ID: 900168758

View in Genome Browser
Species Human (GRCh38)
Location 1:1255899-1255921
Sequence CTCCCCTGCCTCGGGGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 497
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 446}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900168748_900168758 0 Left 900168748 1:1255876-1255898 CCCCCAGAGCCCAGGCTTTCTGC 0: 1
1: 0
2: 1
3: 51
4: 546
Right 900168758 1:1255899-1255921 CTCCCCTGCCTCGGGGCTCCTGG 0: 1
1: 0
2: 2
3: 48
4: 446
900168746_900168758 4 Left 900168746 1:1255872-1255894 CCACCCCCCAGAGCCCAGGCTTT 0: 1
1: 0
2: 5
3: 49
4: 533
Right 900168758 1:1255899-1255921 CTCCCCTGCCTCGGGGCTCCTGG 0: 1
1: 0
2: 2
3: 48
4: 446
900168747_900168758 1 Left 900168747 1:1255875-1255897 CCCCCCAGAGCCCAGGCTTTCTG 0: 1
1: 0
2: 6
3: 56
4: 495
Right 900168758 1:1255899-1255921 CTCCCCTGCCTCGGGGCTCCTGG 0: 1
1: 0
2: 2
3: 48
4: 446
900168743_900168758 24 Left 900168743 1:1255852-1255874 CCAGCACAGCTGTCCGCAGGCCA 0: 1
1: 1
2: 0
3: 18
4: 232
Right 900168758 1:1255899-1255921 CTCCCCTGCCTCGGGGCTCCTGG 0: 1
1: 0
2: 2
3: 48
4: 446
900168740_900168758 28 Left 900168740 1:1255848-1255870 CCCACCAGCACAGCTGTCCGCAG 0: 1
1: 0
2: 1
3: 13
4: 180
Right 900168758 1:1255899-1255921 CTCCCCTGCCTCGGGGCTCCTGG 0: 1
1: 0
2: 2
3: 48
4: 446
900168752_900168758 -9 Left 900168752 1:1255885-1255907 CCCAGGCTTTCTGCCTCCCCTGC 0: 1
1: 1
2: 6
3: 74
4: 647
Right 900168758 1:1255899-1255921 CTCCCCTGCCTCGGGGCTCCTGG 0: 1
1: 0
2: 2
3: 48
4: 446
900168753_900168758 -10 Left 900168753 1:1255886-1255908 CCAGGCTTTCTGCCTCCCCTGCC 0: 1
1: 0
2: 4
3: 84
4: 1067
Right 900168758 1:1255899-1255921 CTCCCCTGCCTCGGGGCTCCTGG 0: 1
1: 0
2: 2
3: 48
4: 446
900168750_900168758 -2 Left 900168750 1:1255878-1255900 CCCAGAGCCCAGGCTTTCTGCCT 0: 1
1: 0
2: 7
3: 53
4: 496
Right 900168758 1:1255899-1255921 CTCCCCTGCCTCGGGGCTCCTGG 0: 1
1: 0
2: 2
3: 48
4: 446
900168751_900168758 -3 Left 900168751 1:1255879-1255901 CCAGAGCCCAGGCTTTCTGCCTC 0: 1
1: 0
2: 5
3: 89
4: 1349
Right 900168758 1:1255899-1255921 CTCCCCTGCCTCGGGGCTCCTGG 0: 1
1: 0
2: 2
3: 48
4: 446
900168744_900168758 11 Left 900168744 1:1255865-1255887 CCGCAGGCCACCCCCCAGAGCCC 0: 1
1: 0
2: 3
3: 91
4: 744
Right 900168758 1:1255899-1255921 CTCCCCTGCCTCGGGGCTCCTGG 0: 1
1: 0
2: 2
3: 48
4: 446
900168749_900168758 -1 Left 900168749 1:1255877-1255899 CCCCAGAGCCCAGGCTTTCTGCC 0: 1
1: 0
2: 3
3: 80
4: 562
Right 900168758 1:1255899-1255921 CTCCCCTGCCTCGGGGCTCCTGG 0: 1
1: 0
2: 2
3: 48
4: 446
900168741_900168758 27 Left 900168741 1:1255849-1255871 CCACCAGCACAGCTGTCCGCAGG 0: 1
1: 0
2: 0
3: 25
4: 236
Right 900168758 1:1255899-1255921 CTCCCCTGCCTCGGGGCTCCTGG 0: 1
1: 0
2: 2
3: 48
4: 446

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900168758 Original CRISPR CTCCCCTGCCTCGGGGCTCC TGG Intronic
900168758 1:1255899-1255921 CTCCCCTGCCTCGGGGCTCCTGG + Intronic
900207306 1:1437038-1437060 CTCCACTGCCCCTGGGCACCGGG + Exonic
900357211 1:2270734-2270756 CTTCCCTTCCTCTGGGCCCCTGG + Intronic
900357241 1:2270863-2270885 CTCTCCTGCCCCAGGGCACCTGG + Intronic
900435685 1:2629521-2629543 CTCCCCTGCCCTGGGCCTGCAGG - Exonic
900510049 1:3054538-3054560 CCCTCCTGCTGCGGGGCTCCCGG - Intergenic
900582219 1:3414883-3414905 GACCCCTGGCTCTGGGCTCCAGG + Intronic
900613786 1:3555312-3555334 CTGCCCTGCCTTTGGGCACCTGG - Intronic
900810839 1:4800348-4800370 CTCCCCTCCCATGGGGCCCCTGG - Intergenic
901084781 1:6603627-6603649 CTGCCCGCCCTAGGGGCTCCCGG + Intronic
901490986 1:9596092-9596114 CTGCCCTGCCCCGGGGCTCATGG + Intronic
901741510 1:11345094-11345116 GGCCCCTGCCTCTGGGCTTCAGG - Intergenic
901750487 1:11404119-11404141 CTGCCCTGACTCGGTGCTCTTGG - Intergenic
902257729 1:15200955-15200977 CTCCACTGCCTGGTGCCTCCCGG - Intronic
902295415 1:15463534-15463556 CTCCCAGGCCTGGGGGCTCCTGG - Intronic
902298307 1:15483412-15483434 CTCCCAGGCCTGGGGGCTCCTGG - Intronic
902409147 1:16202574-16202596 CTCCCCTCCCCCGGTCCTCCAGG - Exonic
902546628 1:17194355-17194377 CTCTGGGGCCTCGGGGCTCCTGG + Intergenic
902627221 1:17683587-17683609 CTCAGCTACCTCTGGGCTCCTGG - Intronic
904263342 1:29303794-29303816 TGCCCCAGCCTCGGGGGTCCTGG - Intronic
904264880 1:29312620-29312642 CTACCATGCCACGGGGCTGCTGG + Exonic
904280790 1:29416989-29417011 CTCCCCTGGCCTGGAGCTCCTGG + Intergenic
904379664 1:30102186-30102208 CTCACCTGCCCCTGTGCTCCAGG - Intergenic
904641941 1:31937927-31937949 CTCCCCTTCCCCGAGGCCCCCGG + Intronic
905169031 1:36099013-36099035 CCCCCCTGCCCTGGGGCCCCAGG + Exonic
905872575 1:41413510-41413532 CTGCTCTGCCTCGGTGCCCCAGG + Intergenic
908563090 1:65326583-65326605 CTCCACTGCCCCTGGGCCCCAGG - Intronic
911188409 1:94926315-94926337 CTTCCGTTCCTCGGGGCCCCTGG + Intronic
