ID: 900174356

View in Genome Browser
Species Human (GRCh38)
Location 1:1285264-1285286
Sequence CGCTGGAGGCTCTGGAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 297}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900174356_900174363 -9 Left 900174356 1:1285264-1285286 CCAGGACTCCAGAGCCTCCAGCG 0: 1
1: 0
2: 2
3: 26
4: 297
Right 900174363 1:1285278-1285300 CCTCCAGCGCGGGACTGGGCAGG 0: 1
1: 1
2: 0
3: 13
4: 188
900174356_900174368 10 Left 900174356 1:1285264-1285286 CCAGGACTCCAGAGCCTCCAGCG 0: 1
1: 0
2: 2
3: 26
4: 297
Right 900174368 1:1285297-1285319 CAGGCAGTGGCTGGGCTTCCTGG 0: 1
1: 0
2: 5
3: 72
4: 547
900174356_900174366 1 Left 900174356 1:1285264-1285286 CCAGGACTCCAGAGCCTCCAGCG 0: 1
1: 0
2: 2
3: 26
4: 297
Right 900174366 1:1285288-1285310 GGGACTGGGCAGGCAGTGGCTGG 0: 1
1: 0
2: 7
3: 238
4: 2284
900174356_900174367 2 Left 900174356 1:1285264-1285286 CCAGGACTCCAGAGCCTCCAGCG 0: 1
1: 0
2: 2
3: 26
4: 297
Right 900174367 1:1285289-1285311 GGACTGGGCAGGCAGTGGCTGGG 0: 1
1: 0
2: 6
3: 65
4: 545
900174356_900174369 11 Left 900174356 1:1285264-1285286 CCAGGACTCCAGAGCCTCCAGCG 0: 1
1: 0
2: 2
3: 26
4: 297
Right 900174369 1:1285298-1285320 AGGCAGTGGCTGGGCTTCCTGGG 0: 1
1: 0
2: 5
3: 58
4: 421
900174356_900174370 12 Left 900174356 1:1285264-1285286 CCAGGACTCCAGAGCCTCCAGCG 0: 1
1: 0
2: 2
3: 26
4: 297
Right 900174370 1:1285299-1285321 GGCAGTGGCTGGGCTTCCTGGGG 0: 1
1: 0
2: 5
3: 53
4: 480
900174356_900174365 -3 Left 900174356 1:1285264-1285286 CCAGGACTCCAGAGCCTCCAGCG 0: 1
1: 0
2: 2
3: 26
4: 297
Right 900174365 1:1285284-1285306 GCGCGGGACTGGGCAGGCAGTGG 0: 1
1: 0
2: 1
3: 30
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900174356 Original CRISPR CGCTGGAGGCTCTGGAGTCC TGG (reversed) Intronic
900174356 1:1285264-1285286 CGCTGGAGGCTCTGGAGTCCTGG - Intronic
900415360 1:2532177-2532199 GGCTAGGGGCTCTGGACTCCCGG + Intergenic
900490905 1:2948706-2948728 GGCAGGAGGCACTGGGGTCCTGG - Intergenic
900534765 1:3171414-3171436 CGCAGGAGGCTCTGCAGGCCAGG - Intronic
900548244 1:3240728-3240750 CGCTTAGGGCTCTGGAGTTCTGG - Intronic
900894574 1:5474243-5474265 TCCTGGAGCCTCTGAAGTCCAGG - Intergenic
901206687 1:7501523-7501545 CCCTGGAGGCCCTGGAGGCTGGG + Intronic
901883033 1:12205075-12205097 AGCTGGGGGCTCTGGAGATCAGG + Intronic
902492511 1:16794794-16794816 CGGTGTGGGCTCTGGAGTCTGGG - Intronic
902983925 1:20143929-20143951 CACTGGAGGCTCTGGAAGACAGG + Intronic
902985047 1:20149896-20149918 TGCTGGCGGCTGTTGAGTCCGGG - Exonic
904253164 1:29238543-29238565 CGCTGGAGCCACAGGAGTTCCGG - Intronic
904341311 1:29836829-29836851 GGCTGGAGACTCTGGGGGCCTGG - Intergenic
905677612 1:39839166-39839188 GACTGGAGGCTCTGGATACCTGG + Intergenic
906301407 1:44684709-44684731 CGGTTGAGGGTCTGGAGTGCAGG - Intronic
909024518 1:70467621-70467643 CCCTCGAGCCTCTGGAATCCTGG + Intergenic
909391816 1:75128878-75128900 CTCTGGAGCCTCTGCAGCCCAGG + Intronic
909607714 1:77523280-77523302 TGATGGAAGCTCTGGAGTCGAGG - Intronic
912795944 1:112693772-112693794 CACTGGAGGCTCCGGGTTCCTGG + Intronic
