ID: 900171118

View in Genome Browser
Species Human (GRCh38)
Location 1:1269303-1269325
Sequence CACACCCGAGACTGGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 3, 1: 1, 2: 1, 3: 25, 4: 203}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900171108_900171118 -7 Left 900171108 1:1269287-1269309 CCCAAAGCCCCTCAGCCACACCC 0: 1
1: 2
2: 1
3: 41
4: 390
Right 900171118 1:1269303-1269325 CACACCCGAGACTGGGGAGAGGG 0: 3
1: 1
2: 1
3: 25
4: 203
900171107_900171118 -6 Left 900171107 1:1269286-1269308 CCCCAAAGCCCCTCAGCCACACC 0: 1
1: 3
2: 2
3: 41
4: 356
Right 900171118 1:1269303-1269325 CACACCCGAGACTGGGGAGAGGG 0: 3
1: 1
2: 1
3: 25
4: 203
900171109_900171118 -8 Left 900171109 1:1269288-1269310 CCAAAGCCCCTCAGCCACACCCG 0: 1
1: 2
2: 3
3: 26
4: 250
Right 900171118 1:1269303-1269325 CACACCCGAGACTGGGGAGAGGG 0: 3
1: 1
2: 1
3: 25
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900171118 Original CRISPR CACACCCGAGACTGGGGAGA GGG Intronic
900171075 1:1269145-1269167 CACACCCGAGACTGGGGAGAGGG + Intronic
900171097 1:1269224-1269246 CACACCCGAGACTGGGGAGAGGG + Intronic
900171118 1:1269303-1269325 CACACCCGAGACTGGGGAGAGGG + Intronic
900171140 1:1269382-1269404 CACACCTGAGACTGGGGAGAGGG + Intronic
900542030 1:3207791-3207813 CACACTCGAAACTCTGGAGACGG - Intronic
902403043 1:16168236-16168258 ATCACCTGAGCCTGGGGAGATGG - Intergenic
902674353 1:17998344-17998366 CACAGCCTAGACTTGGGAGGGGG - Intergenic
903325656 1:22567284-22567306 CAAAGCCGAGTTTGGGGAGATGG - Intronic
903369547 1:22826363-22826385 CAAACCCCAGAATGGGGAGAGGG + Intronic
904323066 1:29709209-29709231 CCCAGCCCAGCCTGGGGAGAGGG + Intergenic
906074497 1:43042051-43042073 CTCATCGGAGACTGGGGTGATGG - Intergenic
907400753 1:54223420-54223442 GACAGCCGAGACTGGGGCGGGGG + Intronic
911220497 1:95240561-95240583 GACACCCAAGACTGAGGACATGG + Intronic
911957750 1:104259792-104259814 CACACACGAGAGAGGGGTGAGGG - Intergenic
912254785 1:108047552-108047574 TCCACCGGAGACTGGGGAGGGGG + Intergenic
916174241 1:162024243-162024265 CACACCTGGGGCAGGGGAGAAGG + Intergenic
918316372 1:183326073-183326095 CACACACAAGACAGGGGAGCAGG + Intronic
920263701 1:204706819-204706841 CACACCCCAACCTGGGGAGAAGG + Intergenic
920540934 1:206777513-206777535 CAAACCCAAGAGTGGGGAGCAGG + Intergenic
921831604 1:219733455-219733477 CACACCCAAGACAAGGCAGAGGG + Intronic
922505218 1:226122123-226122145 CCCGCCCGAGACTGGTGAGGCGG - Intergenic
923171571 1:231421953-231421975 CTCGCCCGAGGCTGGGGAGCGGG + Exonic
924065655 1:240219194-240219216 CAAACCCGAGGCTGGGTAGAAGG - Intronic
1065194759 10:23253135-23253157 CATACCTGAGACTGGGAAGAAGG - Intergenic
1074362454 10:112834228-112834250 CAGACCAGAGACTGGGGCGGGGG - Intergenic
1076750865 10:132542252-132542274 CAAACCCGGGTCTGGGCAGAGGG - Intronic
1076768625 10:132651239-132651261 CTCCCCAGAGACGGGGGAGATGG - Intronic
1076768646 10:132651285-132651307 CTCCCCAGAGACGGGGGAGATGG - Intronic