911563816 1:99438819-99438841 ATCCCCAGCCTGTGGGCTCCAGG + Intergenic
912518101 1:110228392-110228414 CTCCCTGGCCTCAGGTCTCCTGG - Intronic
912797397 1:112701318-112701340 CTGCCCTTCCTCAGGGCCCCTGG - Exonic
914702992 1:150150510-150150532 CTCCCCCGCCCCCGGGCGCCGGG + Intronic
914845614 1:151282247-151282269 CTCTCCTCCCTCCGCGCTCCAGG - Intronic
915634098 1:157174360-157174382 CCCTCCTCCCTCGGGGCTCATGG - Intergenic
916171131 1:162002427-162002449 CTGCCCTGCCTCCGGGCACTGGG - Intronic
918043509 1:180927363-180927385 CTCTCCTGCCTTGGGTCTCAGGG - Intronic
918330398 1:183454683-183454705 CTCACCTGCCTCTGGGCTAGAGG - Intergenic
919640305 1:200039539-200039561 CTCCGCCTCCTCGGGGCTGCCGG - Intronic
920229257 1:204459808-204459830 CTCCCCTTCCTCAGTCCTCCTGG - Intronic
922215390 1:223516060-223516082 CCACACTGCCTCGGGGCTCCTGG + Intergenic
922783771 1:228273042-228273064 CTTCCCTGCCTCGGTCTTCCAGG - Intronic
924415038 1:243849974-243849996 CTCCACTCCCTCCGGGCCCCGGG - Intronic
1063139709 10:3245325-3245347 CTCACATGACTTGGGGCTCCAGG - Intergenic
1063232064 10:4075047-4075069 TTCCCTTGCCTCCGGGCGCCTGG - Intergenic
1063378067 10:5565982-5566004 CCCACCTGCCTCGGGGAGCCTGG - Intergenic
1063955117 10:11258401-11258423 TTCCCCTGGCTCAGGACTCCAGG - Intronic
1065099464 10:22320455-22320477 GACCCCTGCTTCGGGGCTCCGGG + Intronic
1067054402 10:43042642-43042664 CACCCCTCCCTCTGGGCTTCAGG + Intergenic
1067225413 10:44373023-44373045 CTCCTCTGACTCAGGGCTCCTGG - Intronic
1067711752 10:48656048-48656070 CTCCCCTGCCTCGGCCGCCCGGG + Intronic
1067794567 10:49311389-49311411 CTTGTCTTCCTCGGGGCTCCTGG - Intronic
1069486459 10:68827189-68827211 CTCCCCGCCCTGGGGACTCCTGG + Intergenic
1069883632 10:71609597-71609619 CTTCCCTGACTCTGGGCACCCGG + Intronic
1070558073 10:77545579-77545601 CCCCACTGCCTTGTGGCTCCTGG - Intronic
1070759749 10:79016675-79016697 CTCTCCTGCCTCTGGACTTCTGG - Intergenic
1072791347 10:98320556-98320578 CTCCCTTGACTGGGGGATCCTGG - Intergenic
1072971393 10:100020828-100020850 CTTTCCTGCCACAGGGCTCCTGG + Intergenic
1073242186 10:102066035-102066057 CTGCCCTGCCTTCGGGCTGCTGG + Exonic
1073390941 10:103175971-103175993 CCCCCTTGGCTTGGGGCTCCTGG - Intronic
1073425334 10:103452383-103452405 CTCCTCTGCCTGGTGGCGCCGGG - Intronic
1074184381 10:111088110-111088132 CTGCCCTCTCTGGGGGCTCCTGG - Intergenic
1074585900 10:114767920-114767942 ATCCCCGGGCTCGGGGCTGCCGG - Intergenic
1075408601 10:122211135-122211157 CTCCCCTGCCTCCGGGGCCGTGG - Exonic
1075567319 10:123514062-123514084 CTCCCCTTCCCCAGGACTCCAGG - Intergenic
1075593751 10:123712184-123712206 CTCCTCGGCCTTTGGGCTCCAGG - Intronic
1076244638 10:128937210-128937232 CTCTCCTGCCTTTGGACTCCAGG - Intergenic
1076244644 10:128937263-128937285 CTCTCCTGCCTTTGGACTCCAGG - Intergenic
1077047753 11:553854-553876 GACCACTGCCTCGGGGCTGCAGG + Intronic
1077130541 11:970116-970138 CTCCCCTGCCTCTGCCCGCCTGG + Intronic
1077147979 11:1054281-1054303 CTCCCCAGACTCGGCCCTCCCGG - Intergenic
1077204936 11:1337494-1337516 CGCCCCCGCCTCGGGCCCCCGGG - Intergenic
1077217085 11:1399409-1399431 CTCCCCACCCTCGGGCATCCTGG - Intronic
1077268808 11:1665655-1665677 CTCACCTCCCTCTGGGCTCAGGG - Intergenic
1077271945 11:1685525-1685547 CTCACCTCCCTCTGGGCTCAGGG + Intergenic
1077365775 11:2161027-2161049 GTGCCCTGCCTTGGGGCCCCTGG + Exonic
1077410893 11:2403421-2403443 CTCCTCAGCCTCTGGGCTCCCGG - Exonic
1077423157 11:2462395-2462417 GACACCTGCCTGGGGGCTCCCGG + Intronic
1077453852 11:2666254-2666276 CTGCCCAGCCTCGGGGGTCCTGG - Intronic
1077461773 11:2714370-2714392 CTCTCCTGGGTTGGGGCTCCCGG + Intronic
1077465944 11:2733715-2733737 CTCCACTGCCTCTGCCCTCCAGG - Intronic
1081868781 11:46373970-46373992 CTGCTCTGCCTGGTGGCTCCTGG - Intronic
1082808950 11:57467161-57467183 CTCCCATGTCTGGGGGCTCAGGG - Intronic
1083702257 11:64487186-64487208 CTGCCCTGCCTCAGAGCCCCAGG - Intergenic
1083804797 11:65067281-65067303 CAGCCCTGCCTAGGCGCTCCAGG + Intronic
1083883109 11:65558036-65558058 CTACCCTCTCCCGGGGCTCCCGG - Exonic
1084595137 11:70112371-70112393 CTCTCCTGCTTCTTGGCTCCTGG - Intronic
1085254525 11:75164865-75164887 CTCCCCTGTCTCTGGGCCTCAGG + Intronic
1085309343 11:75506974-75506996 CTCCCCTGCCTGGGGACCACAGG - Intronic
1085397146 11:76212269-76212291 CTCCCCTGCCCCAGGCCCCCCGG + Intergenic
1085405795 11:76261086-76261108 CTCCCCTGCCTCTGGAGGCCTGG - Intergenic
1085413354 11:76305094-76305116 CTCCCCTGCCTCCTGCCTACAGG + Intergenic
1087102738 11:94380858-94380880 CTCTCCTTCCACTGGGCTCCTGG + Intronic
1089085775 11:115815700-115815722 CTCCCATGCCTCCAGTCTCCTGG - Intergenic
1089253034 11:117178957-117178979 CGGCCCTGGCCCGGGGCTCCAGG + Exonic
1089454538 11:118618315-118618337 CTCCCCCTCCCCTGGGCTCCAGG + Intronic
