ID: 900176807

View in Genome Browser
Species Human (GRCh38)
Location 1:1294717-1294739
Sequence GTGGACAGCGTCACTGAGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900176807_900176812 2 Left 900176807 1:1294717-1294739 CCCTCCTCAGTGACGCTGTCCAC 0: 1
1: 0
2: 2
3: 13
4: 169
Right 900176812 1:1294742-1294764 CAGAGCCCGAGCCGAAAGCCAGG 0: 1
1: 0
2: 0
3: 12
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900176807 Original CRISPR GTGGACAGCGTCACTGAGGA GGG (reversed) Exonic
900176807 1:1294717-1294739 GTGGACAGCGTCACTGAGGAGGG - Exonic
900270131 1:1782819-1782841 TTGGACAGCGGCACTGACTAAGG - Intergenic
901590168 1:10334572-10334594 GTGGCCATCGTCAGTGAGAAAGG + Exonic
907263444 1:53239017-53239039 AGGGAAGGCGTCACTGAGGAGGG - Intergenic
910428614 1:87139620-87139642 GTGGACAGTGTCACTGGGACAGG + Intronic
912302585 1:108533511-108533533 GTGCAAAGGGTCAGTGAGGAGGG - Intergenic
915290453 1:154879652-154879674 GTGGCCAGCGTCTCTCAGGTGGG + Intergenic
917246378 1:173005261-173005283 GTGGAAAGAGGCATTGAGGAGGG - Intergenic
917457871 1:175201117-175201139 CTGGACAGCGTCAACCAGGAAGG - Intergenic
920008827 1:202853090-202853112 GTGGACAGGGGCATGGAGGAAGG - Intergenic
920045537 1:203129931-203129953 CTGGACACCCACACTGAGGACGG - Intronic
921897896 1:220420192-220420214 GTGGAAAGAGTAACTGGGGAGGG - Intergenic
1062905268 10:1175600-1175622 CTGGCCAGAGTCACTGAGCATGG - Intergenic
1064301893 10:14130198-14130220 GTGGCCAGTGTCATGGAGGAAGG - Intronic
1068052480 10:51967941-51967963 GTGAACAGAATCACTGAGAATGG - Intronic
1070895866 10:79982478-79982500 GTGCACAGCAGCGCTGAGGAAGG + Intronic
1071092614 10:81936513-81936535 GTAGACAGTGTAAGTGAGGATGG + Intronic
1072611903 10:97022987-97023009 GTGGACAGCGTCCCTGTTGCTGG + Intronic
1074396678 10:113103860-113103882 ATGGACAGAGTCACTGAGGCAGG + Intronic
1075523842 10:123165613-123165635 GTGTGCAGCTTCACTCAGGATGG + Exonic
1076338280 10:129725285-129725307 CTGGGCAGGGTCTCTGAGGATGG - Intronic
1076773839 10:132682113-132682135 GTGGACAGCGTCCTGGAGGTGGG + Intronic
1076773846 10:132682139-132682161 GTGGACAGCGTCCTGGAGGTGGG + Intronic
1078066888 11:8084562-8084584 GAGGACAAGGGCACTGAGGACGG - Intronic
1080313116 11:30917724-30917746 GAGGACTGCTTGACTGAGGAAGG + Intronic
1082175173 11:49049924-49049946 GTGGAGAGCGTACCGGAGGAGGG - Intergenic
1082243503 11:49893539-49893561 GTGGAGAGCGTCCTGGAGGAGGG - Intergenic
1083209469 11:61174086-61174108 ATGGAAGGCATCACTGAGGAGGG + Intergenic
1083538994 11:63498581-63498603 GTGGAAAGAGACATTGAGGAAGG - Intergenic
1083730908 11:64652034-64652056 GTGGACAACGTGACTGTGGAGGG - Exonic
1084893309 11:72247832-72247854 CTGGTCAGCTTCACTGGGGAAGG - Intergenic
1084980274 11:72825164-72825186 GTGGACAGAGAAACTGGGGAGGG + Intronic
1086690594 11:89786160-89786182 GTGGAGAGCGTACCGGAGGAGGG + Intergenic
1086697928 11:89865362-89865384 GTGGAGAGCGTCCTGGAGGAGGG - Intergenic
1086708234 11:89979126-89979148 GTGGAGAGCGTCCTGGAGGAGGG + Intergenic
1086715205 11:90053500-90053522 GTGGAGAGCGTACCGGAGGAGGG - Intergenic
1089839116 11:121399045-121399067 GTGGACATCGTTAGTGGGGAGGG - Intergenic
1090101378 11:123800547-123800569 GTGGAAATCGTAACAGAGGAAGG + Intergenic
1202828211 11_KI270721v1_random:100087-100109 GTGCGCAGCGTCCCGGAGGATGG + Intergenic
1091429628 12:422698-422720 GTGGACAGCTTCAGTTTGGAAGG - Intronic
1092053930 12:5493489-5493511 GTGGAGAGCGTCCCCGGGGATGG + Intronic
1094065704 12:26358803-26358825 GTGGCCAGAGTCAGTGAGGGTGG - Intronic
1103935624 12:124475015-124475037 GAGGACAGAGGCCCTGAGGATGG - Intronic
1105241542 13:18613140-18613162 GTGCTCTGGGTCACTGAGGAAGG + Intergenic