1076768666 10:132651331-132651353 CTCCCCAGAGACGGGGGAGATGG - Intronic
1076768687 10:132651377-132651399 CTCCCCAGAGACGGGGGAGATGG - Intronic
1076768708 10:132651423-132651445 CTCCCCAGAGACGGGGGAGATGG - Intronic
1076768746 10:132651515-132651537 CTCTCCAGAGACGGGGGAGATGG - Intronic
1077339182 11:2018447-2018469 CACACCTGAGAGAGGTGAGATGG + Intergenic
1077351760 11:2096432-2096454 CACAGCCGGGACTGGGGAAAAGG - Intergenic
1077453854 11:2666258-2666280 GACCCCCGAGGCTGGGCAGAGGG + Intronic
1081567573 11:44269609-44269631 GAGACCCCAAACTGGGGAGAGGG - Intronic
1082011097 11:47449931-47449953 AACACCAGATACTGTGGAGAAGG + Intergenic
1083679248 11:64343698-64343720 CACCCCAGAGGCTTGGGAGAAGG - Intronic
1083842101 11:65310399-65310421 CACATCTGTGAATGGGGAGAAGG + Intergenic
1084356323 11:68641200-68641222 CAGAGCCAAGACTGGGGAGATGG - Intergenic
1084480192 11:69415609-69415631 CTCACCCCAGACTGGGAGGAAGG - Intergenic
1087181985 11:95150639-95150661 CGCTCCCGAGACTCCGGAGACGG - Intergenic
1089190335 11:116648932-116648954 CAAAGCCGAGCCTGGGAAGAGGG + Intergenic
1089828375 11:121300704-121300726 CATACCCAAGAAAGGGGAGAAGG + Intronic
1091172248 11:133529464-133529486 CACACCCAAGACAGGGCAGAGGG - Intronic
1202822166 11_KI270721v1_random:73629-73651 CACACCTGAGAGAGGTGAGATGG + Intergenic
1094022160 12:25926022-25926044 CACACCTGAGATTGAGGAGTGGG - Intergenic
1100620870 12:96271455-96271477 CACACGCGCCACTGGGGAGTGGG - Intergenic
1103840617 12:123861091-123861113 ACCACCCGAGACTGGACAGATGG + Exonic
1104006736 12:124898297-124898319 TTCACCAGGGACTGGGGAGAGGG + Intergenic
1104149283 12:126066896-126066918 CTCACACGAGACTTGGGAGTAGG + Intergenic
1104773465 12:131379086-131379108 TACCCCCGAGACTGGGCAGTGGG + Intergenic
1107994997 13:45850958-45850980 CACACACGAGTCTGAGGACAAGG + Intronic
1110707159 13:78608954-78608976 CAAACCCGAGAGTGCGGAGCTGG + Intergenic
1114459848 14:22879306-22879328 CTCTCCAGAGACTGGGGAGAGGG + Exonic
1116039063 14:39663611-39663633 CACACCCCACACTGGGCATATGG - Intergenic
1118311776 14:64698986-64699008 AACACCTGAGACTAGGGAGTTGG - Intergenic
1120509431 14:85395791-85395813 CACACTCAAGACAGAGGAGAAGG + Intergenic
1120550814 14:85870147-85870169 ATCACCTGAGACTGGAGAGATGG + Intergenic
1122209048 14:100163152-100163174 CACACCCGAGCCGGGCGAGGTGG + Intergenic
1122266563 14:100549511-100549533 CACAGCCTGGACTGGGCAGAGGG - Intronic
1123012887 14:105357774-105357796 CACGCCTGAGACGGGGGTGAGGG + Intronic
1127269923 15:57391144-57391166 CAGACCCTAGACTGGGAACAGGG - Intronic
1128133604 15:65246716-65246738 CACATCAGAGAATGGGGTGAAGG + Intronic
1128225830 15:66000743-66000765 CACAACCTAGAGTGGAGAGACGG + Intronic
1128512232 15:68320406-68320428 ACCACCAGAGACTGGGCAGATGG + Intronic
1129683278 15:77670627-77670649 CTCACCTGAGACTGGGGCCATGG - Intronic
1130871287 15:87974177-87974199 CACACCTGTGGCTGGGGAGGTGG + Intronic