1089612426 11:119677000-119677022 CTTCCCTGCCTAAAGGCTCCTGG + Intronic
1090402458 11:126457985-126458007 CACCCCTGCTGCTGGGCTCCTGG + Intronic
1090450028 11:126798109-126798131 TTCCTGTGCCTGGGGGCTCCAGG + Intronic
1090836800 11:130459840-130459862 CTCCCATGCCCCCTGGCTCCTGG + Intronic
1091057251 11:132430514-132430536 CCAGCCTGCCTCGCGGCTCCTGG - Intronic
1091445369 12:541862-541884 CCCCCCGGCCTCTGGCCTCCAGG + Intronic
1092210160 12:6640574-6640596 CTCCCATGCCTCAGCCCTCCAGG + Intronic
1092441364 12:8508178-8508200 CTCCCCTGCTTGGGGGCAGCAGG + Intergenic
1092487326 12:8914344-8914366 CTCCCGGGCCTCTGCGCTCCAGG - Intronic
1092922138 12:13242081-13242103 CTCTCCAGCCTTGGGACTCCAGG - Intergenic
1094703912 12:32896757-32896779 CTCGCCTGCCTCTGGACTCGCGG + Intronic
1096106063 12:48997653-48997675 CTCCCCAGACCCTGGGCTCCCGG - Exonic
1097641715 12:62191136-62191158 TTCCCCTTTCTCGGGGGTCCGGG - Intronic
1097664918 12:62467218-62467240 CTTCACCGCCTCGGGGCTGCTGG - Exonic
1097938361 12:65278429-65278451 CTCCTCTGCCCCAGGGCTGCCGG - Intergenic
1100714104 12:97288073-97288095 GTCCCCTGACTCTGAGCTCCTGG + Intergenic
1101884761 12:108652637-108652659 CTCCTCAGCCTCCTGGCTCCTGG + Intronic
1102000986 12:109558090-109558112 CTCCCCTGACTCAGGCCCCCTGG + Intronic
1102157433 12:110742574-110742596 CTCCCCTCCCTCGAGCCCCCGGG + Intronic
1102428731 12:112864907-112864929 CCCCCCTGCCACGGGGTTTCTGG + Intronic
1102680035 12:114684931-114684953 CTCCCCTGCGTCTGGGCTGGGGG + Intergenic
1103364024 12:120369364-120369386 CCCCCTTCCCGCGGGGCTCCTGG + Intergenic
1103843752 12:123887076-123887098 CTCCCTTCCCTGCGGGCTCCGGG - Intronic
1103920139 12:124395078-124395100 CACCCCTCCCTCGGGGAGCCTGG - Intronic
1103938279 12:124488236-124488258 CTTCCTGGCCTCTGGGCTCCCGG - Intronic
1103986811 12:124772857-124772879 CTTCCCTGTCTCAGGACTCCTGG - Intergenic
1104376538 12:128268397-128268419 CCCGCCTGCCCCGCGGCTCCTGG - Intronic
1104719185 12:131035174-131035196 CTCCCCTTCCTGGTCGCTCCTGG + Intronic
1104725247 12:131071683-131071705 CTCTCCTTCCTCGGGCCTCCTGG - Intronic
1104934393 12:132356797-132356819 CTCCCCTCCTTCTGGGTTCCTGG + Intergenic
1105349308 13:19601754-19601776 CTTTCCCGCCTCTGGGCTCCCGG - Intergenic
1106371307 13:29136493-29136515 CTCCCCTGCCCAGAGGCTGCAGG - Intronic
1106403240 13:29449961-29449983 CTCCCCGTCCTCGGGGACCCAGG + Intronic
1106565863 13:30883984-30884006 CACCGCAGCCTCCGGGCTCCTGG - Intergenic
1107604025 13:42040805-42040827 CGCCGCTGCGCCGGGGCTCCTGG - Intronic
1112291006 13:98143699-98143721 CTCGGGGGCCTCGGGGCTCCGGG + Intronic
1112817532 13:103290725-103290747 CTCCCCTATCTAGTGGCTCCAGG + Intergenic
1113428218 13:110227877-110227899 CAGCCCTGTCTCGGGTCTCCGGG + Intronic
1113463005 13:110495036-110495058 CTCCCGGGCCTCTAGGCTCCTGG - Intronic
1113876622 13:113598614-113598636 TTCCCCTGCCTGATGGCTCCAGG + Intronic
1113906937 13:113823717-113823739 CCCCGGTGCCTCTGGGCTCCGGG - Intronic
1114455268 14:22849722-22849744 CTCCCCTTCTCCAGGGCTCCTGG + Intergenic
1115429562 14:33300760-33300782 CTCCCCTCCATGGGGGATCCTGG - Intronic
1115752377 14:36505654-36505676 CTTGCCCGCCTCGGGGCCCCTGG + Intronic
1118647210 14:67851578-67851600 CTCCCCAGCCTGGGGGCAGCAGG + Intronic
1119322807 14:73741665-73741687 CTCCCCAGCCCCTGTGCTCCTGG + Intronic
1119644955 14:76341407-76341429 CTCCCCTCCCTGTGGCCTCCTGG + Intronic
1119724608 14:76914420-76914442 TTCTCCTGCATCGGGGCTTCAGG - Intergenic
1120388336 14:83873596-83873618 CTCCCCTGCCTGTGGACCCCTGG - Intergenic
1121089510 14:91171432-91171454 CACCTCTGCCCCTGGGCTCCAGG + Intronic
1121279108 14:92687102-92687124 CTCGCCTTCCCCGGGGCTCAGGG - Intronic
1121693188 14:95892458-95892480 GTCGCCTTCCTCAGGGCTCCTGG + Intergenic
1121995721 14:98601454-98601476 GTCCCCTGCCTGTGGGCACCAGG + Intergenic
1122190981 14:100043503-100043525 CTCTCCAGCCTTTGGGCTCCAGG - Intronic
1122441438 14:101734769-101734791 CACCCCTGGCTCGGCTCTCCAGG - Intergenic
1122824282 14:104362158-104362180 CTACCCTGGCTGAGGGCTCCAGG - Intergenic
1122843316 14:104477179-104477201 CTGCCCAGCCTGGGAGCTCCAGG - Intronic
1122982100 14:105196567-105196589 CAGACCTGGCTCGGGGCTCCCGG - Intergenic
1123964340 15:25439470-25439492 CTGCCCCGCCTCGGGGCTGGGGG - Intergenic
1124338728 15:28876345-28876367 CTCCCCTGCCTCGGAGCCTAGGG + Intergenic
1124658577 15:31527308-31527330 CTCCCTGGCCTCCTGGCTCCAGG - Exonic
1124922273 15:34038797-34038819 CGCCCCAGCCTCCCGGCTCCCGG + Exonic
1125731446 15:41894630-41894652 CACCCCTGCCTCCGAGCCCCGGG - Intergenic
1127825210 15:62696863-62696885 CTCCCCTCCCTCGGGTCCTCAGG - Intronic
1127836210 15:62793090-62793112 CTCCCCTGACCAGGGGCTCCTGG - Intronic
1128313184 15:66644448-66644470 CTCCCTTGCCTCTGGGGTACAGG - Intronic
