGTGGACGGTGGGAGGATGG - Intergenic
974409188 4:61517261-61517283 GAGGCGGGACTGAGGTGAGCAGG + Intronic
975081499 4:70285853-70285875 GAGGCTGGACAGATAGATGCTGG - Intergenic
975969422 4:80015807-80015829 AAGGATGGAATGAGGGAGGGAGG + Intronic
976503652 4:85820484-85820506 GAGGCTGGAAGGAGGGAGCAGGG + Intronic
976765153 4:88591861-88591883 AAGGCGGGCCTGGGGGAGGCTGG - Intronic
976914074 4:90348115-90348137 GAGGCTGGAGGGTGGGAGGAGGG + Intronic
976980015 4:91216195-91216217 GAGGCAGGCCTGGAGGAGGCAGG - Intronic
977435655 4:96990827-96990849 AAAGGTGGACTGAGGGAGGTGGG + Intergenic
978402901 4:108349717-108349739 GAGGCTGAGGTGAGGGAGGTGGG + Intergenic
978769743 4:112442464-112442486 GAGGGTGGACAGTGGGAGGAGGG + Exonic
979279781 4:118852717-118852739 GAGGCTGGAGGGTGGGAGGAGGG + Intronic
979994792 4:127417988-127418010 GAGCCTGGTCTGGGGAAGGCAGG - Intergenic
980196520 4:129596102-129596124 GGGGAGGGACTGAGGGAGGGGGG + Intergenic
980575459 4:134680350-134680372 GAGGCTGGGATGAGGGGTGCAGG + Intergenic
980746813 4:137028757-137028779 GAGGCTGGAGTGTGGGACGAGGG - Intergenic
980966727 4:139528799-139528821 GAGGCTGGGCTTAGGGGGCCAGG - Intronic
981811828 4:148784265-148784287 CAGGATGGACTGATGGTGGCGGG + Intergenic
982260363 4:153488985-153489007 GAGGCTGGACTGGAGTAGGGTGG - Intronic
982485450 4:155959755-155959777 GAGGCTGGATTGTGGGGAGCAGG - Intergenic
982763586 4:159317471-159317493 GAGGCTGGGCTGATGGAAGCAGG + Intronic
983541332 4:168913989-168914011 GAGGATGGCCTGAGGGAGACCGG - Exonic
983746413 4:171205542-171205564 GAGGATGGAGTGTGGGAGGAGGG + Intergenic
984812563 4:183807691-183807713 GAGGCTGAGCTGGGGGAGGTGGG + Intergenic
984820659 4:183879184-183879206 GAGGCTGGCCTGAGGCTGCCTGG - Intronic
985092399 4:186377810-186377832 GAGGGTGGAGGGAGGGAGGAGGG - Intergenic
985466708 4:190203623-190203645 GTCGCTGGGCTGAGGGTGGCGGG - Intergenic
985467721 5:13054-13076 GTCGCTGGGCTGAGGGTGGCGGG + Intergenic
985625202 5:982116-982138 GAGGTGGGGCTGAGGCAGGCAGG - Intergenic
985655830 5:1130955-1130977 GAGGGTGGTCTGAGGGCTGCTGG + Intergenic
985664604 5:1175478-1175500 GAGGCTGGGATTGGGGAGGCTGG + Intergenic
985710661 5:1426775-1426797 GGGGCTGCAGTGAGGGAGGATGG + Intronic
985878741 5:2620805-2620827 GAGTATGGACTGAGGGGGGCAGG + Intergenic
985993794 5:3584987-3585009 GAGGAAGGAAAGAGGGAGGCAGG + Intergenic
985993828 5:3585118-3585140 GAGGAAGGAAAGAGGGAGGCGGG + Intergenic
985997423 5:3604761-3604783 GAAGCTGGAGTGAGGGAGGGAGG + Intergenic
986241426 5:5963417-5963439 GAGGGTGAACTGAAGCAGGCAGG + Intergenic
986285297 5:6354490-6354512 GAGGCTGGAGGGAGACAGGCTGG + Intergenic
986346134 5:6837130-6837152 CTGGCTGGAGTCAGGGAGGCTGG + Intergenic
986503913 5:8429896-8429918 GAGTGGGGGCTGAGGGAGGCTGG - Intergenic
986908758 5:12527704-12527726 GAGGGTGGAGTGTGGGAGGAGGG - Intergenic