1131101155 15:89690957-89690979 AACGCCCGAGTCTGGGGAGACGG - Intronic
1131109494 15:89756218-89756240 CAACCCCTAGAGTGGGGAGAAGG + Intergenic
1132765071 16:1530470-1530492 CACACCTGGGCCTCGGGAGAGGG - Intronic
1133235431 16:4385317-4385339 CCCACCCGTGGCTGGGGAGCAGG - Intronic
1136172008 16:28495336-28495358 CAGACCTGGGGCTGGGGAGATGG + Exonic
1136548017 16:30966160-30966182 CTCTCCCGAGACTGAGGAGGAGG - Exonic
1137733305 16:50705898-50705920 CACACTCCAGTCAGGGGAGAGGG + Intronic
1138307291 16:55989282-55989304 CACACCCCAGACGGGGCAGCCGG - Intergenic
1140199496 16:72882960-72882982 CACACCCCAGAGTGGTGTGAAGG - Intronic
1142385937 16:89764754-89764776 CACACCCTAGACTCGGGACGTGG + Intronic
1145327730 17:21844447-21844469 CACTCCCGAGCCGGGGGAGCTGG - Intergenic
1145746689 17:27325220-27325242 CACACCCTACACTGGGGAACTGG + Intergenic
1148559304 17:48596904-48596926 CCCACCTGAGCCTGGGGGGAGGG + Intronic
1149727836 17:58914584-58914606 CACACTCAAGACTGGGGATGGGG - Intronic
1150062904 17:62084232-62084254 CACACATGAGACAGTGGAGAAGG + Intergenic
1150634409 17:66902741-66902763 CCCACACGAGACTGTGAAGATGG + Intergenic
1150815316 17:68388097-68388119 TACTCCAGGGACTGGGGAGATGG + Intronic
1151940713 17:77290090-77290112 CACACCAGCAGCTGGGGAGAGGG - Intronic
1151945550 17:77318106-77318128 CAGACCAGGGAGTGGGGAGATGG - Intronic
1152323390 17:79621912-79621934 GACACCCGAATCCGGGGAGAAGG + Intergenic
1152776469 17:82205012-82205034 TACACCCGACACTGGGGTGATGG - Intronic
1155998658 18:32359516-32359538 CTCACCCCAGGCTGGGGAGTGGG - Intronic
1157464436 18:47931249-47931271 CTCACGCTAGACTGGGGAGGCGG - Intergenic
1161296160 19:3521362-3521384 GTCACCAGGGACTGGGGAGAGGG + Intronic
1162514300 19:11138852-11138874 CTGACCCCAGACTGGGGAGCGGG - Intronic
1162918779 19:13888456-13888478 CACACCTGAGCCTGGGCTGAGGG - Intronic
1163004157 19:14387114-14387136 CACACACTACACTGGGGAGTGGG + Intronic
1163789421 19:19297716-19297738 CAGACACGAGACAGGGCAGAGGG + Intronic
1164386698 19:27777425-27777447 CCCAGGCGAGACAGGGGAGATGG - Intergenic
1164760797 19:30726891-30726913 CACAGCCGGTTCTGGGGAGAAGG - Intergenic
1165803698 19:38567770-38567792 CAGTGCCGAGAATGGGGAGAAGG + Exonic
1166366655 19:42281419-42281441 CACACCCAGGCCTGGGGACAGGG - Intronic
1167307154 19:48715757-48715779 CGGATCCGAGACTGGAGAGACGG + Exonic
1167337511 19:48896063-48896085 CAAACCCGGGATTGCGGAGACGG - Intronic
1167446757 19:49542563-49542585 CTCAGCCGAGCCTGGGGAGGAGG + Exonic
925234840 2:2269045-2269067 CACACAGGAGACTGGGCTGATGG - Intronic
925621941 2:5802756-5802778 CACACCCAAGACTGGGAAAGAGG - Intergenic
927114600 2:19888130-19888152 CACAAGGGAGTCTGGGGAGAAGG - Intergenic
927706260 2:25298282-25298304 CACAGCCGAGTGAGGGGAGAGGG - Intronic
927945004 2:27130399-27130421 CTCACCACAGACGGGGGAGAAGG - Exonic
928091544 2:28377827-28377849 CAAACCTGAGTCTGGGGGGAAGG - Intergenic
