ID: 900174729

View in Genome Browser
Species Human (GRCh38)
Location 1:1286652-1286674
Sequence CCCTACTCGGGACGCCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 74}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900174729_900174736 8 Left 900174729 1:1286652-1286674 CCCACTGGGCGTCCCGAGTAGGG 0: 1
1: 0
2: 0
3: 4
4: 74
Right 900174736 1:1286683-1286705 GCTGTCCCGACAGCACACACTGG 0: 1
1: 0
2: 0
3: 8
4: 104
900174729_900174742 18 Left 900174729 1:1286652-1286674 CCCACTGGGCGTCCCGAGTAGGG 0: 1
1: 0
2: 0
3: 4
4: 74
Right 900174742 1:1286693-1286715 CAGCACACACTGGGATGCTGGGG 0: 1
1: 0
2: 4
3: 51
4: 457
900174729_900174741 17 Left 900174729 1:1286652-1286674 CCCACTGGGCGTCCCGAGTAGGG 0: 1
1: 0
2: 0
3: 4
4: 74
Right 900174741 1:1286692-1286714 ACAGCACACACTGGGATGCTGGG 0: 1
1: 0
2: 1
3: 19
4: 246
900174729_900174737 9 Left 900174729 1:1286652-1286674 CCCACTGGGCGTCCCGAGTAGGG 0: 1
1: 0
2: 0
3: 4
4: 74
Right 900174737 1:1286684-1286706 CTGTCCCGACAGCACACACTGGG 0: 1
1: 0
2: 0
3: 9
4: 89
900174729_900174740 16 Left 900174729 1:1286652-1286674 CCCACTGGGCGTCCCGAGTAGGG 0: 1
1: 0
2: 0
3: 4
4: 74
Right 900174740 1:1286691-1286713 GACAGCACACACTGGGATGCTGG 0: 1
1: 1
2: 0
3: 16
4: 209
900174729_900174743 29 Left 900174729 1:1286652-1286674 CCCACTGGGCGTCCCGAGTAGGG 0: 1
1: 0
2: 0
3: 4
4: 74
Right 900174743 1:1286704-1286726 GGGATGCTGGGGCCAGTGTGAGG 0: 1
1: 0
2: 4
3: 60
4: 543

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900174729 Original CRISPR CCCTACTCGGGACGCCCAGT GGG (reversed) Intronic
900174729 1:1286652-1286674 CCCTACTCGGGACGCCCAGTGGG - Intronic
901946936 1:12711791-12711813 CCCCACCCGAGACCCCCAGTGGG - Intergenic
902399238 1:16148931-16148953 CTCTCCTCGGTACACCCAGTTGG + Exonic
903179858 1:21599694-21599716 CCCAACCCGGGAGGCCCAGCTGG + Intronic
905209990 1:36367399-36367421 CCCTACTCAGGCCACGCAGTGGG - Intronic
906856185 1:49307742-49307764 ACCTACTTGGGAGGCCCAGGAGG - Intronic
907018059 1:51036375-51036397 CCCTACTCAGGACGCTGAGGTGG - Intergenic
918523401 1:185439510-185439532 GGCTACTGGGGACTCCCAGTTGG - Intergenic
921985429 1:221307063-221307085 TCTTACTGGGGACACCCAGTAGG + Intergenic
922335837 1:224617487-224617509 CGGGACCCGGGACGCCCAGTCGG - Intronic
1064964949 10:21005619-21005641 CGCTACTCGGGAGGCTCAGGTGG + Intronic
1069072998 10:64009438-64009460 CCCCAATCCGGATGCCCAGTGGG + Intergenic
1075004523 10:118820450-118820472 CCCAACTCAGGACTCCCATTTGG + Intergenic
1083821509 11:65173778-65173800 AGCTACTCGGGACGCCAAGGTGG + Intergenic
1084222673 11:67693901-67693923 CCCTGCTCAGGACCCGCAGTGGG - Intergenic
1090225644 11:125070727-125070749 CCCTACTCCGGCCCCCCAGAAGG + Intronic
1091539998 12:1451510-1451532 ACCTACTCGGGAGGCCCAGGTGG + Intronic
1095801327 12:46272048-46272070 CCCTACCTGGGTTGCCCAGTAGG + Intergenic
1096077503 12:48814641-48814663 CCCAGCTCGAGACCCCCAGTAGG - Intronic
1096479349 12:51927883-51927905 AGCTACTCGGGAGGCCCAGGTGG - Intergenic
1096672198 12:53206702-53206724 CCCTCCTTGTGACTCCCAGTGGG - Intronic
1100637153 12:96445406-96445428 AGCTACTCGGGACGCTGAGTTGG + Intergenic
1106589929 13:31090312-31090334 CCTGTCTTGGGACGCCCAGTCGG + Intergenic
1106825958 13:33520715-33520737 CCCTGCTTGGGATGCACAGTGGG - Intergenic
1106877572 13:34090438-34090460 CCCTACTCGGGAGGCTGAGGCGG + Intergenic
1131544255 15:93302582-93302604 CCCTTCTGGAGCCGCCCAGTTGG - Intergenic
1132183013 15:99776471-99776493 CGCTACTCGGGAGGCCGAGGCGG - Intergenic
1133019907 16:2962846-2962868 CCCTCGTCGGGAAGCGCAGTTGG + Intergenic