1129188026 15:73922489-73922511 CTCCACTGGCTCTGGGCTCAGGG + Intergenic
1129678677 15:77645905-77645927 CTCCACTGCCTGGGGGTGCCAGG + Intronic
1130348142 15:83067361-83067383 CGCCCCTGCCCTGGGGCTGCCGG - Intergenic
1130520588 15:84658187-84658209 CTTCCCGGCCGCTGGGCTCCGGG + Exonic
1130868719 15:87953256-87953278 CTCCCCTGGCTTGGGGGTCTTGG + Intronic
1131052838 15:89359670-89359692 CTCTCCTGCCTCAGGACTCAGGG - Intergenic
1131544200 15:93302254-93302276 CTGCCCTGCCTCAGTGCTGCTGG - Intergenic
1132708891 16:1257919-1257941 CGCCCCTTCCCCGGGGCTGCAGG + Intronic
1133054849 16:3140779-3140801 CTCAGCCTCCTCGGGGCTCCAGG - Exonic
1133222178 16:4323489-4323511 CTCCCCATCCTGGTGGCTCCGGG - Intronic
1133241331 16:4416181-4416203 CTGCGCCGCCTCGGGGGTCCCGG + Intronic
1133254855 16:4510352-4510374 CTTCCCTGCCTCCTGGCACCGGG + Intergenic
1136054964 16:27681540-27681562 CTCCCCTGCTCAGGGGCCCCCGG - Intronic
1137645102 16:50066579-50066601 CTCCCCCGCGTCTGGGCTGCGGG + Intronic
1137683242 16:50368880-50368902 CCCCCCTGCCTCGCGGCGCGGGG - Intronic
1138433330 16:56983312-56983334 GTCCCCTGCCCCAGGGCTCGAGG + Exonic
1138645427 16:58421048-58421070 CTCCCCTGCCTGGATGCTCCAGG - Intergenic
1138889821 16:61128786-61128808 CTCCCCTGCTCCGTGGCGCCGGG - Intergenic
1141153869 16:81583298-81583320 CCCCCCGGGGTCGGGGCTCCGGG + Intronic
1141187573 16:81798822-81798844 CTCCCCGGCCTCAGGACTTCAGG + Intronic
1141625454 16:85259004-85259026 CTCCCCAGCCTGGCAGCTCCTGG - Intergenic
1141647175 16:85373778-85373800 CTGGGCTGCCTCGGGGATCCAGG - Intergenic
1141677668 16:85526044-85526066 GTCCCCTGGCTCATGGCTCCTGG + Intergenic
1142006998 16:87694101-87694123 CTCCCCTCCCTGTGGTCTCCAGG - Intronic
1142048274 16:87940210-87940232 CTCCCCGGCCATGGGACTCCAGG - Intergenic
1142083851 16:88165496-88165518 TTCCTCAGCCTCTGGGCTCCTGG + Intergenic
1142518685 17:490143-490165 CTCCCCAGCCTGCGGCCTCCCGG - Intergenic
1142766114 17:2065222-2065244 ATCCTCTGCCTCGGGGGCCCTGG + Intronic
1142809712 17:2389752-2389774 TTCTCCTGCCTCTGGGCTCCAGG - Intronic
1142903320 17:3026700-3026722 GTGCCCTGCCTTGGGGTTCCTGG + Intronic
1143009453 17:3857864-3857886 CCTCTCTGCCTCGGGGCTGCCGG - Intergenic
1143102994 17:4514344-4514366 TTCCCCTGCCTGGGCCCTCCTGG + Intronic
1143119932 17:4600149-4600171 CTCGCCTGCCTGGGGCCTCTGGG + Intronic
1143183262 17:4997133-4997155 CTTCCCTCCAGCGGGGCTCCAGG - Intronic
1143532253 17:7512320-7512342 ATCCCCGGCCTGGGGGCTGCTGG + Exonic
1143868757 17:9943052-9943074 CGCCCCGGCCACGGGGCCCCGGG + Intronic
1144682549 17:17205424-17205446 CTCCCCTGCCACCAGGATCCAGG + Intronic
1144692958 17:17280898-17280920 CTCCCCTCCCTCGGGCCGCCGGG - Intronic
1145266748 17:21383336-21383358 ACCCTCTGCCTCGGGGCTCCTGG + Intronic
1146478471 17:33182162-33182184 CACCCCTGCCTCCCTGCTCCAGG - Intronic
1147015518 17:37489213-37489235 CTGCCCTGCCTCGGGGACTCGGG + Intergenic
1147179404 17:38674791-38674813 TTCCCCTGCCTCTGCGCTTCGGG - Exonic
1147384296 17:40072399-40072421 CTCCCCTCCCTGGGGGCGCTTGG + Intronic
1147446794 17:40479642-40479664 TTCCCTTGCCCTGGGGCTCCGGG - Intronic
1147673273 17:42189119-42189141 CTCCCCCGCCTTGGGCTTCCTGG - Exonic
1147882065 17:43660548-43660570 CTTCTCTGCCTCTAGGCTCCTGG + Intronic
1147957083 17:44142086-44142108 CTCCCCGGACTCGGGGTGCCGGG + Exonic
1148978287 17:51548541-51548563 CTCTCCTGCCCTGGGGCTGCAGG - Intergenic
1149554232 17:57561635-57561657 CTCCCCTGCCTGTGGACTTCTGG - Intronic
1150122885 17:62618196-62618218 CTCCCCTGCCTCATGGCTTATGG + Intergenic
1151301985 17:73233087-73233109 CTCCCCAGCCTCCGGGCTCAAGG - Intronic
1151418495 17:73982335-73982357 CTCTCCTGTCTCTGGGCCCCAGG - Intergenic
1151558894 17:74860567-74860589 CTCCCCGCCGTCGGGGATCCTGG + Intronic
1151564635 17:74891063-74891085 CTCAGCTGCCTCTAGGCTCCTGG + Intronic
1151995054 17:77603177-77603199 CACACCTCCCTCGGGGCTCTGGG - Intergenic
1152032722 17:77854067-77854089 CTCCCCAGGCTTGGGGCTGCAGG + Intergenic
1152310243 17:79545509-79545531 CTCCGCTCCCTCTGGGCCCCTGG - Intergenic
1152336504 17:79702265-79702287 TGCCCCTGCCTCGGGCCTGCAGG - Intergenic
1152342645 17:79733755-79733777 CTCCAGGGTCTCGGGGCTCCTGG + Intronic
1152529242 17:80907396-80907418 CTCCCCTGCCTGCGGGCACCAGG - Intronic
1152586890 17:81193217-81193239 CTCCCCTGCCTCCGGCCTGAGGG + Intronic
1152616329 17:81339630-81339652 CTTCCCTGTCACGGGGGTCCAGG - Intergenic
1152641946 17:81452894-81452916 CTCCCCAGCCTCGAGGGCCCAGG - Intronic
1152706680 17:81847210-81847232 ATCCCCAGCCTGGGGGCTGCAGG + Intronic
1152795136 17:82302868-82302890 CCCGCCTGCCTCAGGCCTCCTGG - Intergenic
1152844563 17:82591755-82591777 GACCCCTGCCTCAGGGCTGCGGG + Intronic
1153741277 18:8131232-8131254 CTCTCTTGCTTCGGTGCTCCTGG - Intronic
