ID: 900167280

View in Genome Browser
Species Human (GRCh38)
Location 1:1248764-1248786
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 4, 1: 12, 2: 7, 3: 23, 4: 237}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900167263_900167280 16 Left 900167263 1:1248725-1248747 CCCACTCCGCCCTACAGGCCGGG 0: 12
1: 1
2: 2
3: 6
4: 103
Right 900167280 1:1248764-1248786 GAGGCTAGACCGAGGGAGGCTGG 0: 4
1: 12
2: 7
3: 23
4: 237
900167261_900167280 19 Left 900167261 1:1248722-1248744 CCTCCCACTCCGCCCTACAGGCC 0: 12
1: 3
2: 4
3: 48
4: 438
Right 900167280 1:1248764-1248786 GAGGCTAGACCGAGGGAGGCTGG 0: 4
1: 12
2: 7
3: 23
4: 237
900167270_900167280 6 Left 900167270 1:1248735-1248757 CCTACAGGCCGGGACACGGGCAG 0: 12
1: 3
2: 1
3: 17
4: 104
Right 900167280 1:1248764-1248786 GAGGCTAGACCGAGGGAGGCTGG 0: 4
1: 12
2: 7
3: 23
4: 237
900167265_900167280 15 Left 900167265 1:1248726-1248748 CCACTCCGCCCTACAGGCCGGGA 0: 12
1: 1
2: 2
3: 8
4: 121
Right 900167280 1:1248764-1248786 GAGGCTAGACCGAGGGAGGCTGG 0: 4
1: 12
2: 7
3: 23
4: 237
900167266_900167280 10 Left 900167266 1:1248731-1248753 CCGCCCTACAGGCCGGGACACGG 0: 12
1: 1
2: 0
3: 6
4: 98
Right 900167280 1:1248764-1248786 GAGGCTAGACCGAGGGAGGCTGG 0: 4
1: 12
2: 7
3: 23
4: 237
900167269_900167280 7 Left 900167269 1:1248734-1248756 CCCTACAGGCCGGGACACGGGCA 0: 12
1: 3
2: 1
3: 14
4: 65
Right 900167280 1:1248764-1248786 GAGGCTAGACCGAGGGAGGCTGG 0: 4
1: 12
2: 7
3: 23
4: 237
900167273_900167280 -2 Left 900167273 1:1248743-1248765 CCGGGACACGGGCAGCCCTGGGA 0: 13
1: 4
2: 2
3: 34
4: 288
Right 900167280 1:1248764-1248786 GAGGCTAGACCGAGGGAGGCTGG 0: 4
1: 12
2: 7
3: 23
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900104474 1:976441-976463 GAAGCCAGACCGAGGGGCGCTGG - Intronic
900167075 1:1248105-1248127 GAGGCTGGACTGAGGGAGGCTGG + Intergenic
900167092 1:1248171-1248193 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167114 1:1248237-1248259 GAGGCTAGACCGAGGGAGGCTGG + Intergenic
900167135 1:1248302-1248324 GAGGCTGTACCGAGGGAGGCTGG + Intergenic
900167158 1:1248368-1248390 GAGGCTGGACCAAGGGAGGCTGG + Intergenic
900167176 1:1248434-1248456 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167197 1:1248500-1248522 GAGGCTAGACCGAGGGAGGCTGG + Intergenic
900167218 1:1248566-1248588 GAGGCTGGACCAAGGGAGGCTGG + Intergenic
900167236 1:1248632-1248654 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167258 1:1248698-1248720 GAGGCTGGAGCAAGGGAGGCTGG + Intergenic
900167280 1:1248764-1248786 GAGGCTAGACCGAGGGAGGCTGG + Intergenic
900167301 1:1248830-1248852 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167320 1:1248896-1248918 GAGGCTGGAGCGAGGGAGGCTGG + Intergenic