1143808033 17:9445946-9445968 AGCTACTCGGGAGGCCGAGTCGG - Intronic
1143900089 17:10167809-10167831 AGCTACTCGGGAGGCCCAGGTGG - Intronic
1160763952 19:798800-798822 CCCTCCTCGGGACACCCCGGGGG - Intronic
1160877833 19:1305438-1305460 AGCTACTCGGGAGGCCCAGGGGG + Intergenic
1167877923 19:52429706-52429728 AGCTACTCGGGAGGCCCAGGCGG - Intronic
925394022 2:3519408-3519430 CCCGACCCCGGCCGCCCAGTGGG - Exonic
925967178 2:9076911-9076933 AGCTACTCGGGACGCCGAGGTGG + Intergenic
930503673 2:52255589-52255611 CCCTACTAGGGACTCTCTGTGGG + Intergenic
930820718 2:55643626-55643648 ACCTACTTGGGACTCACAGTCGG + Intronic
939232079 2:139441044-139441066 AGCTACTCGGGAGGCCCAGGTGG - Intergenic
942446463 2:176081852-176081874 CCCTAGGCGGCAAGCCCAGTTGG - Intronic
945195395 2:207232715-207232737 CCCTACGCAGTCCGCCCAGTAGG + Intergenic
1169475377 20:5926322-5926344 CCCTACTCAGGAGGCCAAGGCGG + Intergenic
1174842773 20:53915701-53915723 CCCAGCTCGGGACGCCCAGCGGG - Intergenic
1175633434 20:60560796-60560818 CTCTTCTCGGGACCCTCAGTGGG - Intergenic
1176512109 21:7756541-7756563 ACCTACTCGGGAGGCTGAGTTGG - Intronic
1178646221 21:34387066-34387088 ACCTACTCGGGAGGCTGAGTTGG - Intronic
1181105564 22:20572810-20572832 TGCTACTCGGGAGGCCGAGTTGG + Intronic
1183957858 22:41392922-41392944 CACTACTCGGGAGGCTGAGTCGG + Intronic
1184497073 22:44848209-44848231 CCCCACTCTGGACTACCAGTGGG - Intronic
949425263 3:3909263-3909285 CCTCACTCGGGAAGCCCAGGGGG - Intronic
956219266 3:66884550-66884572 ACCTACTCGGGAGGCTGAGTTGG + Intergenic
961582299 3:127892695-127892717 CCCCACCCGAGACCCCCAGTGGG + Intergenic
962229929 3:133655090-133655112 CGCTACTCGGGAAGCTGAGTTGG + Intronic
964461013 3:156928344-156928366 CCCCACTAGGGACACCCTGTGGG - Intronic
968466335 4:753294-753316 CCCTACTCGGGAGGCTGAGTTGG - Intronic
970309161 4:14763625-14763647 CCATACTTGGGACGCTCTGTTGG - Intergenic
975748632 4:77499697-77499719 CCCAACTAGGGATGCCCTGTAGG - Intergenic
976128005 4:81854250-81854272 CCCTAGTAGGGACTCCCTGTGGG + Intronic
978529953 4:109703109-109703131 CGCTACTCGGGACCGCCAGGAGG + Intronic
992743436 5:79796081-79796103 CCCTACCTGGGAGGCCAAGTAGG - Intronic
997692367 5:135835339-135835361 CTCCAGTCGGGACGCCCCGTTGG - Intronic
997955753 5:138277326-138277348 AGCTACTCGGGAGGCTCAGTGGG + Intergenic
1003331265 6:5130447-5130469 CCCTGCTCCGGAGGACCAGTGGG - Intronic
1004473300 6:15947954-15947976 CCCTCCTTGGGACCCCCAGTGGG - Intergenic
1007802999 6:44413694-44413716 AGCTACTCGGGAGGCCAAGTTGG - Intronic
1020127082 7:5539073-5539095 CCCCACTCGGGACAACCAGAAGG - Intronic
1029549592 7:101230653-101230675 CCGTGCTTGAGACGCCCAGTTGG + Intergenic
1032240331 7:130154550-130154572 CCCTCCTCGGGAGGCCCCGCAGG + Intergenic
1037811350 8:22089075-22089097 CCCGGCTGGGGGCGCCCAGTCGG - Intergenic
1041959713 8:63598720-63598742 CTCTACTCGGGAGGCCAAGGCGG - Intergenic
1047291903 8:123539116-123539138 CCCTACTCGGGAGGCTGAGGTGG - Intronic
1049710366 8:144060521-144060543 CCCGCCTCGGGTCGCCCCGTCGG - Intronic
1053757130 9:41323106-41323128 CCCTAGTCAGGACCCCGAGTGGG - Intergenic
1054329597 9:63738681-63738703 CCCTAGTCAGGACCCCGAGTGGG + Intergenic
1054466552 9:65499317-65499339 ACCTACTCGGGAGGCTCAGGCGG + Intergenic
1056186235 9:84137782-84137804 AGCTACTCGGGAGGCTCAGTTGG + Intergenic
1057701808 9:97368435-97368457 CCTTACTCAGGAAGCCCTGTTGG - Intronic
1060234883 9:121855630-121855652 CCCTCCTCTGAACGCCCATTTGG - Intronic
1061024503 9:128039363-128039385 CCCTACTCGGGAGGCTGAGGTGG + Intergenic
1189056622 X:37705863-37705885 ACCTACTTGGGAGGCTCAGTGGG - Intronic