914428408 1:147599617-147599639 CTCAGGAGGCTCTGGAGTTGGGG + Intronic
914913022 1:151801964-151801986 CTCTGGAGGCTCTGGACCCTGGG - Exonic
915049061 1:153049021-153049043 CCCTGGAGTCACTGGAGGCCAGG - Intergenic
915051813 1:153083653-153083675 CCCTGGAGTCACTGGAGGCCAGG - Intergenic
915053407 1:153102634-153102656 CCCTGGAGTCACTGGAGGCCAGG - Intronic
915348251 1:155208926-155208948 CGCGGCAGGCTCTGGAGAGCGGG - Exonic
916211146 1:162360903-162360925 TGATGGAGGAGCTGGAGTCCAGG + Intronic
916689414 1:167176315-167176337 TTCTGGAGGCTGTGAAGTCCAGG + Intergenic
918110869 1:181454275-181454297 CCCTGGAGGCTCTGGGGAGCGGG - Intronic
918331589 1:183466202-183466224 GGCTGGAGGTTCTTGAGCCCAGG + Intergenic
919851525 1:201676215-201676237 CCCTGGGGACTCTGGAGACCTGG + Intronic
919864753 1:201772344-201772366 TGCTGAAGTCTCTGGAGTCCTGG - Intronic
921159772 1:212464581-212464603 CCCTGCAGGCTCTGGGGTCTGGG + Intergenic
921222288 1:212981640-212981662 GCCTGCAGGCTCGGGAGTCCAGG - Intronic
923527938 1:234787738-234787760 CGGTGTGGGCTCTGGAGTCTGGG + Intergenic
923543754 1:234908952-234908974 AGCTGGAGCCTCTGGAGGCAAGG - Intergenic
1063375440 10:5551711-5551733 ACCTTCAGGCTCTGGAGTCCTGG - Intergenic
1063487465 10:6433361-6433383 CACTGTAAGCTCTGGAGGCCGGG + Intronic
1063557917 10:7097991-7098013 CGCTGGAGGAGCTGGGCTCCCGG - Intergenic
1064491407 10:15860749-15860771 AGCTGGAGGCTCTGAGGCCCAGG + Intergenic
1065175138 10:23068288-23068310 TCCTGGAGGCTCTTGACTCCAGG - Intergenic
1065589686 10:27252022-27252044 CACTGCAGGCCCTGGAGTCCTGG - Intergenic
1066347406 10:34601346-34601368 GGCAGGAGGATCTTGAGTCCAGG + Intronic
1067275279 10:44828371-44828393 CGCTGGAGGCCCTGAAGATCAGG - Intergenic
1067799915 10:49351782-49351804 TGCTGTAGGCACTGGAGACCTGG + Intergenic
1068370822 10:56111284-56111306 TGCTGACGGCTCTGGAGTCTTGG + Intergenic
1069015195 10:63421457-63421479 TGGTGGAGGTTCTGGAGTGCTGG + Intronic
1069573596 10:69509020-69509042 GGCTGGAGGCCTTGTAGTCCTGG + Intergenic
1069895646 10:71678683-71678705 CACTGGAGGCTCTAGAGTGAGGG + Intronic
1070918879 10:80171719-80171741 TCCTGGAGGGTCTGGAGCCCTGG - Intronic
1074817198 10:117151419-117151441 AGCTGGAGGAGCTGGAGGCCAGG + Intergenic
1076363156 10:129904182-129904204 CCCTGGAGGCTTTGGGGTCCTGG - Intronic
1076600455 10:131653791-131653813 CGCTGGAGCATCTGAACTCCTGG - Intergenic
1076673176 10:132134155-132134177 CGCTGGGGGATCTGAAGTCCAGG + Intronic
1077109394 11:855434-855456 TGCTGGAGGCACAGGAATCCAGG - Intronic
1078808603 11:14734298-14734320 GGCTGGAGGCGCTTGAGCCCAGG - Intronic
1079260630 11:18875959-18875981 AGCTGGAGTCTGTGGTGTCCAGG - Intergenic
1079390710 11:20019635-20019657 GGATGGAGGCCCTGGAGTTCTGG + Intronic
1080613907 11:33929591-33929613 TGCTGGAGGTTCTGGGGTGCTGG + Intergenic
1081751015 11:45511481-45511503 CAGGGGATGCTCTGGAGTCCTGG - Intergenic
1082787431 11:57324664-57324686 CGCTGGGGACGCTGGAGGCCCGG - Intronic
1084494294 11:69495181-69495203 GGCTGGAACCTCTGGAGACCTGG + Intergenic
1084790201 11:71470416-71470438 CGCTGGGGGCTCGGAGGTCCAGG + Intronic
1084944886 11:72633093-72633115 AACTGGCGGCTATGGAGTCCAGG - Intronic