986936884 5:12900128-12900150 GAGGATGGAGAGAGGGAGGGAGG + Intergenic
987002164 5:13670751-13670773 GAGGGTGGAGTGTGGGAGGAGGG + Intergenic
987939287 5:24511983-24512005 GAGGCTGGAGGGTGGGAGGAGGG + Intronic
988689028 5:33553713-33553735 GAGGGTGGAGTGTGGGAGGAGGG + Intronic
989251405 5:39319740-39319762 GAGGCTGAACTCATGAAGGCTGG - Intronic
989643130 5:43602926-43602948 GAGGCTGGGCTGGGGGCCGCAGG + Intronic
990731078 5:58810144-58810166 GAGACTGGACTGAAGGAGGAGGG - Intronic
990823947 5:59875959-59875981 GAGGCTGGAGGGTGGGAGGAGGG + Intronic
991183183 5:63778187-63778209 GAGGCTGGAGGGTGGGAGGAAGG - Intergenic
991222001 5:64227456-64227478 GAGGCTGCTCTGAGGAGGGCGGG - Intronic
992616118 5:78547846-78547868 CAGGGTGGTCTGAGGGAGACTGG + Intronic
993219702 5:85076405-85076427 GAGGGTGGAGTGTGGGAGGAGGG - Intergenic
993347059 5:86797485-86797507 GAGGATGGAGTGTGGGAGGAGGG - Intergenic
994558465 5:101334617-101334639 GAGGGTGGAATGTGGGAGGAGGG + Intergenic
994842613 5:104946086-104946108 GAGGGTGGACAGTGGGAGGAGGG - Intergenic
995516576 5:112960157-112960179 GAGGTTGGAGTGAGGGTGGAGGG + Intergenic
995593330 5:113722706-113722728 GAGGCTGGACATGGGGAGGTTGG + Intergenic
996159692 5:120147178-120147200 GAGGGTGGAGTGTGGGAGGAGGG + Intergenic
996430571 5:123371617-123371639 GAGGATGGCCTGAAGGAAGCTGG + Intronic
997283853 5:132664767-132664789 TAGGCTGGTCTGAGGGGTGCTGG - Intergenic
997528880 5:134570224-134570246 GACGCTGTCCTGAGGGAGGCAGG - Intronic
997693454 5:135843433-135843455 GACTCAGGAGTGAGGGAGGCAGG + Intronic
997713717 5:136027416-136027438 GGGGCTTGAGTGAGGGACGCGGG - Intergenic
997770463 5:136548767-136548789 GAGGCTGGGATGAGGGGTGCAGG + Intergenic
998417278 5:141955226-141955248 GTGGCTGGCCTGTGGCAGGCTGG + Exonic
998424049 5:142012473-142012495 GGGGCAGGGATGAGGGAGGCGGG - Exonic
998650794 5:144119097-144119119 GAGGAAGGAGTGAAGGAGGCTGG + Intergenic
998899600 5:146838905-146838927 GAGGCTGTAGTGAGGAAGACTGG - Intronic
999432533 5:151536575-151536597 GAGGCTGGGCTGTGAGAGTCTGG - Intronic
999618703 5:153452146-153452168 GAGGCTGGGATGAGGGGTGCAGG + Intergenic
999742682 5:154568540-154568562 GAGGCTGGACTGGGGGTGGGAGG + Intergenic
1000373732 5:160560601-160560623 GAAACAGGACTGAGGGTGGCAGG - Intergenic
1001092395 5:168751042-168751064 GAGGCTAGGGGGAGGGAGGCTGG + Intronic
1001150985 5:169226977-169226999 GTGATAGGACTGAGGGAGGCAGG - Intronic
1001250433 5:170142931-170142953 GGGAGGGGACTGAGGGAGGCAGG - Intergenic
1001296907 5:170504705-170504727 GAGTCCGGACTAAGGGAGGCAGG - Intronic
1001323232 5:170700037-170700059 GAGGCAGGTATGTGGGAGGCAGG - Intronic
1001429139 5:171645832-171645854 GGGCCTGGGCTGAGGGAGGAAGG + Intergenic
1001547866 5:172581631-172581653 GAGGCTGGAGGGAAGGAGGGAGG - Intergenic
1001596252 5:172900784-172900806 GCGGCTGGAGAGAGGGAGGGAGG + Intronic
1001867828 5:175120833-175120855 GAGACTGGAGTGAGGGACGCTGG - Intergenic
