ID: 900173792

View in Genome Browser
Species Human (GRCh38)
Location 1:1283192-1283214
Sequence CTGTGCCTACTCGGGGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900173784_900173792 -3 Left 900173784 1:1283172-1283194 CCAGCAGGGAGGGCGAGCCCCTG 0: 1
1: 0
2: 2
3: 25
4: 266
Right 900173792 1:1283192-1283214 CTGTGCCTACTCGGGGGAGCAGG 0: 1
1: 0
2: 0
3: 2
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900173792 Original CRISPR CTGTGCCTACTCGGGGGAGC AGG Intronic
900173792 1:1283192-1283214 CTGTGCCTACTCGGGGGAGCAGG + Intronic
900488761 1:2935927-2935949 CTGTGCCCACTCCAGGAAGCAGG - Intergenic
900700668 1:4046952-4046974 CTGCACCTACTCAGGGGACCAGG + Intergenic
902748043 1:18486377-18486399 CTGTGCCCACCAGGGAGAGCCGG + Intergenic
905071540 1:35230135-35230157 CAGTGCCTCCTTGGGTGAGCTGG - Intergenic
908045531 1:60163911-60163933 CCCTGTCTACTCTGGGGAGCTGG - Intergenic
912450309 1:109764151-109764173 AGGTGCCTACTCTGGGGAACAGG + Intronic
914443917 1:147733332-147733354 CTGTGCCTACTGGAGGGTGGAGG + Intergenic
916443346 1:164848830-164848852 CTGTGTGTGCTCAGGGGAGCAGG + Exonic
919972754 1:202591492-202591514 CTGGGGCTTCTCTGGGGAGCAGG + Exonic
921276332 1:213524379-213524401 CTGCTCCTTCTCGGGGGAGTGGG - Intergenic
922291583 1:224213132-224213154 CTGACGCTACTCGGGGGAGGTGG + Intergenic
923897259 1:238285183-238285205 CTGTGCTGACTTGGGGGAGAGGG + Intergenic
924302271 1:242651881-242651903 CAGTGCCTATTCCGGGGAGGTGG + Intergenic
924587474 1:245372522-245372544 CTGGGCCTACTTGGGGGTGGAGG - Intronic
1065469068 10:26057893-26057915 CTGTGCCTACCTGGGGGAAGGGG - Intronic
1070558226 10:77546345-77546367 CTGTGGCTTCTCGGTGGGGCTGG - Intronic
1070946431 10:80395701-80395723 CTGTGCATACTCAGGGTGGCTGG - Intergenic
1072640413 10:97207218-97207240 CTGGGCCCACCCTGGGGAGCTGG - Intronic
1072935072 10:99704305-99704327 CTTTGCCTGCTCTGTGGAGCTGG + Intronic
1072936085 10:99714933-99714955 CAGTGACTACTCTGGGGAACTGG - Intronic
1074492818 10:113954376-113954398 CTGTGCATTCTCTTGGGAGCTGG + Intergenic
1076340530 10:129742194-129742216 ATGTGCCTACTGGGTGGGGCAGG + Intronic
1076631579 10:131855190-131855212 CTGTGCCCACTCCAGGGAGGTGG + Intergenic
1076652857 10:132001919-132001941 CTGTTCCTACTCTGTGGAGTGGG + Intergenic
1077354220 11:2107573-2107595 CTGTGCCTGCTCTGGGGACTTGG + Intergenic
1077381279 11:2239789-2239811 CTGGGCCTACTAGGGGGTGGAGG + Intergenic
1081621262 11:44620264-44620286 CTGTGCCTTGTAGGGGGAGAGGG + Exonic
1081772521 11:45658796-45658818 CTGTGGCTTCTCGGTGGGGCGGG - Intronic
1083409184 11:62480127-62480149 CTGTGCCCACTGCTGGGAGCAGG + Intronic