900167343 1:1248962-1248984 GAGGCTGGAGCGAGGGAGGCTGG + Intergenic
900167366 1:1249028-1249050 GAGGCTGGAGCGAGGGAGGCTGG + Intergenic
900167389 1:1249094-1249116 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167413 1:1249160-1249182 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167437 1:1249226-1249248 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167461 1:1249292-1249314 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167485 1:1249358-1249380 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167509 1:1249424-1249446 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167533 1:1249490-1249512 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167557 1:1249556-1249578 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167580 1:1249622-1249644 GAGGCTAGACCGAGGGAGGCTGG + Intergenic
901429979 1:9208098-9208120 GGGGCTAGACCAAGGGATGTGGG - Intergenic
901500781 1:9651708-9651730 GAGCCTCGAGGGAGGGAGGCGGG - Intergenic
902232468 1:15036515-15036537 GAAGCAAGGCAGAGGGAGGCAGG + Intronic
902366068 1:15975433-15975455 GAAGCTAGAGCGAGTGATGCGGG - Intronic
902704648 1:18196200-18196222 GAGGCTGGAGGCAGGGAGGCCGG + Intronic
902754662 1:18541118-18541140 GAGGCCAGAGGCAGGGAGGCTGG - Intergenic
903663005 1:24990094-24990116 GAGGGAAGACTGTGGGAGGCAGG + Intergenic
903670326 1:25031473-25031495 GAGGCTGGAGGGATGGAGGCTGG + Intergenic
904026072 1:27504591-27504613 GAGGCTTTACAGTGGGAGGCCGG + Intergenic
905244282 1:36602054-36602076 GAAGCCATCCCGAGGGAGGCAGG - Intergenic
905651039 1:39657164-39657186 GAGGCTGGTCCCAGGGAGGAAGG - Intergenic
909762124 1:79303076-79303098 GAGGCTAGAATGAGGGAACCAGG - Intergenic
911371740 1:97002489-97002511 GAGGCCAGAGGGAGGGAGGGAGG - Intergenic
913674496 1:121128394-121128416 GAGGCAAGACCGGGGAAGTCTGG + Intergenic
914664716 1:149823456-149823478 GAGGCAAGACCGGGGAAGTCTGG + Intergenic
914671049 1:149870362-149870384 GAGGCAAGACCGGGGAAGTCTGG - Intronic
915343077 1:155186777-155186799 GAGGGTAGACCGAGAAAGGCTGG - Intronic
915471761 1:156129940-156129962 GAGGCAGGAGGGAGGGAGGCAGG + Intronic
916742443 1:167658181-167658203 GAGGCTGGACACAGGGAGGGGGG - Intronic
916873466 1:168942244-168942266 GAGGCTAATCTGAGGGAGGCTGG - Intergenic
918540615 1:185627986-185628008 AAGGCTAAAAAGAGGGAGGCTGG - Intergenic
921527686 1:216238347-216238369 GAGGCCAGGCCGAGGAAGGCAGG - Intronic
922153888 1:223026844-223026866 GAGGCTGGAACGAGGGGTGCAGG + Intergenic
922178866 1:223217991-223218013 GAGGCAAGAGAGAGGGAGGGAGG - Intergenic
923548312 1:234941003-234941025 GAGCCAAGACCGATGGTGGCAGG - Intergenic
924852626 1:247845630-247845652 AAGGCTGCACTGAGGGAGGCTGG - Intergenic