1087590523 11:100182273-100182295 TTCTGGAGGCTGTGAAGTCCAGG + Intronic
1087796674 11:102461448-102461470 AGCTGGAGACACTGGAGTCAGGG - Intronic
1088326054 11:108602628-108602650 CGCTTGAGCCCCTGGAGTCAAGG - Intergenic
1088573356 11:111244734-111244756 TTCTAGAGACTCTGGAGTCCTGG - Intergenic
1089307928 11:117538437-117538459 CGCAGGAGGCGCTGGGGGCCCGG - Intronic
1089630835 11:119783248-119783270 CTCTGGAGGCTGGGAAGTCCAGG + Intergenic
1091180384 11:133599234-133599256 CCCTGGAGGGTCTGCAGCCCAGG - Intergenic
1092284123 12:7119110-7119132 AGCTGGTGGCTGGGGAGTCCAGG + Intergenic
1094041843 12:26126664-26126686 TGCTGCAGTCTCCGGAGTCCTGG + Intronic
1095111258 12:38296711-38296733 CGCTGGAGCAGCTGGAATCCAGG + Intergenic
1096547912 12:52353922-52353944 CACAGGAGGCAGTGGAGTCCAGG - Intergenic
1102326069 12:111985702-111985724 CTCTGGAGGCTCTGGAGGCTGGG - Intronic
1103825206 12:123732409-123732431 CCCTGGAGGGTCTTGAGTACAGG - Intronic
1103917294 12:124382465-124382487 CGCTGAAGACTCTGGAGGCGTGG - Intronic
1104942044 12:132399754-132399776 CGTTGGAGGGGCTGGAGTCCTGG - Intergenic
1105805798 13:23951020-23951042 GGCTGGATGCTGTGGACTCCTGG + Intergenic
1108070681 13:46625587-46625609 TTCTGGAGGCTGAGGAGTCCAGG - Intronic
1108409643 13:50133466-50133488 CCCTGGATCCTCTGGTGTCCCGG + Intronic
1108440713 13:50450180-50450202 GGCTGGAGGATCTTGAGCCCAGG + Intronic
1109232411 13:59774771-59774793 TGCTGGAGGCCTTGCAGTCCGGG - Exonic
1109345285 13:61108704-61108726 AGCTGGAGACTCTGGGGTGCTGG - Intergenic
1110894271 13:80729503-80729525 CTCTGGATGCTCTGGAGACAAGG - Intergenic
1111943981 13:94644214-94644236 CCCTGGAGGCTTTAGATTCCTGG - Intergenic
1113131455 13:107042077-107042099 GGCTGGAGGCACGGGGGTCCAGG + Intergenic
1117072588 14:52069557-52069579 CGCTCCTGGCTCTGGAGGCCTGG + Intergenic
1119035406 14:71226361-71226383 TTCTGGAGGCTGTGAAGTCCAGG + Intergenic
1120578224 14:86210871-86210893 CTCTGTAGCCTCTGGAGTCTGGG + Intergenic
1121971604 14:98362216-98362238 CGCTGGAGCCTCTGCCATCCCGG + Intergenic
1122363816 14:101182834-101182856 CTCTGGAGACTCTGGCCTCCTGG - Intergenic
1122856190 14:104561284-104561306 CGGTGGGTGCGCTGGAGTCCAGG - Intronic
1124445163 15:29723951-29723973 AGCTGAAGGATCTGGAATCCAGG + Intronic
1124563921 15:30798210-30798232 TGCTGGGGGCTCTGGAGGCAGGG - Intergenic
1124629162 15:31327292-31327314 CGCGGGAGGGGCCGGAGTCCCGG + Exonic
1125397880 15:39269855-39269877 CGCTGGGGGCTGTGGAGGACTGG + Intergenic
1127659784 15:61089747-61089769 CACCGTAGGCTCTGAAGTCCTGG + Intronic
1127921666 15:63499352-63499374 GGCTGGAGCCACTGGAGACCTGG + Intergenic
1128788048 15:70412732-70412754 CTCTGTAGGCTCTGTAGTCAGGG + Intergenic
1128860803 15:71070157-71070179 GGCTGCAGGATCTGGAGTACTGG - Intergenic
1130835292 15:87644397-87644419 TGGTGGAGGCTTTGAAGTCCTGG - Intergenic
1132590683 16:725101-725123 CGCTGGAGCATCAGGAGGCCCGG - Exonic
1132724228 16:1332017-1332039 GGCTGGTGGGTCTGGAGACCGGG - Intergenic
1132731087 16:1362374-1362396 TGCTGGAGGCCCTGTAGTGCTGG + Intronic
1132994215 16:2814690-2814712 AGCTGGTGCTTCTGGAGTCCTGG - Intergenic
