ID: 900168515

View in Genome Browser
Species Human (GRCh38)
Location 1:1254744-1254766
Sequence GGCGTCCGCGGGTGCTGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 108}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900168515_900168519 -9 Left 900168515 1:1254744-1254766 CCAGACCAGCACCCGCGGACGCC 0: 1
1: 0
2: 0
3: 6
4: 108
Right 900168519 1:1254758-1254780 GCGGACGCCAGCTCCACCCCTGG 0: 1
1: 0
2: 1
3: 13
4: 174
900168515_900168520 -8 Left 900168515 1:1254744-1254766 CCAGACCAGCACCCGCGGACGCC 0: 1
1: 0
2: 0
3: 6
4: 108
Right 900168520 1:1254759-1254781 CGGACGCCAGCTCCACCCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 167
900168515_900168529 16 Left 900168515 1:1254744-1254766 CCAGACCAGCACCCGCGGACGCC 0: 1
1: 0
2: 0
3: 6
4: 108
Right 900168529 1:1254783-1254805 CCCGAGGTTCCCACCCGCTGAGG 0: 1
1: 0
2: 1
3: 5
4: 134
900168515_900168531 22 Left 900168515 1:1254744-1254766 CCAGACCAGCACCCGCGGACGCC 0: 1
1: 0
2: 0
3: 6
4: 108
Right 900168531 1:1254789-1254811 GTTCCCACCCGCTGAGGAGCCGG 0: 1
1: 0
2: 0
3: 7
4: 139
900168515_900168522 0 Left 900168515 1:1254744-1254766 CCAGACCAGCACCCGCGGACGCC 0: 1
1: 0
2: 0
3: 6
4: 108
Right 900168522 1:1254767-1254789 AGCTCCACCCCTGGGCCCCGAGG 0: 1
1: 0
2: 4
3: 26
4: 299
900168515_900168532 23 Left 900168515 1:1254744-1254766 CCAGACCAGCACCCGCGGACGCC 0: 1
1: 0
2: 0
3: 6
4: 108
Right 900168532 1:1254790-1254812 TTCCCACCCGCTGAGGAGCCGGG 0: 1
1: 0
2: 1
3: 12
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900168515 Original CRISPR GGCGTCCGCGGGTGCTGGTC TGG (reversed) Intronic