1068092851 10:52454359-52454381 GAGGCTATACTGAGGAAGGGAGG + Intergenic
1069612191 10:69781589-69781611 GAGGCTGCAGGGAGGGAGGCAGG + Intergenic
1070652207 10:78245589-78245611 GAGGCTGGAAAGAGGGAGACAGG + Intergenic
1072903805 10:99432054-99432076 GAGGCTAGAGGGTGGGAGGAGGG - Intergenic
1075544294 10:123342870-123342892 GAGGCTGGAAAGAAGGAGGCAGG + Intergenic
1076313987 10:129527918-129527940 GAGGAGAGACTGAGGCAGGCAGG - Intronic
1076316662 10:129546642-129546664 GAGGCTGGAAGGAGAGAGGCGGG + Intronic
1076371601 10:129959293-129959315 GAGGGCAGGGCGAGGGAGGCCGG + Intronic
1076988130 11:253973-253995 GAGGCTGGACTTAGGGAGGGTGG - Intergenic
1077183483 11:1226558-1226580 GAGGCTACCCCGTGGGGGGCTGG + Intronic
1077339385 11:2019215-2019237 GAGGCTGCACCTGGGGAGGCTGG + Intergenic
1078737750 11:14036097-14036119 GAGGCTAGAGGCAGGGAGGCAGG + Intronic
1079078963 11:17400750-17400772 GAAGCGAGACCCAGAGAGGCTGG - Intronic
1080791427 11:35525626-35525648 GAGGAGGGACCCAGGGAGGCCGG + Intronic
1081489488 11:43556550-43556572 GAGGGTAGAGGGAGGGAGGGAGG - Intronic
1083742508 11:64718334-64718356 GAGGAGAGCCAGAGGGAGGCCGG - Intronic
1084332510 11:68438288-68438310 GAGGCTAGGCCTGGGGAGCCTGG - Intronic
1084627968 11:70323426-70323448 GAGGCTGGACAGAGGTAGGAAGG + Intronic
1084941467 11:72615492-72615514 GTGGGTAGAGGGAGGGAGGCAGG + Intronic
1085317771 11:75555676-75555698 GGGGCTTGTCCGAGGGTGGCTGG - Intergenic
1085386824 11:76162430-76162452 GAGGCTACACCTAGGGAGACAGG - Intergenic
1085515675 11:77110545-77110567 CAGGCTCAAGCGAGGGAGGCAGG - Intronic
1085544168 11:77301684-77301706 AAGGGCAGCCCGAGGGAGGCGGG + Intronic
1087205117 11:95386363-95386385 GAGGATAGACTGGAGGAGGCTGG + Intergenic
1089948723 11:122505739-122505761 GAGGCAAGAGGGAGAGAGGCTGG - Intergenic
1090727847 11:129543858-129543880 GAGCCTACACTGAGGGAGGGAGG + Intergenic
1202822370 11_KI270721v1_random:74404-74426 GAGGCTGCACCTGGGGAGGCTGG + Intergenic
1094265724 12:28557356-28557378 GAGACTTGAACCAGGGAGGCTGG - Intronic
1096555994 12:52404194-52404216 GAGGATAGAGAGAGGCAGGCAGG - Intronic
1097146275 12:56941492-56941514 GAGGACAGACCCAGGTAGGCTGG + Intergenic
1102484030 12:113244070-113244092 GAGGCCAGGCCCAGGGAGCCTGG - Intronic
1103047927 12:117753662-117753684 GAGGGTAGACGGTGGGAGGAGGG + Intronic
1103340625 12:120219425-120219447 AAGGCCAGAGCCAGGGAGGCTGG - Intronic
1103510610 12:121471185-121471207 GAGGTCAGACGGAGGGAGGGAGG - Intronic
1104567392 12:129897530-129897552 GAAGCTTGACCTAGGGAGGTGGG + Intronic
1104676744 12:130716301-130716323 GGGGCGAGACGGAGGGAGGGAGG + Intergenic
1104946679 12:132417748-132417770 GAGGCTGGGCCGTGGGAGGAGGG - Intergenic
1107182309 13:37475013-37475035 GAGGCTAGAGGGTGGGAGGAGGG + Intergenic