1001898896 5:175406173-175406195 GAGGGTGGACGGTGGGAGGAGGG - Intergenic
1002073801 5:176696406-176696428 GGGGCTGGACTGGGGAAGGCAGG + Intergenic
1002076756 5:176712964-176712986 GAGGCTGTAGTGAGAGAGGAGGG + Intergenic
1002079541 5:176729131-176729153 GGGGCTGGGGTGCGGGAGGCCGG - Intergenic
1002319972 5:178369160-178369182 TAGGCAGGCCTCAGGGAGGCTGG + Intronic
1002340733 5:178515263-178515285 GAGGCTGCAGGGAGGGAGGCTGG - Intronic
1002424666 5:179168008-179168030 GAGGCTGGTCTGAGGCAGGAGGG - Intronic
1002492458 5:179588378-179588400 GAGGCTGGAATGAGGAGGGATGG + Intronic
1002566009 5:180113268-180113290 GAGGATGGACGGAGGGATCCAGG + Intronic
1002566039 5:180113344-180113366 GGGGATGGACTGAGGGATCCGGG + Intronic
1003148726 6:3530829-3530851 GATGGTGGCCTGAGTGAGGCTGG + Intergenic
1003337285 6:5185927-5185949 GAGGCAGGAGTGAGGAGGGCTGG + Intronic
1003445279 6:6178125-6178147 GGGGCTAGACTGAGGGAAGGAGG + Intronic
1003512238 6:6791179-6791201 GAGGCTGGAAAGAGAGGGGCAGG + Intergenic
1003535003 6:6969100-6969122 GAGGGTGCCCTGAGGGAGGGAGG - Intergenic
1006285744 6:33092566-33092588 AAGGCTGGGCTGAGGGGGCCAGG - Intergenic
1006341282 6:33448546-33448568 GAGGGAGGCCAGAGGGAGGCTGG - Intronic
1006491942 6:34395105-34395127 GAGGCTTAACTAAAGGAGGCTGG + Intronic
1006620280 6:35359163-35359185 GTGGCTGGACAGAGGGAGGGAGG + Intronic
1006799133 6:36748305-36748327 GAGGCAGGGCTGTGGGAGGGGGG + Intronic
1007010122 6:38408831-38408853 GAGAATGGACTGAGTGAGGGAGG - Intronic
1007599213 6:43071468-43071490 CAGGCTGGACTGAAGGGGTCTGG - Intronic
1007607239 6:43125856-43125878 GGGGCTGGAATGAGACAGGCTGG - Intronic
1008323975 6:50154302-50154324 GAGGGTGGATGGAGGGAGGAGGG - Intergenic
1008365663 6:50676829-50676851 GAGGCTGGAGTCACCGAGGCTGG + Intergenic
1008863250 6:56176951-56176973 GAGGAAGGAATGAGGGAGGCAGG + Intronic
1009247394 6:61256190-61256212 GAGGCTGGAGGGTGGGAGGAGGG - Intergenic
1009609307 6:65919583-65919605 GAGGGTGGAGTGTGGGAGGAGGG - Intergenic
1012231185 6:96762636-96762658 GAGGGAGGACTGAGGGTAGCTGG - Intergenic
1012487281 6:99736437-99736459 CAGGATGTACTGAGTGAGGCTGG - Intergenic
1012499710 6:99875131-99875153 GAGGCTGCAATGAGGGAAGTGGG + Intergenic
1012630305 6:101458490-101458512 GAGGCTGCACTGCAGGAGGCTGG - Intronic
1013605824 6:111746812-111746834 GAGGGTAGAGGGAGGGAGGCAGG + Intronic
1013637691 6:112044699-112044721 GAGGCTGGACTGGGGGAGGTAGG + Intergenic
1013754214 6:113441820-113441842 GAGGGAGGACTGGGGGAGGGAGG + Intergenic
1013843537 6:114424914-114424936 GAGGCTGGGATGAGGGATGCAGG + Intergenic
1013891880 6:115035153-115035175 GAGGCTGGGATTAGGGATGCAGG - Intergenic
1015275014 6:131375344-131375366 GAGGCTGGGCTGGAGGAAGCTGG - Intergenic
1016113979 6:140259886-140259908 GAGGCTGGGATGAGGGGTGCAGG + Intergenic
1016368279 6:143342256-143342278 GAGGCTGGGCGCAGAGAGGCTGG + Intergenic