1159890120 18:73945062-73945084 CTCCCCTGCCTTGATGTTCCAGG + Intergenic
1160139101 18:76303680-76303702 CTCCCCTGCCTTCGGCCCCCCGG - Intergenic
1160418239 18:78726764-78726786 CTCGCCTTCCCCAGGGCTCCAGG - Intergenic
1160978569 19:1806225-1806247 ATCCCGTGCCTCTGGTCTCCCGG - Intronic
1160988070 19:1848634-1848656 CTGCCCTGCCTGCGGTCTCCGGG + Intergenic
1160993986 19:1873431-1873453 CTGCCCTCCCCCCGGGCTCCGGG + Intergenic
1161062747 19:2223219-2223241 CTCTCCTGCCTTGGGGTCCCGGG + Intronic
1161142073 19:2653927-2653949 CTCGCCTGCCTCGGCGAGCCCGG + Intronic
1161155965 19:2732079-2732101 CTCACCTGGCCCGGGGGTCCTGG + Intronic
1161495837 19:4585065-4585087 TCCCCCAGCCCCGGGGCTCCAGG - Intergenic
1161594792 19:5145704-5145726 CTCCCCTGGCTCGAGGCTCCCGG + Intronic
1161963367 19:7534941-7534963 CTCCCGTGCCTCCCAGCTCCTGG + Intronic
1162644001 19:12035501-12035523 CTCCCCCGCCTCGGGACCCCTGG + Intronic
1162659257 19:12156519-12156541 CTCCCCCGTCTCGGGACCCCCGG + Intronic
1163268321 19:16234453-16234475 CACCCCGGCCTCGGGGCTCCTGG + Exonic
1163517945 19:17776088-17776110 CGCTGCTGCCTCGGGGCTGCAGG - Exonic
1163859997 19:19737872-19737894 CAGCCCAGCCTGGGGGCTCCTGG + Intergenic
1164412034 19:28014211-28014233 CTCCCTTGCCTCCTGGTTCCTGG - Intergenic
1164637909 19:29805076-29805098 CGCCCCTGACTCGGTGCACCCGG + Intergenic
1164813631 19:31177426-31177448 CTTCCCAGCCTCGGGGCTGCTGG + Intergenic
1165290834 19:34884038-34884060 CTCCCCAGCCTTTGGACTCCAGG + Intergenic
1165348291 19:35262505-35262527 CTCCCAGGCCTCCGGGCTCAGGG + Intronic
1165813406 19:38626111-38626133 CTCCCCTGCCCCTGGACCCCAGG - Intronic
1166100475 19:40568565-40568587 AATCCCTGCCTCGGGGCACCCGG - Intronic
1166666337 19:44682665-44682687 CACCCCGGCTTCGGGGCTCCTGG - Intronic
1166947204 19:46404541-46404563 CTCTCCTGCCCCGGCCCTCCTGG - Intergenic
1167074990 19:47243228-47243250 CGCCGCAGCCGCGGGGCTCCGGG + Intergenic
1167298153 19:48663868-48663890 CGCCCCTGCCCCGGGAATCCAGG + Intronic
1167367690 19:49063749-49063771 CTCCTCCGCCTCGGAGCTCTGGG + Intronic
1167469122 19:49665669-49665691 CACCCCTGTCTTGGAGCTCCGGG + Exonic
1167620105 19:50555905-50555927 CTCTCCACCCTCTGGGCTCCAGG - Intronic
1167641964 19:50687117-50687139 CCCGCCTCCCTCGGGGCCCCGGG + Intronic
1167645416 19:50702853-50702875 CTCTCCTGCCTCCTGGCTTCCGG + Intronic
1168056202 19:53866581-53866603 CTTCCCTGCCCTGGGGCTTCGGG + Intronic
1168292021 19:55361657-55361679 CTCCCTTGACTCAGGGGTCCAGG + Intronic
1168293162 19:55366913-55366935 CTCCCCTGCCTTGGGATTACAGG + Intronic
925036391 2:690086-690108 CTCCTCTGCCCCGGGGCTGCCGG + Intergenic
925140039 2:1543947-1543969 CCCCTCTGCCTCCCGGCTCCTGG - Intergenic
925421229 2:3713487-3713509 CTCCCCTGACCCTGGGCACCCGG - Intronic
926224181 2:10955567-10955589 CTGCCCTGCACCTGGGCTCCAGG + Intergenic
926934389 2:18072577-18072599 CTCCCCCTCCTCTGGGCTCCTGG + Intronic
927159223 2:20242390-20242412 CTCCCCTGCGCCGCGGGTCCGGG - Intergenic
927519322 2:23689578-23689600 CTCCTCTGCCTGAGGACTCCTGG + Intronic
927965529 2:27265238-27265260 CTTCCCCGCCTGGTGGCTCCCGG - Intronic
928593072 2:32836976-32836998 CTTCCCTCCCTCTGTGCTCCTGG + Intergenic
929902930 2:46021427-46021449 CCCCACTGCCTCTGGACTCCTGG - Intronic
929996151 2:46827536-46827558 CTGCCCTGCCTGGTGGCTTCTGG + Intronic
931706174 2:64948062-64948084 ATCCCCTAGCTCTGGGCTCCTGG + Intergenic
932627292 2:73308003-73308025 CACCTTTGCCTCGGAGCTCCTGG + Intergenic
932769277 2:74491573-74491595 GACCCCTGCCTTGGGGCTCCTGG - Exonic
932892478 2:75609036-75609058 CTGCGCTGCCCTGGGGCTCCTGG + Intergenic
933793505 2:85902396-85902418 CTCCCCTTCCCCAGGACTCCCGG + Intergenic
935605585 2:104969608-104969630 CTCTCCTGCCTCGGACCTGCTGG + Intergenic
936050332 2:109217825-109217847 CTCCCCTGCCTGGGGGAAGCTGG - Intronic
936053986 2:109246897-109246919 CCCCTCTGACTCAGGGCTCCAGG + Intronic
936509377 2:113132930-113132952 TCCCCCTGCCCCAGGGCTCCCGG + Exonic
936713558 2:115161259-115161281 CCCGCCTCCCACGGGGCTCCGGG + Intronic
937478970 2:122239779-122239801 TTCCCCTGTCTCGGGGTGCCGGG + Intergenic
938249462 2:129802803-129802825 CTCCCCTCCCCCAGGCCTCCAGG - Intergenic
938890146 2:135696311-135696333 CTTCCCAGCCTCCTGGCTCCAGG - Intronic
941688790 2:168476670-168476692 CTCTCCAGCCTTGGGACTCCAGG - Intronic
943639541 2:190343642-190343664 CGCTGCCGCCTCGGGGCTCCCGG - Exonic
944516436 2:200516547-200516569 CTGCCCTGGCTCAGGGCTCATGG - Intronic
944802858 2:203253360-203253382 CTCCCCTGGCCCAGGGCTCCGGG + Intronic
945535133 2:211007172-211007194 ATCCCCTGCCTCTGGGCCCATGG - Intergenic
946191521 2:218010306-218010328 CTACCCTGTCCCGGGTCTCCCGG + Intergenic
946248345 2:218399571-218399593 CTCCCCGGCGTGGGCGCTCCCGG + Intronic
946327426 2:218992059-218992081 CTCCCCTGCCTCCTAGCTCCAGG - Intronic