1113656780 13:112072682-112072704 GAGGGAAGAACGGGGGAGGCGGG - Intergenic
1113882473 13:113635391-113635413 GGGGATAGACCCAGGGTGGCCGG + Intronic
1114650899 14:24284110-24284132 GAGGCTTGACAGAGAAAGGCAGG + Intergenic
1115591493 14:34869981-34870003 GAGGCTAGGCTGAGGCAGGTTGG - Intronic
1115754501 14:36518623-36518645 GAGGCTAGACCGGGCCAGGAGGG - Intronic
1116868367 14:50049514-50049536 GAGGCCAGGAAGAGGGAGGCTGG - Intergenic
1118443393 14:65831377-65831399 GAGGCTAAACCGGGGAAGGCTGG + Intergenic
1118594555 14:67425692-67425714 GAGGCTGGTCCCTGGGAGGCAGG - Intergenic
1119046285 14:71320994-71321016 GAGGGGGGCCCGAGGGAGGCGGG - Intronic
1119109949 14:71962285-71962307 GTGGCTGGGCAGAGGGAGGCCGG + Intronic
1119268852 14:73283478-73283500 GAGGATAGACCTATAGAGGCTGG + Intronic
1121275303 14:92663434-92663456 CAGGCAAGAGGGAGGGAGGCCGG + Intronic
1122139386 14:99653294-99653316 CAGGCCAGAGCGAGGCAGGCTGG - Intronic
1123996061 15:25718750-25718772 GAGGCAGGACAGAGGGTGGCAGG + Intronic
1124465576 15:29936386-29936408 CAGGCTGGACCGGGGAAGGCAGG - Intronic
1128344955 15:66847824-66847846 CAGGCTAGGCCAGGGGAGGCAGG + Intergenic
1129332409 15:74834463-74834485 GAGGCTGGGGCGAGGGGGGCAGG - Intergenic
1129868491 15:78926231-78926253 GAGGCAGGACTGAGGGAGGCTGG - Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1131671128 15:94620532-94620554 GAGGCCAAACAGATGGAGGCAGG - Intergenic
1132679404 16:1133565-1133587 GAGGACAGACAGAGGGAAGCTGG - Intergenic
1132826947 16:1909868-1909890 GAGGCCAGACTCAGGCAGGCTGG - Intergenic
1132888259 16:2191946-2191968 GAGGTTGGACCGAGGGATGTGGG - Intronic
1133111343 16:3549940-3549962 GAGGCTAGAAGGTGGGGGGCTGG - Intronic
1133831940 16:9331414-9331436 GAGGCTGGATCACGGGAGGCAGG - Intergenic
1134058072 16:11182593-11182615 CAGGCTGGGCCGAGGGAAGCAGG + Intergenic
1135899757 16:26446179-26446201 GTGGACAGACTGAGGGAGGCTGG - Intergenic
1137977260 16:53042295-53042317 GAGGGGAGACGGAGGGAGGAAGG - Intergenic
1138130622 16:54476602-54476624 GAGGGGAGACAGAGGGAGGGGGG + Intergenic
1138907688 16:61357547-61357569 GAGGGTAGAGCGTGGGAGGCTGG + Intergenic
1138941265 16:61793402-61793424 GAGGGTAGAGGGAGGGAGGAGGG - Intronic
1140193262 16:72836169-72836191 GTGGCTACACCGATGGAGGTGGG + Intronic
1142597653 17:1037331-1037353 GAGGTCAGGCAGAGGGAGGCTGG - Intronic
1143348458 17:6268117-6268139 GAGGGTAGAGGGTGGGAGGCGGG - Intergenic
1144580554 17:16456633-16456655 GAGGGAACACAGAGGGAGGCAGG + Intronic
1144727890 17:17511000-17511022 GAGGTTGGACCGATGGAGCCAGG - Intronic
1147168207 17:38604496-38604518 GAGGCTGGACCGAGGGACCCTGG - Intronic
1150633529 17:66897232-66897254 GAGGCCATTCCCAGGGAGGCTGG + Intergenic
1150645689 17:66976317-66976339 GAGGAAAGACAGAGGGAGGAGGG - Intronic