1132996802 16:2827698-2827720 AGCTGGTGCTTCTGGAGTCCTGG + Intergenic
1133017213 16:2949593-2949615 AGGAGGAGGCTCTGCAGTCCCGG - Exonic
1133323842 16:4931478-4931500 TGCTGCAGCCTCTGGAGCCCGGG - Intronic
1133809934 16:9154136-9154158 TGCTGGGGGCCCTGGAGTCTAGG - Intergenic
1134418928 16:14068942-14068964 AGCTGGAGAATCTGGAGTTCTGG - Intergenic
1134572845 16:15306372-15306394 TTCTGGAGGCTGAGGAGTCCAGG - Intergenic
1134584022 16:15395814-15395836 TGCTGGAGGCTGGGGAGGCCCGG + Exonic
1134729541 16:16449664-16449686 TTCTGGAGGCTGAGGAGTCCAGG + Intergenic
1134937896 16:18262242-18262264 TTCTGGAGGCTGAGGAGTCCAGG - Intergenic
1136393033 16:29977378-29977400 CACTTGGGGCTCTGGAGTGCTGG + Intronic
1136570543 16:31094093-31094115 AGCTGGAGATTCTGGGGTCCAGG - Intronic
1138416867 16:56876606-56876628 AGCTGGAGTCTCTAGAGCCCAGG - Intronic
1139290520 16:65854215-65854237 TGGTGGAGGCTCTGGGGTCATGG + Intergenic
1140889708 16:79274477-79274499 CCCTGGAGACTCTGGTGTCCAGG + Intergenic
1142204082 16:88774509-88774531 TGCTGGGGACTCTGGAGCCCAGG - Intronic
1142980443 17:3668281-3668303 CTCGGGAGGCTCTCGGGTCCCGG + Intronic
1143099900 17:4499179-4499201 CGCGGGCGGCGCTGGAGTCTCGG + Exonic
1145309092 17:21691783-21691805 CGCTGGGCCCTCTGGAGCCCAGG - Intergenic
1145905260 17:28512773-28512795 CCCTGGCTACTCTGGAGTCCAGG - Intronic
1146662255 17:34672589-34672611 GGCTATAGCCTCTGGAGTCCAGG + Intergenic
1147260471 17:39207094-39207116 CGCTGCAGGCTCTGGAATCCTGG - Intergenic
1147429870 17:40364495-40364517 GGCTGGAGGCACAGGAGGCCAGG - Exonic
1147439203 17:40437227-40437249 CGTTGCAGGCTCTGGAGTGTTGG + Intergenic
1147743737 17:42682932-42682954 CCCTGCAGGCTCTGGACTCCTGG - Intronic
1147978891 17:44262798-44262820 ACCTGGAGGCTCTGGGGACCTGG - Intronic
1148174323 17:45550546-45550568 CACAGCAGGCGCTGGAGTCCTGG - Intergenic
1148274939 17:46294901-46294923 CACAGCAGGCGCTGGAGTCCTGG + Intronic
1148297046 17:46512480-46512502 CACAGCAGGCGCTGGAGTCCTGG + Exonic
1148361599 17:47016960-47016982 CACAGCAGGCGCTGGAGTCCTGG + Intronic
1148782789 17:50130817-50130839 CGCTGGAGGCTATTGAGGGCCGG + Intergenic
1149657469 17:58318017-58318039 CCAGGGAGGCTCTGGAGTGCTGG - Intronic
1149865911 17:60150887-60150909 CGCTGGAGGTTAGGGAGGCCAGG - Intronic
1150405543 17:64897468-64897490 CACAGCAGGCGCTGGAGTCCTGG - Exonic
1150469333 17:65423495-65423517 AGCTGGAGGAGCTGGAATCCTGG + Intergenic
1151650442 17:75465090-75465112 CGCAGGAGGATCTTGAGACCAGG - Intronic
1151724281 17:75875561-75875583 CCCTGGTGGCTCTGGACTCTGGG - Intronic
1153819522 18:8821242-8821264 GGCTGGAGCTTCTGTAGTCCAGG - Intronic
1154047131 18:10916469-10916491 CGCTGGCGGCCCAGGAGTGCTGG + Intronic
1154172521 18:12061705-12061727 CCCTCGAGAGTCTGGAGTCCGGG - Intergenic
1154358841 18:13642561-13642583 CGCTGGAGGATCCTGAGCCCAGG + Intronic
1157884874 18:51357300-51357322 CTCTGGAGGCTAGGAAGTCCAGG - Intergenic
1159185797 18:64972106-64972128 CTCTGGAGGCTCTGGAGAGAAGG + Intergenic
1159284394 18:66330019-66330041 TTCTGGAGGCTCAGGAGTTCAGG - Intergenic