1083669451 11:64291941-64291963 CTGTGCGGACGCGGGGGAGGCGG + Intronic
1084095516 11:66908598-66908620 CTGTGCCTCCTCCAAGGAGCTGG - Intronic
1084434027 11:69127536-69127558 CTGTGCCTCCTCCTGGGTGCTGG - Intergenic
1084585922 11:70062463-70062485 CTGTGTCTACTGGGGGGTGCAGG - Intergenic
1090281019 11:125456023-125456045 CCGTGACTTCTCGGAGGAGCTGG - Exonic
1093347493 12:18056962-18056984 CTATGCTGACTCGGGGGAGGAGG - Intergenic
1096719560 12:53510983-53511005 CTGTGCCTCCTGAGGAGAGCAGG - Intronic
1100667290 12:96768770-96768792 CTATGCCTTCTGAGGGGAGCTGG + Intronic
1101018926 12:100531795-100531817 CTATACCTTCTCGGGGGAGATGG + Intronic
1103700795 12:122847841-122847863 CTGTGCCTGATCGGTGCAGCTGG - Intronic
1109971144 13:69770298-69770320 CTCTGCCCACTCGGGCCAGCAGG - Intronic
1113226442 13:108164857-108164879 CTGTGTCTCCTCTAGGGAGCAGG + Intergenic
1114134769 14:19834883-19834905 CTGTGGCTACTCAGGGCAGGGGG - Intergenic
1116287783 14:42994546-42994568 CTGTTCCTAGTGGTGGGAGCTGG + Intergenic
1122722172 14:103728236-103728258 CTGTGGCTCCTCGGAGGGGCCGG + Intronic
1122770228 14:104094586-104094608 ATGTTCCCACTCAGGGGAGCAGG - Intronic
1123165213 14:106319618-106319640 CTGCGCCAACTCGGTGGGGCTGG - Intergenic
1126263938 15:46729809-46729831 TTGTGCCAACTTGGGGGAGGAGG + Intergenic
1132821313 16:1872646-1872668 CTGGGACTACTCGGGTGGGCGGG - Intronic
1134694648 16:16214530-16214552 CAGTGCCCACTCTGGGGACCAGG + Intronic
1134977186 16:18580107-18580129 CAGTGCCCACTCTGGGGACCAGG - Intergenic
1135664575 16:24325150-24325172 CTGTGTCTACTGGGGGAAGAGGG + Intronic
1135689256 16:24522980-24523002 CTGTGCCTGTTCGGGGAACCGGG + Intergenic
1138829517 16:60359553-60359575 CTGTGCCTGCCCGGGGAATCTGG - Exonic
1140018297 16:71210491-71210513 TTGTGCCTACTTGAGGGAGGAGG + Intronic
1141432930 16:83980329-83980351 CTGTCCTTTCTTGGGGGAGCAGG - Intronic
1143449048 17:7024747-7024769 CTGTACCTGCTCTGGGGACCAGG - Exonic
1143452381 17:7043560-7043582 CTGTGCTTCCGCTGGGGAGCTGG + Exonic
1143514233 17:7411404-7411426 CTTTGCCCACACTGGGGAGCTGG + Intronic
1146184532 17:30716473-30716495 CTGTCTCTCCACGGGGGAGCTGG - Intergenic
1148846983 17:50535098-50535120 CTGTGGCTACTGGGGGGAATTGG + Intronic
1152613800 17:81328849-81328871 CTGCCCCTACTCCGGGGACCCGG - Intronic
1152788929 17:82267772-82267794 CTGCGCCTGCTTGGGGGTGCAGG - Intronic
1153562395 18:6384173-6384195 CTCTGCCTACTCAGGTAAGCAGG - Intronic
1155191842 18:23437447-23437469 CTCTTCCTCCCCGGGGGAGCAGG + Intronic
1155940948 18:31801619-31801641 TTGTCCCTACCCTGGGGAGCAGG + Intergenic