929531105 2:42753455-42753477 CACAGCCGTGCCTGGGAAGAAGG + Exonic
929720496 2:44362436-44362458 CGCACCAGAGACTGGCGAGAAGG - Intronic
930701211 2:54458564-54458586 CACAGCTGTGACTGGGGAGAGGG + Intronic
934930748 2:98420761-98420783 CACAACAGAGACTGCAGAGAGGG + Intergenic
938236848 2:129712298-129712320 CACACCAGAGATTGGGGATGAGG - Intergenic
941934215 2:170970717-170970739 CACAGCTGAGTCTGGGGAGAGGG + Intergenic
944904221 2:204246257-204246279 GACACCAGAGGCTGGGGAGGCGG - Intergenic
946135514 2:217643805-217643827 CAGCCCCAAGGCTGGGGAGATGG + Intronic
947232437 2:227901952-227901974 TACATCCGAGACTGAGGGGAAGG + Intronic
947757746 2:232580380-232580402 CACACTAGAAACTGGGCAGATGG - Intronic
948669043 2:239554941-239554963 CACACCCGACAGAGAGGAGAGGG + Intergenic
948953142 2:241268001-241268023 CTCACCTGGAACTGGGGAGAGGG - Intronic
1171074390 20:22107562-22107584 CACAGCCGAGATTGCAGAGATGG + Intergenic
1171078771 20:22156343-22156365 CACAACCCAGACCGGGGAGAAGG + Intergenic
1172265697 20:33611287-33611309 CTCCCCTGAGATTGGGGAGAAGG + Exonic
1172618386 20:36305178-36305200 CAGACCAGACACTGGGGAAAGGG + Intergenic
1172793314 20:37520931-37520953 CAGGCCAGGGACTGGGGAGAAGG + Intronic
1173722191 20:45269198-45269220 CACATCCCAGCCTGGGGACAAGG + Intergenic
1173873145 20:46354154-46354176 CACACAGGAGCCTGGGGACATGG - Intronic
1174332728 20:49832594-49832616 CAAAGCCGTGAGTGGGGAGAGGG - Intronic
1174363566 20:50043147-50043169 CAGGCCCGAGACAGGGGTGAAGG - Intergenic
1175515628 20:59568194-59568216 CACACCTGAGGCTGGGCAGGTGG + Intergenic
1176031291 20:63014051-63014073 CCCACCTGAGAGTGGGGAGTTGG - Intergenic
1176286173 21:5020659-5020681 CACCCGCGGGACTGCGGAGAGGG - Intergenic
1177404243 21:20645465-20645487 CACTTCCGAGACTGGGGGCAAGG - Intergenic
1178523472 21:33305192-33305214 ATCACCTGAGCCTGGGGAGATGG - Intergenic
1179871008 21:44242816-44242838 CACCCGCGGGACTGCGGAGAGGG + Intergenic
1180148966 21:45937989-45938011 CCCTCCAGAGCCTGGGGAGATGG + Intronic
1181167220 22:20990307-20990329 CACACTCGAGACTGCTGAGATGG - Intronic
1181358688 22:22318553-22318575 CACACTCCAGACTGAGGAGGAGG - Intergenic
1182274387 22:29177011-29177033 CCCAGCTGAGACTGAGGAGAGGG + Intergenic
1183187312 22:36299551-36299573 CCCACCCGGGACTGGGATGAGGG - Intronic
1185079684 22:48702750-48702772 CTCACCCGAGCCCGGGGAAAGGG + Intronic
1185234047 22:49700789-49700811 AATACCCGAGACTGGGTATAAGG - Intergenic
950217599 3:11170431-11170453 CACACCCCACACTGGGCAGTGGG + Intronic
950612723 3:14136677-14136699 CACAGCCCAGAGCGGGGAGAGGG + Intronic
950625389 3:14242827-14242849 CACACTGGAGAGTGGGGAGAGGG + Intergenic
950685853 3:14618247-14618269 CACTCCCAACAGTGGGGAGATGG + Intergenic
951734568 3:25850010-25850032 CAGACTCCAGAATGGGGAGATGG + Intergenic
953994530 3:47509495-47509517 CAGACCCCAGTGTGGGGAGAGGG - Intronic
954708978 3:52495649-52495671 CAGACCTCAGACTGGGGAGGTGG - Intronic
