ID: 900168632

View in Genome Browser
Species Human (GRCh38)
Location 1:1255329-1255351
Sequence GGGCCGTCCCAAACCTCGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 46}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900168632_900168641 15 Left 900168632 1:1255329-1255351 CCCTGCGAGGTTTGGGACGGCCC 0: 1
1: 0
2: 0
3: 1
4: 46
Right 900168641 1:1255367-1255389 TGAGCAGCTGAATCCCGTTCTGG 0: 1
1: 0
2: 0
3: 2
4: 74
900168632_900168642 21 Left 900168632 1:1255329-1255351 CCCTGCGAGGTTTGGGACGGCCC 0: 1
1: 0
2: 0
3: 1
4: 46
Right 900168642 1:1255373-1255395 GCTGAATCCCGTTCTGGACGAGG 0: 1
1: 0
2: 0
3: 4
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900168632 Original CRISPR GGGCCGTCCCAAACCTCGCA GGG (reversed) Exonic
900168632 1:1255329-1255351 GGGCCGTCCCAAACCTCGCAGGG - Exonic
900579289 1:3400585-3400607 GCTCCGTCCCAAACCTCTCCGGG - Intronic
910289033 1:85582079-85582101 GGGCTGTCCCAACCCTCGGCTGG + Exonic
912955946 1:114154033-114154055 GGGCTGTCCCGAATCTCGGAGGG + Intergenic
919355462 1:196516466-196516488 CAGCAGTCCCAAACCTCCCAGGG + Intronic
922706471 1:227793269-227793291 GGGCTGTGCCAGGCCTCGCAGGG + Intergenic
1067497408 10:46773397-46773419 GGTCCGTCCCCCACCTAGCAAGG - Intergenic
1067597243 10:47567018-47567040 GGTCCGTCCCCCACCTAGCAAGG + Intergenic
1069890726 10:71650830-71650852 GGGCTGCCCCAAGCCTAGCAGGG - Intronic
1075880119 10:125843843-125843865 GGGCAGTGCCAAACCACCCAAGG + Intronic
1076247943 10:128962143-128962165 GGGCAGCCCCAGACCTCCCAAGG + Intergenic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1104647627 12:130508558-130508580 AGGCCTTCCCAACCCTTGCAAGG + Intronic
1107840945 13:44457500-44457522 GGGCCTTCACAAACAACGCATGG + Intronic
1124248833 15:28094705-28094727 GGGCCCACCCCCACCTCGCAGGG - Intronic
1124342966 15:28901778-28901800 GAGACGTCCCTAACCCCGCAGGG - Intronic
1128522122 15:68382386-68382408 GGGCCCTTCCAAACTTTGCAAGG + Intronic
1130014618 15:80176887-80176909 TGGCAGACCCAGACCTCGCATGG + Intronic
1133212577 16:4271753-4271775 AGGCCGCCCCTAGCCTCGCAGGG - Intronic
1133345532 16:5067606-5067628 GTGCTGTCCCAAACCTTGCTGGG + Intronic
1134803629 16:17107165-17107187 GCCCCATCCCAAGCCTCGCAAGG - Exonic
1138501358 16:57447138-57447160 GGGCCGGCCCTAACCTCCCTGGG - Intronic
1142127865 16:88419206-88419228 GGGCCGTGCCAAGCCACGGAAGG + Intergenic
1151106972 17:71626371-71626393 GGACCATCCCAAACATAGCATGG + Intergenic
1151217951 17:72590934-72590956 GGGCAGTTCCAAACCCTGCATGG + Intergenic
1168522320 19:57062191-57062213 GGGCCGTCCCATGGCTTGCAGGG + Intergenic
942877013 2:180812881-180812903 TGGCTGTTCCAAACCTCCCAGGG + Intergenic
944716077 2:202376810-202376832 GGGCCTCCCCAACCCTCTCACGG + Intergenic
1170945550 20:20888035-20888057 GGGCCTTCACAAAGCTGGCAGGG + Intergenic
1175414336 20:58791950-58791972 AGGCCGTCCCAGGCCTCGCATGG + Intergenic
1184933186 22:47696973-47696995 GGCCAGTCACAAACCTGGCAAGG - Intergenic
1185065471 22:48629752-48629774 GGACCGTCCCAAGCATCCCAGGG - Intronic
963317418 3:143774453-143774475 GTGCCATCCCAAACATCACATGG - Intronic
969698252 4:8748105-8748127 GGGCCGTCCCACCCCCCGCCTGG - Intergenic
979057584 4:116015868-116015890 GGTCAGTCCCACACCTCGCTAGG - Intergenic
985478760 5:94265-94287 GGGTCGCCCCACACCTGGCAGGG + Intergenic
989167491 5:38445942-38445964 GGCACGTCCCAACCCTTGCAAGG + Intronic
992056550 5:72996735-72996757 GGGCTTTCCAAAACCTCGCCAGG + Intronic
994006146 5:94839634-94839656 GGGCCCACCCAAACCTCCCTGGG + Intronic
1007518078 6:42429332-42429354 AGGGCTTCCCAGACCTCGCAGGG - Intronic
1011795345 6:90947173-90947195 GAGCCGCCCCTACCCTCGCACGG + Intergenic
1016632098 6:146244720-146244742 GGGCTGTCTCCAACCTAGCAAGG - Intronic
1017605330 6:156127190-156127212 GGGCCGTCCCATACATTTCAGGG - Intergenic
1019385757 7:755186-755208 GGGCCCTTCCAGGCCTCGCAGGG + Intronic
1035231416 7:157468274-157468296 GGGCCGTCCCCGGCCTCACACGG - Intergenic
1041369216 8:57142333-57142355 GGGACGTCCCAAGCATCGCTGGG - Intergenic
1062044472 9:134418649-134418671 GGGCAGTCCCCACCCTGGCAGGG - Intronic
1185909784 X:3970960-3970982 GGGCCTCCCCAAAGCTAGCAGGG - Intergenic