946372850 2:219290964-219290986 CTCCCCTCCCCCAGGCCTCCAGG - Intronic
947065204 2:226216805-226216827 CTCCCCGCCCTAGGTGCTCCAGG - Intergenic
948560751 2:238849434-238849456 CCCGCCTGCCTCAGCGCTCCAGG - Intronic
948572659 2:238927305-238927327 CTCACCTGCCTGGTGGCTCACGG - Intergenic
948625035 2:239263488-239263510 CTGCCCTGCCTGGGGGTTCCTGG - Intronic
948634177 2:239323753-239323775 ATCCCCTGTCACGGGGCCCCGGG + Intronic
1170756949 20:19213022-19213044 CTCCGGCGGCTCGGGGCTCCCGG + Intronic
1170889301 20:20365136-20365158 CTCCCCTTCCTTCGGGGTCCTGG - Intergenic
1171266519 20:23776089-23776111 TTCCTCCTCCTCGGGGCTCCAGG + Intergenic
1171452155 20:25243634-25243656 CTCCCCTGCCCAGAAGCTCCAGG - Intergenic
1172271627 20:33658607-33658629 CTCCCCGGCCTGGGGCCTCATGG + Intronic
1172563555 20:35910566-35910588 CTCCCCTCCCCCTGAGCTCCAGG + Intronic
1172799253 20:37564688-37564710 TTCCCCTTCCTGGGGGCTCTGGG - Intergenic
1173595800 20:44257857-44257879 CTCCCCTGTCTCAGGGTTCTGGG - Intronic
1174171240 20:48619482-48619504 CTCCCCAGCCTCAGTGCCCCAGG + Intergenic
1174524560 20:51160799-51160821 CTCCCCTGCCACAGGGACCCTGG - Intergenic
1175199112 20:57266140-57266162 CTACCCGGGCTCCGGGCTCCGGG + Exonic
1175422027 20:58840660-58840682 CTCCCCTTCCCTGGGGCTCTGGG - Intronic
1175612340 20:60362122-60362144 CTCCCCTGCCACTGCCCTCCAGG - Intergenic
1175936198 20:62515209-62515231 CTCCCCGGCCCCGGGGCCTCAGG - Intergenic
1175975614 20:62709018-62709040 CGCCCCGGGCTCCGGGCTCCGGG - Exonic
1176031725 20:63016088-63016110 CACCCCTGCATCTGGGCTGCTGG + Intergenic
1176031824 20:63016521-63016543 CTCCCCTGTATGGGGGCTCCTGG + Intergenic
1176194292 20:63830518-63830540 CCCCCCGGCCTCAGGGCGCCGGG + Intronic
1176293883 21:5060321-5060343 CTCCCGTGCTGCGGGGCTCCTGG + Intergenic
1178914599 21:36699421-36699443 CTCTCCTGCCTCGGCCTTCCTGG - Exonic
1179052086 21:37896789-37896811 CTCCGCTGCCTCTGGGGCCCGGG - Intronic
1179375570 21:40847189-40847211 CTCCCCTGCCTCTGGCCGCTGGG + Intergenic
1179631270 21:42680105-42680127 CTCCGCTGCCCCCGGGCTCAGGG + Intronic
1179863376 21:44203327-44203349 CTCCCGTGCTGCGGGGCTCCTGG - Intergenic
1180137617 21:45871464-45871486 CACCCCTGCCCCTGGGGTCCTGG - Intronic
1180825184 22:18856673-18856695 CTCCCCTGCCTTGGGCTCCCTGG - Intronic
1180842597 22:18966248-18966270 CACCCCTTCCTCTGGGCACCAGG + Intergenic
1180867529 22:19127924-19127946 CTCCCTCGCCTCTGGGCTCCAGG + Intergenic
1180884474 22:19231008-19231030 CTCCCCAGCCTTTGGACTCCAGG + Intronic
1181187546 22:21117874-21117896 CTCCCCTGCCTTGGGCTCCCTGG + Intergenic
1181211652 22:21292619-21292641 CTCCCCTGCCTTGGGCTCCCTGG - Intergenic
1181397855 22:22634267-22634289 CTCCCCTGCCTTGGGCTCCCTGG + Intergenic
1181651552 22:24261791-24261813 CTCCCCTGCCTTGGGCTCCCTGG - Intergenic
1181705823 22:24648948-24648970 CTCCCCTGCCTTGGGCTCCCTGG + Intergenic
1182368773 22:29796545-29796567 CTGCCATACCTTGGGGCTCCTGG - Intronic
1183360169 22:37379243-37379265 CTCCCGGGCCTCTGGGCTGCGGG - Intronic
1183510775 22:38233485-38233507 CAGCCCTGTCTAGGGGCTCCTGG - Intronic
1183689070 22:39377954-39377976 CTCCCCAGCCTGTGGGCTCCTGG - Intronic
1184670955 22:46012133-46012155 CTCCTCTGCCTCTGAGTTCCAGG - Intergenic
1184720243 22:46308447-46308469 CTCCCCGGCCAGAGGGCTCCAGG - Exonic
1184976473 22:48065972-48065994 CTCCGCTGCCCGGTGGCTCCTGG + Intergenic
1184986428 22:48139302-48139324 CTCCTCTGCCTGGGGTCTCAGGG + Intergenic
1185139924 22:49094361-49094383 CTTTTCTGCCTGGGGGCTCCGGG + Intergenic
1185179011 22:49348686-49348708 CTCCCCTGCATGGTGGCTGCAGG - Intergenic
1185343601 22:50302075-50302097 GGCCCCTCCCTCGGGGCTCCAGG - Intronic
1203215301 22_KI270731v1_random:2813-2835 CTCCCCTGCCTTGGGCTCCCTGG + Intergenic
1203275329 22_KI270734v1_random:82576-82598 CTCCCCTGCCTTGGGCTCCCTGG - Intergenic
950198933 3:11029111-11029133 CTCTCCTGGCTCGGTGCTGCTGG + Intronic
950239752 3:11358202-11358224 CTGCCCTGCCTCAGGGCCCTGGG + Intronic
950246483 3:11424084-11424106 CTCCCCTGCCTCCCGTCGCCTGG + Intronic
950406609 3:12808948-12808970 CACCCCTGCCCCATGGCTCCTGG - Intronic
950490409 3:13301345-13301367 CTCCCCTGCCACGCCCCTCCTGG + Intergenic
950523516 3:13509983-13510005 CTCCCATGGCTCCAGGCTCCTGG + Intergenic
950642642 3:14358497-14358519 CCTCCCTGCCTCCTGGCTCCAGG + Intergenic
950996227 3:17499909-17499931 CTCCCATGTCTGGGGGGTCCAGG + Intronic
951865384 3:27301132-27301154 GTGCCCTGCCTGGGGGCACCTGG - Intronic
952834381 3:37591090-37591112 CCCTCCTGCCCCTGGGCTCCAGG + Intronic
952943354 3:38459636-38459658 GTCCCCGGCCTGGGGGCTCCAGG - Intronic
953430674 3:42837192-42837214 CTCCCCAGCCCCTGGACTCCAGG - Intronic
955340468 3:58121454-58121476 CTCCACTGTGTAGGGGCTCCCGG - Exonic