1160464990 18:79069151-79069173 CGCAGGAGGCAGTGGAGTCCGGG - Intergenic
1160517618 18:79487176-79487198 CGCAGGAGGATCTGCAGCCCAGG - Intronic
1160842575 19:1152785-1152807 CCCAGGAGACCCTGGAGTCCTGG + Intronic
1160967397 19:1752782-1752804 CGCTGGAGGCACTGGAGCCTGGG - Exonic
1161003035 19:1920736-1920758 CACAGGAGGCACTGGAGCCCAGG - Intronic
1161006068 19:1937424-1937446 GGCTGGAGGGTCAGGAGCCCGGG - Intergenic
1161461917 19:4402764-4402786 TGCTGGAGGAGCTGGAGTGCGGG + Exonic
1162069743 19:8146506-8146528 AGCTGGAGGTGCTGGGGTCCTGG + Intronic
1162966683 19:14159531-14159553 GGCCAGAAGCTCTGGAGTCCTGG - Exonic
1163158749 19:15452669-15452691 AGCTGCAGGATCTGGACTCCAGG - Exonic
1163595521 19:18219084-18219106 GGATGGAGGCTCTAGAGTCTGGG - Intronic
1165961115 19:39534939-39534961 CGGTGGTAGTTCTGGAGTCCTGG - Intergenic
1166159504 19:40941415-40941437 CCCTGGGGGCGCTGGGGTCCAGG - Intergenic
1166295586 19:41887829-41887851 CGTTGGAGGCTCAGGAGCCTGGG - Intronic
1166296854 19:41893778-41893800 GGCTGGGGGGTCTGGACTCCTGG + Intronic
1166337041 19:42114565-42114587 TGCTGGAGTCTCTGGTGGCCGGG + Intronic
1166705135 19:44904259-44904281 TCCTGGAGGCTCGGGAGTCGTGG - Intergenic
1167638157 19:50667090-50667112 GGCTGGATGCGGTGGAGTCCAGG + Exonic
1167678767 19:50906611-50906633 GGCTGGGGGGTCTGGACTCCTGG + Exonic
1167678792 19:50906678-50906700 GGCTGGGGGGTCTGGACTCCTGG + Exonic
1167678817 19:50906745-50906767 GGCTGGGGGGTCTGGACTCCTGG + Exonic
1167689409 19:50975680-50975702 GGCTGGGGGGTCTGGACTCCTGG + Intergenic
1168056619 19:53868206-53868228 GGCTGGGGGGTCTGGACTCCTGG + Intronic
1168155562 19:54471969-54471991 GGCTGGGGGGTCTGGACTCCTGG - Intronic
1168155635 19:54472155-54472177 GGCTGGGGGGTCTGGACTCCTGG - Intronic
1168155690 19:54472304-54472326 GGCTGGGGGGTCTGGACTCCTGG - Intronic
1168283819 19:55320752-55320774 GGCTGGGGGATCTGGACTCCTGG - Intronic
928004766 2:27554433-27554455 CTCTGGAGGCTGGGAAGTCCAGG + Intronic
928404735 2:31006029-31006051 AGCAGGAAGCTCTGAAGTCCAGG - Intronic
930023672 2:47016698-47016720 AGCTGGTGGCTCTGTAGTCCAGG - Intronic
930930289 2:56874497-56874519 CACTGGAACCTCTGGAATCCTGG + Intergenic
931734982 2:65185943-65185965 CTCTGGAGGCTCTGTCGCCCTGG + Intergenic
932653717 2:73588264-73588286 CCCTGCAGTCTCTGCAGTCCAGG + Intronic
933864730 2:86505825-86505847 CTCTGGAGGCCATGCAGTCCCGG - Exonic
935041090 2:99428016-99428038 CTCTGGTGGCTTTGGACTCCAGG - Intronic
935871615 2:107456814-107456836 CGCTGGAGGCTCAGATGACCTGG - Intergenic
936257917 2:110933551-110933573 CGCTGCAGGCTCTGGTGGCGGGG + Exonic
936524266 2:113232318-113232340 CCTTGGAGGATCTGGGGTCCAGG - Intronic
937125915 2:119474883-119474905 CTGTGGAGGCTCAGGAGGCCTGG + Intronic
938118440 2:128617735-128617757 AAATGAAGGCTCTGGAGTCCTGG - Intergenic
940579651 2:155561744-155561766 TCCTGGAGGCTGTGCAGTCCAGG + Intergenic
940890179 2:159027817-159027839 TTCTGGAGGCTGTGAAGTCCAGG + Intronic
945464025 2:210145909-210145931 CAGTGGAAGCTCTGGAGTCTGGG + Intronic
946160192 2:217831207-217831229 AGCTTGAGGCTTTGGAGGCCTGG - Intronic
947229374 2:227870141-227870163 CGGTGGTAGTTCTGGAGTCCTGG + Intergenic