1016389032 6:143556992-143557014 GAGGCTGGGGTTAGGGAGGGAGG - Intronic
1016791975 6:148075658-148075680 GAGGAAGGAGTGAGGGAGGGAGG - Intergenic
1017088849 6:150740394-150740416 GATGCTGGACTAAAAGAGGCAGG + Intronic
1017545919 6:155450617-155450639 GAGGCTGCGCTGGGGGAGGTAGG + Intronic
1017609361 6:156168059-156168081 CAGGCTGGAGGGAGGGAGGAAGG + Intergenic
1017734980 6:157354609-157354631 GAGGCTGAACAGTGGGAGGATGG - Intergenic
1017788585 6:157775919-157775941 GAGGATGGAATGAGGGAGGTTGG + Intronic
1018135880 6:160778153-160778175 GAGGCTGGGATGAGGGGTGCAGG - Intergenic
1018298200 6:162372020-162372042 GAGGCTGGACAGAGGGCATCTGG - Intronic
1018456756 6:163960396-163960418 GACGCTGGAGTCAGGAAGGCTGG + Intergenic
1018639044 6:165890024-165890046 GAGGGAGGAGTGAGGGAGGGAGG - Intronic
1018991802 6:168679418-168679440 GAGGCTGGGATGAGGGGTGCAGG + Intergenic
1019260824 7:81026-81048 GGGGCTGATCAGAGGGAGGCCGG - Intergenic
1019273188 7:162028-162050 GAGCCTGGACTGAGGCTGCCTGG + Intergenic
1019273561 7:164181-164203 GAGGTTGGACTCAGACAGGCAGG + Intergenic
1019443566 7:1059641-1059663 GAGGCAGGTCTTAGGGGGGCGGG + Intronic
1019443638 7:1059888-1059910 GAGGCGGGTCTTAGTGAGGCGGG + Intronic
1019443640 7:1059903-1059925 GAGGCGGGTCTTAGTGAGGCAGG + Intronic
1019443679 7:1060039-1060061 GAGGCGGGTCTTAGTGAGGCGGG + Intronic
1019549614 7:1595416-1595438 GAGGATGGATGGAGGGAGGATGG - Intergenic
1019742562 7:2682140-2682162 CAGGCTGGGCACAGGGAGGCTGG + Intronic
1019926446 7:4196268-4196290 GAGGGTGGTCTGAGCGAGGGCGG - Intronic
1020014038 7:4820751-4820773 CAGGCTGGACTGAGGGCGCGTGG - Intronic
1020280913 7:6649592-6649614 GAGCCTGGCCTGGGGCAGGCTGG + Intronic
1021386134 7:20033176-20033198 GAGGTAGGAATGAGGGAGGAAGG + Intergenic
1021609355 7:22442758-22442780 GAGGCAAGGCTGAGAGAGGCAGG + Intronic
1021889932 7:25177950-25177972 GAGGGTGGAGAGAGGGAGGAAGG - Intronic
1021913132 7:25406082-25406104 GAGGCAGGAATGAGAGAGGAGGG + Intergenic
1022131543 7:27409377-27409399 GATACTGGAGTGAGGGAGGCCGG - Intergenic
1022228743 7:28392122-28392144 GAGGGTGGACGGAGGGAGGAAGG + Intronic
1022756678 7:33300229-33300251 GAGACTGGAGAGAGGGAGGAAGG - Intronic
1022791147 7:33690485-33690507 GAGGCTGAAGTCAGGGAGACAGG - Intergenic
1023647069 7:42328894-42328916 AAGCCTGGACTGAGGGAGACAGG + Intergenic
1024044787 7:45579307-45579329 GAGGCTGGGGAAAGGGAGGCAGG - Intronic
1024578886 7:50785668-50785690 GAGGCTGGAAGGAGGGAACCTGG - Intronic
1025276001 7:57581380-57581402 GAGGCTGGACTTTGGAAGGTGGG + Intergenic
1026004782 7:66592085-66592107 GAGGCTGGAATGTGGGACGAAGG + Intergenic
1026024187 7:66732052-66732074 CAGGCTGGGCTGGGGGTGGCTGG - Intronic
1026888911 7:73970944-73970966 CAGGCTGGGCTGGGGGTGGCAGG - Intergenic
1026892717 7:73991942-73991964 GGGGATGGAGTGAGGGTGGCAGG + Intergenic