956041369 3:65148816-65148838 CTCCCCAGCCTTTGGACTCCAGG + Intergenic
956105140 3:65809670-65809692 CTCCCTGGCCTCAGGGCTCCAGG - Intronic
958641552 3:96813552-96813574 CTCCCCGCGCTCGGGTCTCCCGG - Intergenic
958949398 3:100400733-100400755 CGCCCCGGCCTCTGGCCTCCCGG + Exonic
960465977 3:117997124-117997146 CCTCCCTGCCGCCGGGCTCCGGG - Intergenic
961311599 3:126005533-126005555 CTCCCCTGGCTCTGTGCCCCAGG + Intergenic
961734603 3:128993645-128993667 CTCTCCCGCCTGGTGGCTCCCGG - Intronic
963549610 3:146702992-146703014 GTCCCCAGCCTGGAGGCTCCGGG + Intergenic
963713660 3:148777395-148777417 CTCCGCAGCCTTGGGGCTACTGG + Intergenic
966982603 3:185152527-185152549 CTCTGCGGCCGCGGGGCTCCGGG - Intronic
967914126 3:194565470-194565492 ATCCCCTGCCTCGGGCTTCCTGG - Intergenic
968103830 3:195987191-195987213 CTCCCCTGCCTGGTTGCTGCTGG + Intergenic
968302131 3:197624784-197624806 CTCCCCTGCCTGGTTGCTGCTGG + Intergenic
968500186 4:946287-946309 CTTCCCTGCTCCGGGGCACCTGG + Intronic
968760705 4:2441739-2441761 TCTTCCTGCCTCGGGGCTCCAGG + Intronic
968969414 4:3785806-3785828 GTCTCCAGCCTCTGGGCTCCTGG + Intergenic
968975600 4:3820727-3820749 CTCCTCTGGCTCAGGGCCCCAGG + Intergenic
969053538 4:4388069-4388091 CTCCCTTGCCCCGTGGCCCCAGG + Intronic
969264351 4:6055231-6055253 CTGCCCTGCCTCCCGGCCCCTGG - Intronic
969474065 4:7411285-7411307 CTCCCTTGGGTCCGGGCTCCAGG + Intronic
969688444 4:8689948-8689970 CTCTCCTGCCCCGGGCCTGCTGG + Intergenic
972675596 4:41257163-41257185 CGCCCCCGCCTCGGCGCTCGCGG - Intronic
973287186 4:48431788-48431810 CTTCCCTGGCTCCTGGCTCCTGG + Intergenic
974624044 4:64399547-64399569 CTCCCAGGCCTCAGGGCTTCTGG - Intronic
981315441 4:143336345-143336367 CTCCCCCACCCCGGGGCTCGCGG - Intergenic
982106807 4:152018373-152018395 CTCCACTGCCTCCCTGCTCCTGG + Intergenic
984704695 4:182839343-182839365 AGGCCCTGCCTTGGGGCTCCAGG - Intergenic
985498190 5:222881-222903 CTCCCCTGCCTGGCTGCTGCTGG - Intronic
985550184 5:528786-528808 CTCCCCCCGCCCGGGGCTCCGGG + Intergenic
985564133 5:606811-606833 CCACCCTGCCTGGGGGCTCCTGG + Intergenic
985647232 5:1090720-1090742 CTCGCCTGTCACGGGGCTGCGGG - Intronic
985895554 5:2748573-2748595 CTACCCTGCCTCGCCGCTGCTGG - Exonic
993503911 5:88689676-88689698 CTCATCTGCCGCGGGGCTGCCGG + Intergenic
996050227 5:118924046-118924068 CTCCCCTACCTGGGACCTCCAGG + Intronic
997530186 5:134577162-134577184 TTCCCCTGGCTGGGGGGTCCTGG + Intronic
998107652 5:139478500-139478522 CTTCCCTGCCTCAGAGCTCCAGG - Exonic
998928044 5:147148917-147148939 CTTCCCTGCCTTGGGGCACTGGG + Intergenic
999264124 5:150255456-150255478 CACCCCTGCCACGGTCCTCCCGG - Intronic
999366596 5:151027610-151027632 CTCCCCTGCTCCTGGGCTCTTGG + Intronic
1000751682 5:165102844-165102866 CCCCCCTGCCTCTGTGTTCCAGG + Intergenic
1002312847 5:178325153-178325175 CTCCCCAGGCTCCAGGCTCCAGG + Intronic
1002394082 5:178940003-178940025 CTCGCCTCCCTCGTGACTCCAGG - Intergenic
1002460766 5:179372495-179372517 CTCCCCTTCCCCGGGGCCCAGGG - Intergenic
1002574072 5:180161660-180161682 CTCCCCAGCCCCGCGGCTCCTGG + Intronic
1003590269 6:7431578-7431600 CTCACCTCCCACGCGGCTCCTGG + Intergenic
1004861042 6:19804938-19804960 CTCCCGGGCCGCGCGGCTCCAGG - Intergenic
1006366798 6:33621037-33621059 CTCTCCGCCCTCGGGGTTCCCGG - Exonic
1006428204 6:33979205-33979227 CTCCCCTGCCTTGGGGAGCAGGG + Intergenic
1006694659 6:35920881-35920903 ACCCCCTGCCTCTGGGCTGCGGG - Intronic
1006740206 6:36302506-36302528 CTCGCTTGCCAAGGGGCTCCAGG - Intronic
1006835538 6:36996794-36996816 CTCCCCTTTCTCTTGGCTCCAGG - Intergenic
1007255650 6:40526533-40526555 CTCCCCTGCCCTGGAGCTCTGGG + Intronic
1007277925 6:40689203-40689225 CTCCTCTGTCACAGGGCTCCTGG + Intergenic
1008760352 6:54846476-54846498 CTGCCCGCCCTCGGGGCTACGGG - Intergenic
1013181673 6:107721653-107721675 CTCACCTGGCTCAGGACTCCTGG + Intronic
1013737918 6:113248923-113248945 CTGCCCTGCCTCTGTGGTCCAGG + Intergenic
1014999017 6:128191387-128191409 CTGCCCTGCCCCGGTGCTCCTGG - Intronic
1017311478 6:152982472-152982494 CTCCCCCACCCCGGGGCCCCCGG - Intronic
1018457967 6:163969757-163969779 CTCCTGTGCCTCGGGACCCCTGG + Intergenic
1018472117 6:164106473-164106495 CTGCCCTGCATCGGGGCTGCGGG + Intergenic
1019348722 7:543246-543268 CACCCCTGCCGAGGGCCTCCTGG + Intergenic
1019460188 7:1154112-1154134 CTCCACTGTCCCAGGGCTCCTGG - Intronic
1019476625 7:1247560-1247582 GTCCCCAGCCTGGGGGCTCAGGG + Intergenic
1019898223 7:3999555-3999577 CTCCCCCGCCCCGAGGCACCAGG - Intronic
1020006343 7:4785411-4785433 TCCCCCTTCCTCAGGGCTCCTGG - Exonic
1020078487 7:5274125-5274147 CTGTCCAGCCTCGTGGCTCCAGG - Intergenic
1022832162 7:34078963-34078985 CTCCCCTGCCTCGCCCTTCCAGG + Exonic
1023616492 7:42025271-42025293 CTCCCCAGCCCAGGGGCTCGGGG - Exonic