947549704 2:231037576-231037598 AGCTGGAGGCGCTGGCGGCCCGG + Exonic
947919172 2:233854528-233854550 CGCGCGAGGCCCTGCAGTCCGGG - Exonic
948147535 2:235719242-235719264 CGCTGGAGGCCCTGGGTTTCTGG + Intronic
948382754 2:237562152-237562174 CCCTGGGAGCTCTGGAGCCCAGG - Intergenic
948544540 2:238717415-238717437 CCATGGAGCCTCTGGAGCCCGGG + Intergenic
948792905 2:240388465-240388487 CGCTGGGTGGTCTGGAGACCTGG - Intergenic
949077742 2:242071852-242071874 TGCTGGAGTCACTGGAGTGCTGG - Intergenic
1171213068 20:23331697-23331719 CGCTGGGGGCTCTGGAGCAGGGG + Intergenic
1171395066 20:24827505-24827527 GGCAGGAGGATCTGGAGACCAGG + Intergenic
1171958061 20:31475056-31475078 GGATGGGGGCTCTGGATTCCTGG - Intronic
1172884563 20:38222518-38222540 CGCTGGAGGCCCAGTAGGCCGGG + Exonic
1173165374 20:40683715-40683737 CCCTGGAGGCTCCGGAAGCCCGG + Intergenic
1173872758 20:46352080-46352102 GGCTGGAGGTTCTGGAGACCAGG + Exonic
1175144659 20:56886391-56886413 AGCAAGAGGCTCTGGGGTCCAGG + Intergenic
1175545523 20:59775490-59775512 AGCGGGAGGCTATGGAGCCCTGG - Intronic
1176061931 20:63176258-63176280 CGCTGGAGGGGCTGGAGGGCTGG - Intergenic
1178700348 21:34828029-34828051 CACTGGTGGCTCTGCAGTTCTGG - Intronic
1179875912 21:44267329-44267351 CGCTGGGGGCTGGGGAGCCCCGG + Intergenic
1182066468 22:27434828-27434850 CTCTGGATGCTGTGGAGTCTTGG + Intergenic
1183366744 22:37410921-37410943 GGCTGGGGCCTGTGGAGTCCCGG - Intronic
1183931071 22:41236598-41236620 AGGTGCAGGCTCTGGAGCCCGGG + Exonic
1184172792 22:42769468-42769490 CTTGGGAGGCTCAGGAGTCCGGG + Intergenic
1184413673 22:44339952-44339974 CACAGCAGCCTCTGGAGTCCAGG - Intergenic
1184675650 22:46041442-46041464 GGCTGGAGGCTCTGGAGCAGAGG + Intergenic
1184801390 22:46762663-46762685 GGCTCTAGGCTCTGGAGTCCCGG + Exonic
1185394913 22:50581964-50581986 GCCTGGAGGCTCTGGAGCACAGG + Intronic
949951190 3:9230061-9230083 CGCTGCAGGCTCTGGAGTCTGGG - Intronic
950440554 3:13007860-13007882 TGCTGGGGGCTCTGGACTCTGGG - Intronic
950461132 3:13122819-13122841 CCCTCGAGGGTCTGGAATCCTGG - Intergenic
953490421 3:43345593-43345615 GCCTGCAGGTTCTGGAGTCCAGG + Intronic
953865698 3:46581165-46581187 CGGTGGTAGTTCTGGAGTCCTGG - Exonic
953927532 3:46989982-46990004 TGCTGGAGGATCTGGTGCCCAGG + Intronic
953982277 3:47418774-47418796 CGAGGGAGGCTCTGGAGGGCCGG - Exonic
954081939 3:48217580-48217602 CACTGGAGGCACAGGAGTGCTGG + Intergenic
954677726 3:52324956-52324978 CGCAGCAGGGTCTGGAGGCCAGG + Intronic
959547636 3:107615393-107615415 TTCTGGAGGCTCAGAAGTCCAGG + Intronic
961384796 3:126517459-126517481 GGCTGGAGCCCCTGGAGTCCAGG + Intronic
967290528 3:187915300-187915322 CTCTGGAGGCTCTTGAGAGCAGG + Intergenic
968328644 3:197844483-197844505 GGCGGGAGGATCTTGAGTCCAGG - Intronic
968546703 4:1202639-1202661 CGCTGGTGGCCCTGCAGTCCTGG + Intronic
968583551 4:1405789-1405811 CGATGCAGGCCCTGCAGTCCGGG + Intronic
968626730 4:1629242-1629264 CTCTGTGGGCCCTGGAGTCCTGG - Intronic
968682132 4:1928699-1928721 AACTGGGGGCTCTGGAGTCATGG + Intronic
968731311 4:2270585-2270607 CTCTGGATGCTCTGGAGGTCTGG + Exonic