1026931039 7:74223123-74223145 GTGGCTGGAGAGAGGGAGGGAGG - Intronic
1027158482 7:75785196-75785218 GAGGCTGGGATGAGGGGTGCAGG - Intronic
1027247584 7:76377722-76377744 GGAGCTGGACTCAGAGAGGCAGG + Intergenic
1027775083 7:82454929-82454951 GAGGCTGGACTGAGTGCTGCTGG + Intergenic
1028170326 7:87588324-87588346 GAGGGTGGAGTGTGGGAGGAGGG - Intronic
1028589730 7:92482225-92482247 GAGGCTGGGATGAGGGGTGCAGG + Intergenic
1029348624 7:99997206-99997228 GAGGAAGGACAGAGGGAGGGAGG - Intergenic
1029634946 7:101777465-101777487 GGGGCAGGACAGAGGGAGGTGGG + Intergenic
1029731975 7:102444503-102444525 GAGGCTGGAGGGTGGGGGGCGGG - Intronic
1029818322 7:103120147-103120169 GAAGCTGGAGTGAGGGAAGCTGG - Exonic
1030311178 7:108070940-108070962 GAGCCTGGAATTTGGGAGGCAGG - Intronic
1031081785 7:117265135-117265157 GAGGCAGGAGAGAGGGAGGAGGG - Intergenic
1031243982 7:119283134-119283156 TAGGCTGGACTGAGAGGTGCTGG + Intergenic
1031422302 7:121566428-121566450 GAGGCTGGGATGAGGGGTGCAGG + Intergenic
1031979392 7:128115042-128115064 CAGGCTGGACACAGGGAGGGAGG - Intergenic
1033341523 7:140495830-140495852 GTGGCTGGACCCAGGGAGCCAGG + Intergenic
1033428967 7:141271203-141271225 GAGGCTGGAGTTGGGGTGGCAGG + Intronic
1033537890 7:142328839-142328861 GAGTCTGGGGTGAGGGAGGAGGG - Intergenic
1034275977 7:149824046-149824068 CAGGGTAGACTAAGGGAGGCAGG - Intergenic
1034417357 7:150972097-150972119 GAGGCTAGACTGGGGGAGTGTGG - Intronic
1034451508 7:151139446-151139468 GAGTCTGGAAGGAGGAAGGCAGG + Intronic
1034577499 7:152013191-152013213 GAGGGTGGACTGTGGGAGGAGGG + Intronic
1034577668 7:152015023-152015045 GAGGGTGGACTGTGGGAGGAGGG + Intronic
1034584424 7:152076567-152076589 GAGGCTGGATTTAAGGAAGCTGG + Intronic
1034993173 7:155560768-155560790 GCGACTGGAGTGAGGGAGGGGGG + Intergenic
1035143112 7:156784365-156784387 GAGAGTGGACGGAGGCAGGCAGG + Intronic
1035275417 7:157745377-157745399 GGGGGTGGTCTGCGGGAGGCAGG + Intronic
1035401650 7:158569940-158569962 GGCGCGGGGCTGAGGGAGGCCGG - Intronic
1035537325 8:402228-402250 GAGGCTGGAGGGTGGGAGGAGGG + Intergenic
1035537826 8:406276-406298 GCGGCTGGAGGGAGAGAGGCAGG - Intergenic
1035971916 8:4258416-4258438 GAGGATGGAAGGAGGGAGGGAGG + Intronic
1036208452 8:6822794-6822816 GTGCCTAGACTGAGGGAGGAGGG + Intronic
1036549842 8:9806213-9806235 GAGGCTGGGATGAGGGGTGCAGG - Intergenic
1036571135 8:9980558-9980580 GAGGAGGGATTGAGGGAGGAGGG - Intergenic
1036620673 8:10422985-10423007 TGTGCTGGACAGAGGGAGGCAGG - Intronic
1036671373 8:10790706-10790728 GGGGCCAGACTGAGGCAGGCAGG - Intronic
1036773229 8:11592843-11592865 GTGGCTGGGGTGAGGGAGGCGGG + Intergenic
1036820256 8:11934353-11934375 GTTTCTGGACTGAGGGAGACCGG - Intergenic
1037490884 8:19396040-19396062 GGGACTGGACTGAGGTGGGCGGG - Exonic
1037491766 8:19403004-19403026 GAGGGTGGACTGTGGGAGGAGGG + Intergenic