1160165373 18:76506813-76506835 CTGTGCCACCCCGGGGGAGAGGG + Intergenic
1160915147 19:1492875-1492897 CTGTGCCTGCCCCCGGGAGCAGG + Intronic
1161205721 19:3040259-3040281 CTGTGCCTTCCAGGGGGACCAGG - Intronic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
1162974245 19:14199201-14199223 CTGTCTCTCCACGGGGGAGCTGG + Intronic
1164633704 19:29777865-29777887 CTGAGCCAACTCGGGGGTGGGGG - Intergenic
1164674862 19:30094393-30094415 CTGCACCTACGCAGGGGAGCAGG - Intergenic
1166033846 19:40153089-40153111 CAGTGGCTACCCAGGGGAGCAGG + Intergenic
930028248 2:47042954-47042976 CTGTGACTCCTGGGGGAAGCTGG - Intronic
930769868 2:55120317-55120339 CTGTGCCCACCCTGGTGAGCTGG - Intergenic
932628709 2:73320013-73320035 CTTTGATTACTCAGGGGAGCTGG + Intergenic
934997115 2:98973998-98974020 CTGTGCCTGTTTGGGGGAGGAGG + Intergenic
936391435 2:112078142-112078164 CTGTGCCAAGTAGAGGGAGCAGG + Intronic
938899300 2:135786257-135786279 GTGCGCCTACTCGGGGCAGAGGG - Intergenic
941431378 2:165418202-165418224 ATGTAGCTACTTGGGGGAGCTGG - Intergenic
942662581 2:178281994-178282016 CTGTGTGTACTCCGGGAAGCAGG - Intronic
946398024 2:219453105-219453127 CTGGGCCCCCTCAGGGGAGCTGG - Intronic
947732441 2:232438944-232438966 CTGTGCCTCCCCGGGGCAGGAGG - Intergenic
948032326 2:234828969-234828991 CTGTGCCTACTCACTGGAGAGGG - Intergenic
948575558 2:238947291-238947313 CCCTGCCTACTCAGTGGAGCAGG + Intergenic
1169205612 20:3738752-3738774 CAGTGCCTGCTCGGGTGAGTGGG - Intronic
1170682847 20:18542304-18542326 CTCTGCCTCCTTGGGGGATCGGG - Exonic
1171050126 20:21850091-21850113 CTGAGCCTACTAGGAGGTGCAGG - Intergenic
1172097347 20:32466925-32466947 CTGTGCCTCCTGGTGGGAGAGGG + Intronic
1173049962 20:39549868-39549890 CTGCCCCTCCTCTGGGGAGCTGG - Intergenic
1173664302 20:44753958-44753980 CTGTCCCAACCAGGGGGAGCAGG - Intronic
1173827831 20:46058598-46058620 CGGTGCCTTCGCTGGGGAGCAGG + Intronic
1175820312 20:61905562-61905584 CTGTGCCTAGTGGTGGGGGCAGG - Intronic
1176106584 20:63392380-63392402 CTGTGCCTTCTCAGGGGTGGCGG - Intergenic
1176122797 20:63461706-63461728 CTGTACCTACCCCGGGCAGCAGG + Intronic
1179644205 21:42765795-42765817 CTGTGCCTTCATGGGAGAGCTGG - Intronic
1181050045 22:20234178-20234200 CTGGGCCTGGTCGGGGGATCTGG - Intergenic
1182419227 22:30240820-30240842 CTATGTCTACTCTGGAGAGCCGG + Exonic
1183060867 22:35335654-35335676 CTGTCCTTCCTCTGGGGAGCAGG + Intronic
1183803301 22:40186377-40186399 CTGTTCCTACTGGGCGGTGCTGG - Intronic
953329894 3:42043785-42043807 CTGTGCCCCCTCTGGGGAGTTGG - Intronic