1151319165 17:73342429-73342451 GATGCTGGGCCGAGTGAGGCTGG + Intronic
1151390992 17:73786569-73786591 GAGCCAAGACCGAGGGGGCCAGG - Intergenic
1151692318 17:75694184-75694206 GAGGCAAGACCGCAGGAGGCAGG - Intronic
1152482553 17:80564738-80564760 GAGGGTAGACGGTGGGAGGAGGG - Intronic
1152748346 17:82051432-82051454 GGGCCTAGACCCTGGGAGGCGGG + Intronic
1153225140 18:2894167-2894189 TAGGCTAGAACGTGGGAAGCAGG + Intronic
1155100414 18:22605144-22605166 GAGGCCAGACCAAAGGAGGGAGG + Intergenic
1156561866 18:38134480-38134502 GAGGCTAGAAGGTGGGAGGAGGG - Intergenic
1160159399 18:76459805-76459827 GAGGTTAGACGGTGGCAGGCAGG + Intronic
1160229333 18:77034571-77034593 GAGGCTCCACTGTGGGAGGCAGG - Intronic
1161458413 19:4381575-4381597 CAGGGTAGACAGAGAGAGGCAGG - Intronic
1161664718 19:5568234-5568256 GAGGCTCCAGGGAGGGAGGCTGG + Intergenic
1161895955 19:7080478-7080500 GAGGCTACACCTATGGAAGCTGG - Intronic
1164157026 19:22603161-22603183 CAGGCAAGAGCAAGGGAGGCTGG + Intergenic
1164864244 19:31590733-31590755 GAGACTAGACAGAGGAAGACAGG - Intergenic
1164925502 19:32126861-32126883 GAGGATTGAGCCAGGGAGGCCGG + Intergenic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
1166679804 19:44759369-44759391 GAGGCTAGACCCAGAGAGCAGGG - Intronic
1166707188 19:44914588-44914610 GTGGGTGGACAGAGGGAGGCAGG + Intronic
1167080691 19:47274684-47274706 GGGGCTGGAGCGAGGGGGGCGGG + Exonic
1167260312 19:48454414-48454436 GAGGCTGGATGGAGGGGGGCCGG - Exonic
1167270593 19:48503576-48503598 GAGACTAGAGCCAGGGAGGCTGG - Intronic
1167377201 19:49118629-49118651 GAGACTAGTCCGAGGGCGGAGGG + Exonic
1167717151 19:51150823-51150845 GTGATTAGACAGAGGGAGGCAGG + Intronic
1167718566 19:51161062-51161084 GGGGCTTGAACCAGGGAGGCAGG + Intergenic
925017620 2:543734-543756 GAGGCTGGAGGGTGGGAGGCAGG + Intergenic
925017634 2:543772-543794 GAGGCTGGAGGGTGGGAGGCAGG + Intergenic
925017691 2:543933-543955 GAGGCTGGAGGGTGGGAGGCTGG + Intergenic
925017696 2:543948-543970 GAGGCTGGAGGCAGGGAGGCAGG + Intergenic
925276771 2:2655644-2655666 AGGGCGAGACCGAGGGATGCAGG + Intergenic
925312345 2:2894202-2894224 GAAGCTAGGCCGAGGTGGGCAGG + Intergenic
926165661 2:10521142-10521164 GAGGCTGGAGGGAGGGAGGGAGG + Intergenic
926240456 2:11081111-11081133 GAGGCCAGAGGGAGGGAGGGAGG - Intergenic
926714509 2:15913573-15913595 GAGGCTAGGCAGAGGGAGGGAGG + Intergenic
926878901 2:17518591-17518613 GAGGAGGGACTGAGGGAGGCGGG - Intergenic
927436632 2:23072104-23072126 GAGCGTAGGCAGAGGGAGGCTGG - Intergenic
927636390 2:24820155-24820177 GAGCCTAGACTGAGGGCGGGTGG + Exonic
928644042 2:33332997-33333019 AAGGGTAGAGCTAGGGAGGCAGG + Intronic
930022457 2:47009554-47009576 GAGGCCAGCTGGAGGGAGGCGGG + Intronic