954794391 3:53154220-53154242 CACTCCCCAGACTCTGGAGAAGG - Intergenic
956075714 3:65503069-65503091 CACACCTGGGAGTGGGGAGGGGG - Intronic
957025680 3:75178924-75178946 CTCAGCCGAAACTTGGGAGAAGG - Intergenic
957789223 3:84918603-84918625 CACTTCCCAGACTGGGCAGACGG - Intergenic
960619507 3:119625087-119625109 CACAACAGAGACTGGCCAGAGGG - Intronic
962163890 3:133028660-133028682 CTGAACCGAGACTTGGGAGATGG + Intergenic
966851526 3:184167886-184167908 CACATCTGAGCCTGGGGACAAGG - Exonic
967609030 3:191482365-191482387 CAAACCTGAGACTAGGGAGAAGG - Intergenic
967980917 3:195064961-195064983 CTCACCTGGAACTGGGGAGAAGG + Intergenic
969285093 4:6198099-6198121 CCCACTAGAGACTGGGGACACGG - Intronic
969288191 4:6221552-6221574 CCCACCCGAGACAGGTGAGCTGG - Intergenic
969525830 4:7703604-7703626 CCCACCCCAGCCTGGGGAGCAGG + Intronic
969603779 4:8191737-8191759 CAGACCCAAGAATGGGGGGAAGG - Intronic
974862876 4:67545261-67545283 GGCGCCCGAGGCTGGGGAGAAGG - Intronic
975029927 4:69601798-69601820 CACACCCCAGACTGGTGCTAGGG - Intronic
975487069 4:74945917-74945939 CACAGGTGTGACTGGGGAGAGGG + Intronic
977203084 4:94139911-94139933 GACACTCGAGTCTGGGGAAAAGG - Intergenic
977519183 4:98059275-98059297 CCCTCCCAAGACTGGAGAGAGGG + Intronic
977578683 4:98701474-98701496 CCCAACCAAGACTGGGGATAGGG - Intergenic
978372820 4:108046238-108046260 CACACCTGAGACTCGGGACTTGG + Intergenic
978469914 4:109053953-109053975 AATACCCGAGAATAGGGAGAAGG + Intronic
979745350 4:124206001-124206023 CACAACCGACACAGGAGAGAAGG + Intergenic
981521685 4:145668956-145668978 CTCACCAGAGAGTGGGGAAAAGG + Intergenic
985011582 4:185588010-185588032 CACACCAGAGTCGGGGGTGAGGG + Intronic
985392990 4:189511728-189511750 CTCACAGGAGACTGGGGAGAGGG - Intergenic
988053695 5:26063652-26063674 CATACCTAAGACTGGGGAAAGGG + Intergenic
988492723 5:31718264-31718286 CACACCCTGGGCTGGGAAGATGG - Intronic
989705527 5:44325717-44325739 CACACCAGGGCCTGGGGAGGGGG + Intronic
992052680 5:72955872-72955894 AACACCCGAGAATGGGGACAGGG + Intergenic
997235878 5:132271677-132271699 GGCACCCGAGACTGGGGAACGGG - Intronic
999258336 5:150222344-150222366 CCCACCAGGGGCTGGGGAGAAGG - Intronic
1000152244 5:158514826-158514848 CACACTGGAGACTGGACAGATGG + Intergenic
1000289364 5:159855809-159855831 GACACCCCAGAATGGGGAGAGGG + Intergenic
1000603105 5:163298402-163298424 AACACCCCAGACTTAGGAGAAGG + Intergenic
1001237997 5:170045965-170045987 CACCCCAGATCCTGGGGAGATGG + Intronic
1001868589 5:175129458-175129480 CACACCTAATACTGGAGAGATGG - Intergenic
1002031515 5:176433766-176433788 CACATCCCAGACTGGGCAGCGGG - Intergenic
1002586598 5:180252669-180252691 CACACTGAGGACTGGGGAGACGG + Intronic
1003640313 6:7870182-7870204 CACACCTGGGGCTTGGGAGAGGG + Intronic
1004186534 6:13426194-13426216 CACAGCCAAGCCAGGGGAGAAGG - Intronic
1012220744 6:96646304-96646326 CAAACCAGAGATTTGGGAGAAGG - Intergenic
1015761750 6:136669509-136669531 CACACCAGATTCTGGGGTGAAGG - Intronic