1039883970 8:41645285-41645307 GGGGGTGGGCTGGGGGAGGCGGG - Exonic
1040014477 8:42689732-42689754 GAGGCTGGGTGGGGGGAGGCAGG - Intergenic
1040538205 8:48328233-48328255 GAGGCTGGAGGGTGGGAGGAAGG + Intergenic
1040799004 8:51320863-51320885 GAGGCACGCCTGAGGCAGGCAGG - Exonic
1041020253 8:53631717-53631739 GAGGAAGGAATGAGAGAGGCAGG + Intergenic
1041207381 8:55512394-55512416 GAGGCAGGGCTGAGGAGGGCTGG - Intronic
1041220106 8:55642240-55642262 GAGGCTGGAGGGTGGGAGGAAGG - Intergenic
1041577296 8:59413508-59413530 AAGGGTGGAGAGAGGGAGGCAGG + Intergenic
1041738655 8:61136685-61136707 GAGGGTGGAGTGTGGGAGGAGGG + Intronic
1041921474 8:63187025-63187047 GAGGCTGCACTTGGTGAGGCTGG - Exonic
1044065410 8:87692960-87692982 GAGGGTGGAGTGTGGGAGGAGGG - Intergenic
1044499518 8:92936459-92936481 GAGGATGAACAGAGGGAGGCAGG + Intronic
1044545957 8:93459672-93459694 GAGGGTGGACGGTGGGAGGAGGG - Intergenic
1044832367 8:96262266-96262288 GAGGCGGGAGGGAGGGTGGCGGG + Intronic
1045428932 8:102095255-102095277 GCAGATGGAGTGAGGGAGGCAGG + Intronic
1045494790 8:102699274-102699296 GAGGAAGCACTGAGGGAGCCTGG + Intergenic
1046004744 8:108464977-108464999 GAGTCTGGAGTGAGGCAGGGGGG + Intronic
1046072029 8:109267267-109267289 GAGGGTGGAGGGAGGGAGGAGGG - Intronic
1047433284 8:124812028-124812050 GAGGCTGGAGAGTGGGAGGAGGG - Intergenic
1047896585 8:129373222-129373244 AAGGCTGCAGTGAGGGAGGAGGG - Intergenic
1047953669 8:129956820-129956842 GAGGCTGGGGGGAGGGAGGGAGG - Intronic
1047966770 8:130050803-130050825 GAGGCTGGGCTGTCGGGGGCTGG + Intergenic
1048314767 8:133353879-133353901 GATGCTTGGCTGAGGGCGGCAGG - Intergenic
1048336085 8:133503512-133503534 GGGGCTGGACGGAGGGAGGAAGG - Intronic
1048436083 8:134419164-134419186 GAGGATGGACAGTGGGAGGAGGG + Intergenic
1049051587 8:140201147-140201169 GAGGCGGGACTGTGGCCGGCTGG + Intronic
1049202122 8:141345599-141345621 TTTGCTGGACTGCGGGAGGCCGG - Intergenic
1049206757 8:141367155-141367177 GAAGCTGGGGAGAGGGAGGCTGG + Intronic
1049472572 8:142782956-142782978 GAAGCTGGACTGGAGGGGGCGGG + Intergenic
1049765465 8:144353357-144353379 CAGGCTGGACTGAGAGGAGCTGG + Exonic
1049791860 8:144475843-144475865 GAGGCCGGGCTGGGGCAGGCGGG + Exonic
1050318728 9:4429293-4429315 GAGGCTGGAGAGAGGGAGGTAGG - Intergenic
1051183726 9:14437949-14437971 GAGGCAGGACTCTGGGAGGAGGG - Intergenic
1051309974 9:15759106-15759128 AAGGCTGGAGAGAGGGAGGGAGG - Intronic
1052632974 9:31064521-31064543 GAGGCTGGTGTTAGGGAGGATGG + Intergenic
1054823048 9:69543213-69543235 GAGCCTGGACTGCGGGCTGCTGG + Intronic
1055874967 9:80931468-80931490 GAGGCTGGAGGGTGGGAGGAGGG + Intergenic
1056430943 9:86527020-86527042 GAGGCAGGAGTGAGGGAGCCAGG - Intergenic
1056587392 9:87937759-87937781 GAGGCTGGACTTTGGAAGGTGGG - Intergenic
1056609485 9:88115183-88115205 GAGGCTGGACTTTGGAAGGTGGG + Intergenic