932799848 2:74731445-74731467 GTGGCTGGACCGAGGGAGAGAGG + Intergenic
933726701 2:85431125-85431147 GAGGCTGGTCGGGGGGAGGCGGG + Intronic
934150121 2:89138434-89138456 GAGGATAGACAGAGTGAGGCTGG - Intergenic
934217175 2:90043595-90043617 GAGGATAGACAGAGTGAGGCTGG + Intergenic
936083730 2:109452778-109452800 GAGGCTGGTCCCTGGGAGGCTGG + Intronic
936083748 2:109452835-109452857 GAGGCTGGTCCCTGGGAGGCTGG + Intronic
936083790 2:109452948-109452970 GAGGCTGGTCCCTGGGAGGCTGG + Intronic
940072839 2:149708808-149708830 GAGGCTAGAGCCAGCAAGGCTGG - Intergenic
941043321 2:160647391-160647413 GGGGCTAGAGTCAGGGAGGCAGG + Intergenic
944671227 2:201996070-201996092 CAGGCTCTCCCGAGGGAGGCAGG + Intergenic
947889660 2:233605735-233605757 GAGGCTAGAGCTAGAGTGGCTGG + Intergenic
948844710 2:240677502-240677524 GAGGGCAGGCCCAGGGAGGCGGG + Intronic
948849150 2:240697377-240697399 GAGGGCAGGCCCAGGGAGGCGGG - Intronic
1172110957 20:32544598-32544620 GAGGCTGGAAGGAGAGAGGCAGG + Intronic
1173380487 20:42535322-42535344 GAGGGTAGAGGGAGGGAGGAGGG + Intronic
1176013564 20:62914651-62914673 CAGGCTTGCCCCAGGGAGGCAGG + Intronic
1178843512 21:36156609-36156631 GGGGCCTGACCGAAGGAGGCGGG - Intergenic
1180980767 22:19877031-19877053 GAGGCCAGACCCAGGTATGCAGG - Exonic
1181295504 22:21835201-21835223 GAGGCTGAACTGAGGGAGGAAGG + Intronic
1182062033 22:27405245-27405267 GAGGGAAGAGGGAGGGAGGCAGG - Intergenic
1182098064 22:27639089-27639111 ACGGCTAGAGCGAAGGAGGCGGG + Intergenic
1182498415 22:30727497-30727519 GAGGTGAGAACAAGGGAGGCTGG + Intronic
1182766328 22:32760606-32760628 TAGGGTAGACGGTGGGAGGCTGG - Intronic
1183411114 22:37655508-37655530 GAGGCTGGACCTGGGGAGGCCGG - Exonic
1183416763 22:37687030-37687052 GAGATTAGACCGAGGGAAGGAGG + Intronic
1183579067 22:38712407-38712429 GAGGCTGGGCAGAGGAAGGCAGG + Intronic
1184231090 22:43158893-43158915 GGGACTTGACCCAGGGAGGCAGG + Intronic
1185017697 22:48354503-48354525 TAGGTTAGGCTGAGGGAGGCAGG + Intergenic
1185276353 22:49951652-49951674 GAGTGGAGACCGAGAGAGGCAGG + Intergenic
1185410374 22:50678506-50678528 GAGGCTTGCCGGAGGAAGGCGGG + Intergenic
950570716 3:13798426-13798448 GCGGCTAGACCGAGGTATCCTGG + Intergenic
955233681 3:57121592-57121614 GAGGCTAGAAGGAGGAAAGCTGG - Intronic
955579458 3:60403468-60403490 GAGGCTAGAGAGAGGAGGGCTGG - Intronic
956659695 3:71584620-71584642 GAGGAGAGACCGAGGGAGGACGG - Intergenic
961645201 3:128389126-128389148 GAGGCTGGAGGGAGGCAGGCAGG + Intronic
962036585 3:131658264-131658286 GAGACTAGACCCAGTGAGACGGG + Intronic
962715800 3:138124942-138124964 GAGGCCAGGCCCAGAGAGGCTGG + Intronic
962920952 3:139950035-139950057 GAGCCTACAGCTAGGGAGGCAGG + Intronic
962962769 3:140326322-140326344 GAGGCAAGACAGAGGGAAGAAGG + Intronic