968850112 4:3073357-3073379 GGCAGGAGGCTCTGGAGACCAGG + Intergenic
969283940 4:6190783-6190805 CCCTGGGAGCTCTGGCGTCCTGG - Intronic
971886704 4:32458976-32458998 CGCTTGAGGCTAGGAAGTCCTGG - Intergenic
974623013 4:64385136-64385158 GGCTGGTGGCTCTGGTGACCAGG + Intronic
975201645 4:71597154-71597176 TTCTGGAGGCTGAGGAGTCCAGG - Intergenic
976879019 4:89895472-89895494 CGTTGGAGGCACTGGAGGCGTGG + Exonic
978617924 4:110614349-110614371 GGCTGGAGGCTGGGGAGTCCCGG + Intergenic
979536196 4:121823461-121823483 CGCTGGCGGTACTGAAGTCCGGG - Exonic
981392363 4:144206020-144206042 AGCAGAAGGTTCTGGAGTCCAGG - Intergenic
981455857 4:144952474-144952496 CACTGCAGGCTCTGGAGCCTTGG + Intergenic
983077511 4:163343962-163343984 CGCTGCAGGCCCTGGGCTCCCGG - Intronic
984397756 4:179222881-179222903 GGCTGGTGGCTCTGGAGACTGGG - Intergenic
986402460 5:7394966-7394988 CGCAGGAGGCGCTAGAGACCCGG - Intergenic
987358428 5:17084933-17084955 AGCTGGAGGACCTGGAGCCCAGG - Intronic
990657724 5:57975927-57975949 TTCTGGAGGCTGAGGAGTCCAGG - Intergenic
991170577 5:63620282-63620304 GTCTGATGGCTCTGGAGTCCAGG - Intergenic
992773187 5:80068367-80068389 CACCGGAGGCTCTGGCATCCAGG - Intronic
993901720 5:93588511-93588533 CGCGGGAGGCTCCGAAGGCCAGG - Intronic
996321547 5:122222559-122222581 CAGTGGAGTCTCTGGATTCCAGG - Intergenic
997338501 5:133124271-133124293 AGCTGGAGACTCTGGAATGCTGG + Intergenic
998474367 5:142408190-142408212 CACTGGGAGCTCTGGAGGCCAGG + Intergenic
1002101582 5:176860582-176860604 AGCTGGAGGCTCTGGGGTAAGGG + Intronic
1002196511 5:177504374-177504396 AGCGGCAGGCTCTGGGGTCCGGG + Exonic
1002819169 6:707828-707850 CGCTGGACGATCTGCAGGCCTGG + Intergenic
1002960563 6:1910928-1910950 CTCTGGAAGCTCTGGAGACAGGG + Intronic
1003119162 6:3305962-3305984 CACTGGAGGCTCTGGAGGCTGGG + Intronic
1004134322 6:12951743-12951765 TTCTGGAGGCTCTGGAGCCTGGG - Intronic
1004582074 6:16964197-16964219 TGCTTGGGGCTTTGGAGTCCAGG + Intergenic
1004605661 6:17192880-17192902 TTCTGGAGGCTGGGGAGTCCAGG + Intergenic
1006844335 6:37051878-37051900 CGCAGGAGGGACTGGCGTCCAGG + Intergenic
1010536876 6:77041595-77041617 GGCTGGAAGCTCTGGAGCCAGGG - Intergenic
1013861785 6:114644550-114644572 CACTGGAGCCTAGGGAGTCCAGG - Intergenic
1016753434 6:147657634-147657656 TTCTGGAGGCTCGGAAGTCCAGG + Intronic
1017815970 6:158016944-158016966 GGCTGGAGGAGCTGGGGTCCTGG - Intronic
1017870712 6:158484152-158484174 TGCTGGAGGATCTTGAATCCAGG - Intronic
1018630022 6:165814301-165814323 CGGTGGAGGGTGTGGAGTCGTGG - Intronic
1018753818 6:166831060-166831082 CACTGGAGGGTCTGGGCTCCAGG - Intronic
1020056126 7:5118464-5118486 GGCAGGAGGATCTCGAGTCCAGG + Intergenic
1020135512 7:5585879-5585901 CCCTGAAGGCTCTGGGCTCCTGG - Intergenic
1020999653 7:15312774-15312796 CTCAGGAGGCTCTTGAGCCCAGG - Intronic
1021275021 7:18639859-18639881 GGCTGAAGGTTCTGAAGTCCAGG + Intronic
1021414029 7:20361410-20361432 CTCTGGAGGCTGGGGAGTCCAGG + Intronic
1022723105 7:32957933-32957955 CGGCGGAGGGTCTGGGGTCCGGG - Intronic
1024094855 7:45975466-45975488 TTCTGGAGGCTGTGAAGTCCAGG + Intergenic