1018481344 6:164194267-164194289 CACTCCCAAGAGTGGGGGGAAGG - Intergenic
1019963698 7:4482246-4482268 CACACCCAAGACTGGGGGCCGGG - Intergenic
1023968680 7:44976729-44976751 CACCCCCAAGACTGGCAAGATGG + Intronic
1029061299 7:97800806-97800828 CACTCCTTAGACTGGGGAGAGGG - Intergenic
1029116613 7:98241022-98241044 CATACCCTGTACTGGGGAGAAGG - Intronic
1033293999 7:140114658-140114680 CACTCCCCAGACTGGGCAGCCGG - Intronic
1033921563 7:146399331-146399353 CATACCAGAGACTGGAGGGAAGG - Intronic
1034552731 7:151831902-151831924 CAGAACCGAGACGGGAGAGAGGG + Intronic
1034565699 7:151913482-151913504 CACACCCAAGAATGGGTAAATGG - Intergenic
1036097757 8:5742260-5742282 GGCAGCCGAGACTCGGGAGACGG - Intergenic
1038413875 8:27378983-27379005 CACATCCGACACGGGGGAGCTGG + Intronic
1040429588 8:47326078-47326100 ATCACCTGAGACTGGGGAGGTGG - Intronic
1041066196 8:54085468-54085490 CACTTCCCAGACTGGGCAGAGGG - Intronic
1041891000 8:62868917-62868939 CACAGCAGAGACAGGAGAGAAGG + Intronic
1042084972 8:65097502-65097524 CAAACCCGTGACAGGGTAGAAGG + Intergenic
1042189051 8:66167091-66167113 CACACCTGAGACTCGGGACAGGG - Intronic
1042485313 8:69340433-69340455 CACACCCGAGACTGGGCAATTGG - Intergenic
1046733686 8:117752989-117753011 CACACCTGAGCCTGGGAATAAGG + Intergenic
1048525934 8:135202473-135202495 CCCTCATGAGACTGGGGAGACGG - Intergenic
1049214980 8:141403363-141403385 GAGTCCCGAGCCTGGGGAGATGG + Intronic
1049694427 8:143976528-143976550 CACGCCCGAGACTGCGGAACTGG - Intronic
1050571939 9:6949354-6949376 CACTTCCCAGACTGGGCAGAGGG + Intronic
1050937974 9:11423302-11423324 CACACCAGAGCCTTGGGACAGGG - Intergenic
1051848444 9:21479512-21479534 CACACCCGTGCCAAGGGAGAGGG - Intergenic
1059308064 9:113370090-113370112 CACAGCAAAGACTGGGAAGAGGG - Exonic
1060415006 9:123424011-123424033 CACACCCTAGGCTGGGGAGAGGG + Intronic
1060480950 9:124016560-124016582 CAAACCCAAGACTGTGCAGAGGG + Intronic
1060491497 9:124088472-124088494 CACCCCCGAGAATGGAGGGAGGG - Intergenic
1061094527 9:128447691-128447713 ATCACCTGAGACTGGGGAGGTGG - Intergenic
1061819494 9:133218290-133218312 CACACATGAGGCTGGGGAGTGGG + Intergenic
1062121781 9:134837742-134837764 CACACCCGAGACTGGCAAAGTGG - Intronic
1062241194 9:135539899-135539921 CACACATGAGGCTGGGGAGTGGG - Intergenic
1062582724 9:137235611-137235633 CACACTGGGGACTGAGGAGACGG + Intronic
1186143721 X:6603717-6603739 CAGACTTGTGACTGGGGAGATGG + Intergenic
1189198159 X:39168927-39168949 CACACACGTGCCTGGGGAGATGG + Intergenic
1192510249 X:71717072-71717094 CACACCAGAGAATGGCGGGAAGG + Exonic
1192516448 X:71764481-71764503 CACACCAGAGAATGGCGGGAAGG - Exonic
1198801394 X:140451600-140451622 CAAACACGAGCCTGGGGAAAGGG - Intergenic
1200119564 X:153783962-153783984 CAAGCCAGAGTCTGGGGAGACGG - Exonic
1200135557 X:153872980-153873002 CAAACCCCAGACAGGGGAGAAGG + Intronic
1200762993 Y:7056918-7056940 CACACCCGAGGCAGGGGAAGGGG + Intronic