967293906 3:187947386-187947408 AAGGCTAGACCTTTGGAGGCGGG + Intergenic
968180526 3:196591868-196591890 GCGGGTAGAGCGAGGGAGGCGGG + Intergenic
968892154 4:3375114-3375136 GGGGCCAGACTGAGGGAGACAGG + Intronic
969371563 4:6734507-6734529 GAGGCAAGGCAGAGGGCGGCTGG - Intergenic
969379162 4:6782940-6782962 GGGGCCAGCCCGAGGGAGGCCGG + Intronic
969379224 4:6783104-6783126 GGGGCCAGCCTGAGGGAGGCCGG + Intronic
969967088 4:11008068-11008090 GAGGCTGGACAGAGGGAGTGAGG + Intergenic
972886159 4:43491352-43491374 GAGGCCAGGCCGAGGCAGGATGG + Intergenic
976753373 4:88473308-88473330 GAGGCTAGAGGGAGGAAGGAGGG - Intronic
979099940 4:116600236-116600258 GAGGCTAGACAAAGCAAGGCCGG - Intergenic
979318908 4:119300461-119300483 GAGGCTTTAGCGAGGGAGGGAGG - Exonic
979616319 4:122746847-122746869 GAGGCTAAACAGTGTGAGGCAGG - Intergenic
985993673 5:3584508-3584530 GAGGAAAGAAGGAGGGAGGCAGG + Intergenic
987338708 5:16920501-16920523 GGGGTTAGAGGGAGGGAGGCTGG + Intronic
991304201 5:65159405-65159427 GAGGCTACAGAGAGAGAGGCAGG - Intronic
1001092395 5:168751042-168751064 GAGGCTAGGGGGAGGGAGGCTGG + Intronic
1001241940 5:170077872-170077894 GGGGATAGAGCCAGGGAGGCAGG - Intronic
1001813427 5:174648019-174648041 GAGGCGAGAGGCAGGGAGGCCGG + Intergenic
1002210618 5:177596809-177596831 GAGGCCAGAGGGAGGGGGGCAGG - Intergenic
1002340733 5:178515263-178515285 GAGGCTGCAGGGAGGGAGGCTGG - Intronic
1002467289 5:179413945-179413967 GATGATTGTCCGAGGGAGGCTGG - Intergenic
1003016031 6:2468213-2468235 GAGGGTAGACAGAGAGAGGAAGG + Intergenic
1003445279 6:6178125-6178147 GGGGCTAGACTGAGGGAAGGAGG + Intronic
1003948178 6:11094072-11094094 GTGGCCAGAGCGCGGGAGGCAGG - Exonic
1006180770 6:32152148-32152170 GAGGCTAGACCAGGCGAGGCGGG + Intronic
1006620280 6:35359163-35359185 GTGGCTGGACAGAGGGAGGGAGG + Intronic
1006985060 6:38170453-38170475 GAGGCGAGGCGGAGGGAGGAGGG - Exonic
1007899831 6:45400239-45400261 GAGGGGAGACAGAGGGAGGAAGG + Intronic
1010252612 6:73723741-73723763 GAGGGTAGAGGGAGGGAGGAGGG + Intronic
1010507219 6:76675401-76675423 GAGGGTAGAGGGAGGGAGGAGGG - Intergenic
1012161874 6:95895355-95895377 GAGGGTAGACGGTGGGAGGTGGG - Intergenic
1013605824 6:111746812-111746834 GAGGGTAGAGGGAGGGAGGCAGG + Intronic
1013637691 6:112044699-112044721 GAGGCTGGACTGGGGGAGGTAGG + Intergenic
1017935239 6:158999673-158999695 GAGGCGACAACAAGGGAGGCGGG + Exonic
1019168868 6:170117425-170117447 GGTCCCAGACCGAGGGAGGCAGG - Intergenic
1019549258 7:1594055-1594077 GAGGATAGATGGAGGGAGGGAGG - Intergenic
1019633612 7:2063852-2063874 GAGGGCAGAGCGAGGGAGGCTGG - Intronic
1019716728 7:2542629-2542651 GAGAGTAGACCGGGGGAGGATGG - Intronic
1021609355 7:22442758-22442780 GAGGCAAGGCTGAGAGAGGCAGG + Intronic