1023722693 7:43112764-43112786 CTCCGCTCTCTCGGGGCACCCGG + Exonic
1024556389 7:50606447-50606469 ATGCCGGGCCTCGGGGCTCCCGG - Intronic
1025230962 7:57203183-57203205 CTCCTCCGCCTCGGCCCTCCTGG + Intergenic
1026579556 7:71602634-71602656 CTCCCCTGCCACATGGCTACAGG - Intronic
1026802797 7:73410721-73410743 CCCCCCCACCTCTGGGCTCCTGG - Intergenic
1027029056 7:74875036-74875058 CCCCCCCACCTCTGGGCTCCCGG - Intergenic
1027229293 7:76262953-76262975 CTGCCCTTCCTCTGGGCTGCTGG - Intronic
1030630906 7:111894633-111894655 TTCCCTTGCCTTGTGGCTCCTGG - Intronic
1031317514 7:120274714-120274736 CTCTCCTGCCTCGGGGGAGCCGG - Exonic
1033156313 7:138960097-138960119 CTCCTCTGCCACAGAGCTCCAGG - Intronic
1034493603 7:151407482-151407504 GTCCCCAGCCCAGGGGCTCCCGG + Intronic
1034679154 7:152915371-152915393 CTCCCATGACTAGTGGCTCCAGG - Intergenic
1035168204 7:157003853-157003875 CTCCTCTGCCTCAGGGCGCGGGG - Intronic
1035224154 7:157424433-157424455 CTCCCCTGGCTAGGGGGTTCTGG - Intergenic
1035472222 7:159117718-159117740 TTCCCATGACTCGGGCCTCCTGG - Intronic
1036294976 8:7528345-7528367 CTCCCCTGCCTCCAGGACCCAGG - Intergenic
1036327588 8:7792646-7792668 CTCCCCTGCCTCCAGGACCCAGG + Intergenic
1036664133 8:10727930-10727952 CTCCCCTGGCTCTGAGCCCCTGG - Intronic
1037529229 8:19757377-19757399 CTACCCTGCGGCGGGGCGCCAGG - Intronic
1038205355 8:25459407-25459429 CTCGCCTGCCACGGGGCTCTGGG + Exonic
1039904180 8:41774108-41774130 CTTCCCTGCCCAGGGGGTCCTGG - Intronic
1040533153 8:48282404-48282426 CTCTCCTGCCTTTGTGCTCCAGG + Intergenic
1041311247 8:56519031-56519053 CTGCCCTGCCCTGTGGCTCCTGG - Intergenic
1043021258 8:75002753-75002775 CTCTCCTGCCCCCTGGCTCCTGG - Intronic
1043400343 8:79878360-79878382 CTCCCCTGTCTCTTGGCTCCAGG + Intergenic
1047929501 8:129712820-129712842 CTCTCCTGCCTTGGGGCAGCAGG + Intergenic
1048437388 8:134431262-134431284 CTCACCAGCCTGGGGTCTCCTGG - Intergenic
1049373461 8:142278454-142278476 CTCCCCTTCCTGGGAGCTGCTGG - Intronic
1049427123 8:142542540-142542562 CCCCCCAGCCTGGGGGATCCCGG + Exonic
1049469344 8:142768530-142768552 CTTCCCTGCACCAGGGCTCCTGG - Intronic
1049473615 8:142787050-142787072 CTCTCCTGGCTCTGGGCTCAGGG + Intergenic
1049643500 8:143726005-143726027 TTCCCCTGCCCCAGGGCTGCTGG + Exonic
1049784580 8:144444342-144444364 CTCCCCAGCCTCCGCGCCCCCGG + Intronic
1051108115 9:13603825-13603847 CTCCTCTGCCTTGGTGCTGCGGG + Intergenic
1054775949 9:69123444-69123466 TTCCCCAGCCTCTGGGCTTCTGG + Intronic
1056370730 9:85951735-85951757 CACCCCTGCCTCTGGGTTCAAGG + Intronic
1056873246 9:90304508-90304530 CTCTCCTGCCTGGTGGCTCCAGG - Intergenic
1058467607 9:105244799-105244821 CTCGCATGCCGAGGGGCTCCGGG + Exonic
1058668660 9:107342473-107342495 CTCCCCTGCCCAGGGGCTGCAGG - Intergenic
1059508111 9:114818504-114818526 CTCCCCTGTCTCTGGTCTCCAGG + Intergenic
1059769854 9:117414887-117414909 CGGCCCCGGCTCGGGGCTCCGGG - Exonic
1060358348 9:122931481-122931503 CTCCGGCCCCTCGGGGCTCCGGG + Exonic
1060555122 9:124504207-124504229 CTCCCCGGCCTCGTCTCTCCGGG - Intronic
1061388240 9:130303026-130303048 GTCCCCAGCCACAGGGCTCCTGG + Intronic
1061622208 9:131818032-131818054 CTGCCCTGGCTCTTGGCTCCTGG + Intergenic
1061803891 9:133127675-133127697 CTCCCCTGCCACTGGGTTCCTGG + Intronic
1062216320 9:135391583-135391605 CACTCCTGCCTCGGGGCGCCGGG + Intergenic
1062277754 9:135738793-135738815 CTCCCCTGACCCTGAGCTCCGGG + Intronic
1062540475 9:137039723-137039745 CTCCCCGACCTCGAGGCCCCCGG - Exonic
1062623756 9:137433951-137433973 CTCTCCTGCCTCAGGGAGCCGGG + Exonic
1185449766 X:275932-275954 CACCCCGTCCTGGGGGCTCCGGG + Intergenic
1185621966 X:1455480-1455502 CTCCCGCTCCTGGGGGCTCCAGG + Intergenic
1186465181 X:9779298-9779320 ATCCCCTGCCTTGAGGCTGCTGG + Intronic
1186878464 X:13840389-13840411 CCTCCCTGCCTGCGGGCTCCGGG + Intronic
1187391808 X:18891062-18891084 CACCCCCGGCTCGAGGCTCCAGG + Intergenic
1187412489 X:19063265-19063287 CTCCCCCGACCCGGGGCTCTGGG - Intronic
1187688462 X:21839878-21839900 TTCCCCTGCCTGGCGCCTCCCGG + Intronic
1188739823 X:33764300-33764322 CCCCAGTGCCTCTGGGCTCCTGG + Intergenic
1191686833 X:63900328-63900350 CCCCTCTGCCTCTGGTCTCCTGG - Intergenic
1192156044 X:68747343-68747365 CTGCCCTGCCTCTGGGATTCTGG + Intergenic
1192168923 X:68842590-68842612 CTGCCCTGCCTCAGGACGCCTGG + Intergenic
1193906863 X:87254436-87254458 CTCCTCTGCCTCAGGTCTGCTGG - Intergenic
1199628363 X:149760200-149760222 CTCCCCTACCTGGGGCCTCCAGG - Intergenic
1199972839 X:152873298-152873320 CTCACCTGCCTCAGGGCACCTGG + Intergenic
1200062109 X:153488306-153488328 CCCCTCTGCCTCCGGGCTGCTGG + Intronic
1200123229 X:153800997-153801019 CTTCCCTGCAGCGGGACTCCAGG + Intergenic
1200365445 X:155657641-155657663 CTCCCCTGCCCAGTGGCGCCTGG - Intronic