ID: 900168369

View in Genome Browser
Species Human (GRCh38)
Location 1:1254163-1254185
Sequence GAGGGGAGACGGCCGAGACC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 191}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900168362_900168369 10 Left 900168362 1:1254130-1254152 CCACCCAGGCGAAGTCACGGAAC 0: 1
1: 0
2: 0
3: 3
4: 30
Right 900168369 1:1254163-1254185 GAGGGGAGACGGCCGAGACCCGG 0: 1
1: 0
2: 1
3: 12
4: 191
900168363_900168369 7 Left 900168363 1:1254133-1254155 CCCAGGCGAAGTCACGGAACAGA 0: 1
1: 0
2: 0
3: 7
4: 68
Right 900168369 1:1254163-1254185 GAGGGGAGACGGCCGAGACCCGG 0: 1
1: 0
2: 1
3: 12
4: 191
900168361_900168369 11 Left 900168361 1:1254129-1254151 CCCACCCAGGCGAAGTCACGGAA 0: 1
1: 0
2: 0
3: 3
4: 43
Right 900168369 1:1254163-1254185 GAGGGGAGACGGCCGAGACCCGG 0: 1
1: 0
2: 1
3: 12
4: 191
900168364_900168369 6 Left 900168364 1:1254134-1254156 CCAGGCGAAGTCACGGAACAGAC 0: 1
1: 0
2: 0
3: 3
4: 38
Right 900168369 1:1254163-1254185 GAGGGGAGACGGCCGAGACCCGG 0: 1
1: 0
2: 1
3: 12
4: 191
900168359_900168369 23 Left 900168359 1:1254117-1254139 CCTGCGGTACATCCCACCCAGGC 0: 1
1: 0
2: 1
3: 2
4: 94
Right 900168369 1:1254163-1254185 GAGGGGAGACGGCCGAGACCCGG 0: 1
1: 0
2: 1
3: 12
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900168369 Original CRISPR GAGGGGAGACGGCCGAGACC CGG Intronic