1056760133 9:89408678-89408700 GAGGCAGGCCTGCGGCAGGCAGG + Intronic
1057379129 9:94553448-94553470 GAGGCTGGACTTTGGAAGGTGGG - Intergenic
1057380685 9:94564660-94564682 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1057893672 9:98889140-98889162 GAGGCTGGAGTTGGGGAGGTTGG + Intergenic
1058138483 9:101334040-101334062 GAGGCTGGAGTGCGGGTGGGAGG - Intergenic
1058503835 9:105649046-105649068 GAGGTTGGAATGAGGGAGGCAGG + Intergenic
1058665123 9:107306517-107306539 GATGCTGGAGTGATGGATGCAGG - Exonic
1058739986 9:107933360-107933382 GATGCTGGAATGTGGGGGGCGGG - Intergenic
1058769562 9:108216966-108216988 GTGGCTGGAGGGCGGGAGGCAGG + Intergenic
1058826672 9:108781512-108781534 GAGGCTGGCCTGAGGAAGCCAGG - Intergenic
1059207912 9:112483828-112483850 GAGGATCGACTGAGGCAGGGAGG + Intronic
1059247239 9:112858880-112858902 AAGGTGGGGCTGAGGGAGGCAGG - Intronic
1059770238 9:117416955-117416977 AAGGAGAGACTGAGGGAGGCAGG - Intergenic
1060252476 9:121997385-121997407 GGGGCTGGACAGAGGCTGGCTGG - Intronic
1060863895 9:126979623-126979645 GCTGCTGGAAGGAGGGAGGCGGG + Intronic
1060994667 9:127869204-127869226 GTAGCTGGATTGAGCGAGGCAGG - Intronic
1061210524 9:129189744-129189766 GAGGCTGGACTGACAGGGGGAGG + Intergenic
1061226763 9:129284925-129284947 GGGGGTGGCCTGAGGGTGGCCGG + Intergenic
1061306139 9:129734450-129734472 GAGCCTCGATTCAGGGAGGCAGG - Intergenic
1061492592 9:130954330-130954352 AAGGCTGAAATGAGGGAGGCAGG - Intergenic
1061517113 9:131096441-131096463 GAGGCGGGAGGGAGGGAGGGAGG + Intergenic
1061578748 9:131523938-131523960 GAGCCTGGACGGACGGGGGCTGG + Exonic
1061599186 9:131655465-131655487 GAGGCAGGACAGAGGGGAGCGGG - Intronic
1061798580 9:133102393-133102415 GAGCCTGGGCTCAGGGAGTCAGG - Intronic
1061885194 9:133587758-133587780 TTGGGTGGTCTGAGGGAGGCGGG + Intergenic
1061890286 9:133615715-133615737 GAGGGTGCAGAGAGGGAGGCTGG - Intergenic
1062121580 9:134836676-134836698 GATGCTGGGCAGGGGGAGGCGGG - Intronic
1062135113 9:134922681-134922703 GAGGCTGGTCAGAGTGGGGCTGG + Intergenic
1062144736 9:134982750-134982772 GAGGTTGTACTGAGGGGGGGTGG - Intergenic
1062192303 9:135254301-135254323 GGGGCTGTCCTGTGGGAGGCTGG - Intergenic
1062423070 9:136493374-136493396 GTGGCTGTACTGAGTGATGCCGG + Intergenic
1062480209 9:136747615-136747637 GAGGCTGGAGGGTTGGAGGCTGG - Intronic
1062480234 9:136747701-136747723 GAGGCTGGAGGGTTGGAGGCTGG - Intronic
1062480321 9:136748025-136748047 GAGGCTGGAGGGCTGGAGGCTGG - Intronic
1062488190 9:136791463-136791485 GAAGCTGACCTGAGCGAGGCGGG + Intronic
1062523624 9:136969687-136969709 GAGGCAGGGCAGAGGGAGGCTGG - Intronic
1062527374 9:136983421-136983443 GATGCAGAACTGAGGGAGGGGGG - Exonic
1062682035 9:137787422-137787444 GAGGCAAGGCTGTGGGAGGCAGG - Intronic
1062695972 9:137876822-137876844 GAGTGTGGACTGCAGGAGGCTGG - Intergenic
1185524552 X:766868-766890 GAGGCTGCAGTGAGGCAGCCAGG + Intergenic