1022228743 7:28392122-28392144 GAGGGTGGACGGAGGGAGGAAGG + Intronic
1029591690 7:101511280-101511302 GTGGCCAGGCCAAGGGAGGCAGG - Intronic
1032625003 7:133582118-133582140 GAGGGTAGAGGGAGGGAGGAAGG - Intronic
1033341523 7:140495830-140495852 GTGGCTGGACCCAGGGAGCCAGG + Intergenic
1034275977 7:149824046-149824068 CAGGGTAGACTAAGGGAGGCAGG - Intergenic
1034417357 7:150972097-150972119 GAGGCTAGACTGGGGGAGTGTGG - Intronic
1036208452 8:6822794-6822816 GTGCCTAGACTGAGGGAGGAGGG + Intronic
1036671373 8:10790706-10790728 GGGGCCAGACTGAGGCAGGCAGG - Intronic
1043289341 8:78577341-78577363 GAGGGTAGAGCGTGGGAGGAGGG + Intronic
1043778195 8:84297198-84297220 GAGGGTAGACAGTGGGAGGAGGG - Intronic
1044499518 8:92936459-92936481 GAGGATGAACAGAGGGAGGCAGG + Intronic
1044963750 8:97555996-97556018 GAGACTAGACCCAAGGATGCAGG - Intergenic
1046048198 8:108987982-108988004 GAGGGTAGAGGGAGGGAGGAGGG + Intergenic
1048336085 8:133503512-133503534 GGGGCTGGACGGAGGGAGGAAGG - Intronic
1048351596 8:133620964-133620986 GATGCTAGACCCAGGGTGGGAGG - Intergenic
1048449845 8:134523667-134523689 AAGGCGAGAGGGAGGGAGGCGGG - Intronic
1048473190 8:134721340-134721362 GAGGCTAGGCAGAGGCTGGCAGG - Intergenic
1049370333 8:142261276-142261298 GAGGATAGAGGGAGGGAGGAGGG + Intronic
1050318728 9:4429293-4429315 GAGGCTGGAGAGAGGGAGGTAGG - Intergenic
1055549415 9:77417723-77417745 GACACTACACCCAGGGAGGCAGG - Exonic
1056771546 9:89481274-89481296 GAGGGTCCAGCGAGGGAGGCGGG + Intronic
1056771840 9:89483209-89483231 CAGGCAAGACCAAGGGAGCCAGG + Intronic
1058503835 9:105649046-105649068 GAGGTTGGAATGAGGGAGGCAGG + Intergenic
1059322547 9:113480916-113480938 GCGGCAAGAGCCAGGGAGGCTGG - Intronic
1059770238 9:117416955-117416977 AAGGAGAGACTGAGGGAGGCAGG - Intergenic
1059832272 9:118110495-118110517 GAGGCTAGCAAGAGGGAGTCAGG - Intergenic
1061314179 9:129783964-129783986 GGGGCTTGGCCGAGGGAGCCTGG - Intergenic
1061855356 9:133439115-133439137 GGGGCAAGCCAGAGGGAGGCAGG - Intronic
1061911778 9:133728840-133728862 GTGGCTAGAGGGAGGGAGGGAGG + Intronic
1062143990 9:134978888-134978910 GAGGATAGAGGGAGGGAGGGAGG + Intergenic
1062432978 9:136534194-136534216 GAGCCAAGGCCCAGGGAGGCAGG - Intronic
1062523624 9:136969687-136969709 GAGGCAGGGCAGAGGGAGGCTGG - Intronic
1062682035 9:137787422-137787444 GAGGCAAGGCTGTGGGAGGCAGG - Intronic
1185451313 X:281842-281864 GAGGCTTGAACCCGGGAGGCGGG - Intronic
1190302704 X:49065728-49065750 GGGGCTAGACAGAGACAGGCAGG - Exonic
1191700425 X:64036110-64036132 GAGGCTGGACGGTGGGAGGAGGG + Intergenic
1200049125 X:153419396-153419418 CAGGCTAGACGGATGGGGGCCGG + Intronic
1201696190 Y:16829102-16829124 GAGGAGAGACTGAGGGAGGGAGG + Intergenic