1026313546 7:69208891-69208913 GACTGGACGGTCTGGAGTCCGGG + Intergenic
1026794139 7:73354977-73354999 GGCTGGAGGCTGTAGAGCCCAGG - Intronic
1029653991 7:101912362-101912384 CCCACGAGGCTCTGGATTCCAGG + Intronic
1030077028 7:105745721-105745743 GGCAGGAGGCCCTGGAGTCCCGG + Intronic
1033228612 7:139579900-139579922 GCCAGGAGGCTCTGGTGTCCTGG - Intronic
1034222608 7:149458308-149458330 CGCTGGGGGCCCTGGAGGCTAGG + Intronic
1034930564 7:155158449-155158471 GTCTGGAGGCTGTGAAGTCCAGG + Intergenic
1035327990 7:158077129-158077151 CGCTGCGGGCTATGGGGTCCAGG + Intronic
1035536278 8:393648-393670 TGCTGGAGTCACTGGAGTGCAGG - Intergenic
1035769577 8:2136261-2136283 AGCTGCAGGCTGTGGGGTCCTGG + Intronic
1036097561 8:5740969-5740991 TGCTGGAAGCTGTGGACTCCTGG + Intergenic
1036236598 8:7044333-7044355 CGCTGGTGACTTTGGAGCCCAGG + Intergenic
1036739495 8:11347832-11347854 CGCTGGAGACTCTGCATTCCCGG + Intergenic
1039618321 8:38974531-38974553 GGCTGGAGGCACTGCAGCCCCGG - Exonic
1040850830 8:51899080-51899102 CCCCGGCGGCTCCGGAGTCCGGG - Exonic
1041064939 8:54073488-54073510 TGCTGGTAGTTCTGGAGTCCTGG - Intronic
1041753758 8:61290145-61290167 CTCTAGAGGCACTGGATTCCTGG - Intronic
1043527307 8:81111419-81111441 AGCTGGAAGGTCTGGAGTCCAGG - Intronic
1043614920 8:82113855-82113877 CTCTGGAGGCTGGGAAGTCCAGG + Intergenic
1043877622 8:85503848-85503870 CCCTTGAGGCTCTGGAATGCAGG - Intergenic
1044614597 8:94126851-94126873 GGCTGGAGGCACTGGGGTCAGGG + Intergenic
1045342605 8:101267991-101268013 CCCTGCAGCCTTTGGAGTCCAGG + Intergenic
1049762324 8:144337034-144337056 GGCTGCGGGCTCTGGAGGCCGGG - Intergenic
1051964039 9:22803912-22803934 TGCTGGAGGCTTTGAAGTTCTGG + Intergenic
1053279408 9:36808140-36808162 CGCTGGAGGTTTTAAAGTCCAGG - Intergenic
1055397700 9:75891881-75891903 CGCTGGAGACTCCGGAGGCGCGG + Intronic
1056218226 9:84425714-84425736 CGCTTGAGCCTGTGGAGTCAAGG - Intergenic
1059545408 9:115171005-115171027 TGTTGGAGGCTCTGTAGTCATGG - Intronic
1062460217 9:136659829-136659851 CACTGGAAGGTCTGGAGCCCAGG - Intronic
1062495209 9:136828290-136828312 CTCTGTAGGCTCTGGAGGCAGGG - Intronic
1185723760 X:2402906-2402928 AGATGGAGTCTCTGTAGTCCAGG + Intronic
1186078453 X:5905753-5905775 CGCTGGAGCCTCTGCCTTCCAGG + Intronic
1186190667 X:7064681-7064703 TGCTGGAGGCCCAGGAGTCAAGG - Intronic
1187176146 X:16897928-16897950 GGCTGGAGGGTCTGGAGACCAGG + Intergenic
1190088728 X:47419068-47419090 GGCAGGAGGATCTCGAGTCCAGG - Intergenic
1195310122 X:103624509-103624531 CCCTGGAGGCTCTGGAGGTGTGG - Intronic
1195311715 X:103638494-103638516 CCCTGGAGGCTCTGGAGGTGTGG - Intergenic
1195975485 X:110521611-110521633 CGGTGGTAGTTCTGGAGTCCTGG - Intergenic
1195980417 X:110571384-110571406 CAGTGGAGGCACTGGAATCCAGG - Intergenic
1198474610 X:136983440-136983462 AGCTGCTGGCTCTGGAGACCTGG + Intergenic
1199600222 X:149537291-149537313 CCATGGATGCTCTGGAGTCCCGG - Intergenic
1199650362 X:149942649-149942671 CCATGGATGCTCTGGAGTCCCGG + Intergenic
1200145565 X:153924651-153924673 GGCTGGAGGGGCTGGAGTCGGGG + Intronic
1200224320 X:154408910-154408932 CCTTGGAGGCTCTGGCGTCAGGG + Intronic