1185610881 X:1392959-1392981 GAGGCGGGAGGGAGGGAGGGAGG - Intergenic
1185610891 X:1392981-1393003 GAGGCGGGAGGGAGGGAGGAGGG - Intergenic
1185612778 X:1402398-1402420 GAGGCTGAATTGGGGGAGGAGGG - Intergenic
1185612788 X:1402425-1402447 GAGGCTGCATTCAGGGAGGAGGG - Intergenic
1186157067 X:6736851-6736873 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
1186471023 X:9822311-9822333 GAGGCTGCAGTGGGGGAGGTGGG + Intronic
1187446348 X:19364453-19364475 GAGAATGGACTGAGAGAGGGAGG - Intronic
1188200794 X:27291578-27291600 GGGGCTGGGATGAGGGATGCAGG + Intergenic
1188259144 X:28001907-28001929 GAGGGTGGAGGGAGGGAGGAGGG - Intergenic
1188289430 X:28369497-28369519 GATGGTGGACTGTGGGAGGAGGG - Intergenic
1188327520 X:28823730-28823752 GAGCTTGGAGTGAGGGAGGAAGG - Intronic
1189309250 X:40008533-40008555 GAGACCGCACTGAGGGTGGCAGG + Intergenic
1189465763 X:41276491-41276513 GAGGCAGGAGGGAGGGAGGAAGG + Intergenic
1189855515 X:45220692-45220714 GAGGGTGGAGTGTGGGAGGAGGG + Intergenic
1189898309 X:45679473-45679495 GAGGGTGGAATGTGGGAGGAGGG + Intergenic
1190812202 X:53895629-53895651 GAGGGTGGAAGGAGGGAGGAGGG + Intergenic
1190880651 X:54490182-54490204 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1191630976 X:63321839-63321861 GAGGGTGGACGGCGGGAGGAGGG + Intergenic
1191700425 X:64036110-64036132 GAGGCTGGACGGTGGGAGGAGGG + Intergenic
1191824105 X:65345542-65345564 GAGGGTGGAGTGTGGGAGGAGGG + Intergenic
1191991052 X:67037410-67037432 GAGGGTGGAGTGTGGGAGGAGGG + Intergenic
1192303509 X:69932462-69932484 GAGGCTGGAGTTAAAGAGGCAGG + Intronic
1192547180 X:72023798-72023820 GAGACTGGAGGCAGGGAGGCTGG + Intergenic
1192831844 X:74758551-74758573 GAGGGTGGAGGGAGGGAGGAGGG - Intronic
1193032595 X:76915487-76915509 GAGGTGGGAGTGAGGGAGGTAGG + Intergenic
1194216892 X:91141463-91141485 GAGGGTGGAGTGTGGGAGGGAGG - Intergenic
1194869430 X:99109944-99109966 AAGGAGGGAGTGAGGGAGGCTGG + Intergenic
1195708573 X:107756608-107756630 GAGGAAGGAGGGAGGGAGGCAGG - Intronic
1195977373 X:110542269-110542291 GAGGATGGAGGGAGGGAGGATGG - Intergenic
1196200678 X:112882551-112882573 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
1196585275 X:117420896-117420918 GAGGCTGGGATGAGGGGTGCAGG - Intergenic
1197351888 X:125391284-125391306 GAGGCTGGGATGAGGGGTGCAGG + Intergenic
1197525091 X:127551437-127551459 GAGGCTGGGCAGAGGGTGGGAGG - Intergenic
1197648507 X:129041614-129041636 GGGGCTGCACTGGGGGTGGCTGG + Intergenic
1198560358 X:137843271-137843293 GAGGGTGGACTGGGGGAGGATGG - Intergenic
1199706604 X:150431558-150431580 GAGGGTGGACGGAGGGAAGAGGG - Intronic
1199791376 X:151158439-151158461 GAGGGTGGAGGGAGGGAGGAGGG - Intergenic
1199964000 X:152803285-152803307 GAGGCTGGAGAGTGGGAGGAGGG - Intergenic
1201696190 Y:16829102-16829124 GAGGAGAGACTGAGGGAGGGAGG + Intergenic