961059189 3:123813967-123813989 CTGGGACTATTCAGGGGAGCCGG + Intronic
962257254 3:133880967-133880989 CTGTGCCTACTCCCGGGTCCAGG - Intronic
968969235 4:3784800-3784822 CTGTGGCTGCACTGGGGAGCGGG - Intergenic
969232468 4:5841271-5841293 CTGGGCCTTCTGGGGGCAGCTGG - Intronic
972404783 4:38735286-38735308 CTGTGGCTACTTGGGAAAGCAGG + Intergenic
982113316 4:152075778-152075800 CTGTCCCTGCTCAGGGAAGCAGG + Intergenic
985657017 5:1137558-1137580 CAGTGCCTGCTCGGGGGGTCTGG - Intergenic
986383404 5:7208381-7208403 CTGGGCCTACGAGGGTGAGCTGG - Intergenic
989230075 5:39074808-39074830 CAGTGGATACACGGGGGAGCGGG - Intergenic
990466999 5:56079960-56079982 CTGCCCCTACTCTGGGGATCAGG - Intergenic
997527094 5:134560433-134560455 CAGTGCCTTCTCCGTGGAGCTGG + Intronic
998173980 5:139889516-139889538 GTGTGAATACTCGGGGGTGCGGG - Intronic
1001961349 5:175882054-175882076 CTGTCCCTTCTTTGGGGAGCAGG + Exonic
1002334666 5:178469576-178469598 CTGAGCACTCTCGGGGGAGCTGG + Intronic
1007647122 6:43391602-43391624 CTGTGGCTTCTGTGGGGAGCCGG - Intergenic
1020109136 7:5438367-5438389 CTCTGGCTTCTCAGGGGAGCAGG - Intronic
1029351831 7:100018818-100018840 CTGCTCCTACTCTGGGGTGCAGG - Intronic
1036023122 8:4871015-4871037 CTGTGCTCACCCTGGGGAGCTGG + Intronic
1036162894 8:6406148-6406170 CCCTGCCTGCTCCGGGGAGCCGG - Intergenic
1037709590 8:21345175-21345197 CTGTGCTTGCACGAGGGAGCTGG + Intergenic
1040565711 8:48564896-48564918 TTGTGCTTAGTCAGGGGAGCAGG + Intergenic
1043954172 8:86342524-86342546 CTGCGCATGCTCGGGGGAGGCGG + Intergenic
1046581461 8:116098193-116098215 CTGTGCCTTCTCGTGGCAGATGG - Intergenic
1046885035 8:119357012-119357034 CTGTGTCTATTCGGAGGAGCAGG - Intergenic
1047721835 8:127647941-127647963 ATGTTACTACTGGGGGGAGCTGG + Intergenic
1048268720 8:133010932-133010954 CTGTTCCTGCTCGGTGGAACAGG - Intronic
1049658617 8:143809814-143809836 CGGTGCCTGGTCGGGGCAGCGGG - Intronic
1056713902 9:89012909-89012931 CTGTGCTTGCTGGTGGGAGCGGG - Intergenic
1059426406 9:114223441-114223463 CTGTGCCTGCTCAGGTGAGTGGG + Intronic
1061637969 9:131927398-131927420 CTTTGGCTACTCAGGGGAGAAGG - Intronic
1062004414 9:134232050-134232072 CTCTGCCTTCCCGGGGAAGCCGG - Intergenic
1062031151 9:134362604-134362626 CAGAGCCTACTCCTGGGAGCTGG + Intronic
1062340348 9:136091269-136091291 CTCTGCCTCCTCCGAGGAGCTGG - Intronic
1190335889 X:49261425-49261447 CTGGGCCTCATGGGGGGAGCTGG + Intronic
1190971448 X:55352929-55352951 CTGTGCCAACTTAGGGGAGGTGG + Intergenic
1192168089 X:68838508-68838530 CTGGGCCTACTGGGTGGAGATGG - Intronic
1200359774 X:155592506-155592528 CTGTGCCAACTTAGGGGAGTAGG - Intronic