1118589866 14:67393136-67393158 GGGGACAGGCTCACCGAGGAAGG + Exonic
1118921921 14:70157261-70157283 GTAGACAGAGTCACTTAGAAGGG - Intronic
1122248717 14:100423301-100423323 GTGGAGAATGCCACTGAGGATGG + Intronic
1122345756 14:101059064-101059086 GTGGAAGGTGACACTGAGGAGGG - Intergenic
1123489809 15:20772006-20772028 GTGCTCTGGGTCACTGAGGAAGG - Intergenic
1123546308 15:21341093-21341115 GTGCTCTGGGTCACTGAGGAAGG - Intergenic
1123627660 15:22238749-22238771 GAGGACAGCGTCACTGAGCTGGG + Intergenic
1123723251 15:23078426-23078448 AAGGACAGAGTCACTGAGAATGG + Intergenic
1127092148 15:55478065-55478087 CTGGACAGGGGCAGTGAGGAAGG - Intronic
1127481454 15:59381243-59381265 GGGGACAGAGTCTCTGGGGAAGG + Intronic
1128980374 15:72181057-72181079 GCGGACAGGGTCACTGTAGAGGG + Intronic
1129516654 15:76161374-76161396 GTGGGCAGAGGCACTGAGGTGGG + Intronic
1131195710 15:90352887-90352909 GGAGACAGCGCCACTGAGGAGGG - Intronic
1202954635 15_KI270727v1_random:68308-68330 GTGCTCTGGGTCACTGAGGAAGG - Intergenic
1133280368 16:4661693-4661715 GTGGACAGAGACACTGATGCTGG - Intronic
1134316831 16:13126646-13126668 GTGGAGAGAGAGACTGAGGAAGG + Intronic
1135409922 16:22225814-22225836 GGGGACAGCGACGATGAGGAAGG + Exonic
1135486796 16:22872698-22872720 ATGGACTGCCTCATTGAGGATGG + Intronic
1141195988 16:81861738-81861760 GTGGAGAGAGGCACTGAGGGTGG - Intronic
1141231381 16:82170505-82170527 GTGGAGGGGGTCCCTGAGGAAGG - Intergenic
1141976298 16:87518608-87518630 GAGGACAGCGTCCCTGAGCTGGG - Intergenic
1142264335 16:89056863-89056885 GTGGCCCGCTTCACTGAAGACGG - Intergenic
1143005465 17:3830107-3830129 GTGGGCATCGTCACTGCGGAGGG + Intronic
1144489965 17:15700102-15700124 GGGGACAGCATCCCTGAGGCTGG - Exonic
1144910996 17:18681857-18681879 GGGGACAGCATCCCTGAGGCTGG + Intronic
1146052345 17:29563998-29564020 GTGGGCACCGTCACACAGGAAGG - Intronic
1148711459 17:49684389-49684411 GTGGATCGCATCAGTGAGGAGGG - Intergenic
1150654818 17:67032858-67032880 CTGGACAGCGGGACTGGGGAGGG - Exonic
1150842477 17:68621808-68621830 CTGGGCAGAGTCATTGAGGAAGG + Intergenic
1154447415 18:14446766-14446788 GTGCTCTGGGTCACTGAGGAAGG - Intergenic
1157197004 18:45627610-45627632 GTGGGAAGGGGCACTGAGGAAGG + Intronic
1157915807 18:51662688-51662710 GGGGCCAGAGTCACCGAGGAAGG + Intergenic
1163106239 19:15124655-15124677 GTGAAAAGAGTCACTGGGGAAGG + Intronic
1166202632 19:41248474-41248496 GTGGACAGAGTCATGGAGCAGGG - Intronic
1166729353 19:45049993-45050015 TTAGATAGAGTCACTGAGGACGG + Intronic
1167110330 19:47456963-47456985 GTGGACTACCGCACTGAGGACGG - Exonic
1167740920 19:51324564-51324586 GTGGACGGTGGCACTGAGGTTGG - Intronic
925803455 2:7625484-7625506 GTGGATTGATTCACTGAGGAGGG - Intergenic
926082503 2:9999393-9999415 GTGGCCAGCGCCACTGAGGATGG + Intronic
928204979 2:29277596-29277618 GTGGCCAGCATCACTGGGGTTGG + Intronic
928719541 2:34103249-34103271 GTCCACAGAGCCACTGAGGAGGG - Intergenic
929924252 2:46196076-46196098 GTGGACAGCGTCCATTAAGATGG - Intergenic
930744803 2:54871083-54871105 GTGGGTAGCGTAACTGAGAATGG + Intronic
932598764 2:73110450-73110472 GTGGGGAGGGTCACTTAGGATGG - Intronic
933771568 2:85747979-85748001 AGGGACAGCCTCACTGAGAAGGG + Intergenic
934588305 2:95525544-95525566 TTGGAGAGCGTCCCGGAGGAGGG + Intergenic
934894238 2:98100217-98100239 GTGGACAGGGTTACTAATGAAGG - Intronic
938218944 2:129549049-129549071 GTGGACAGCCTCACTGCGGCTGG - Intergenic
942703362 2:178739374-178739396 GTGGACACTGTTTCTGAGGAAGG - Exonic
948447725 2:238046144-238046166 GTGAACAGGGTCACTGAGGCTGG - Intronic
1169703855 20:8480436-8480458 CTGAAGAGCGTCACTGAGAAAGG + Intronic
1170801432 20:19593740-19593762 GAGGACAGCCACACTGTGGAGGG - Intronic
1172053778 20:32139910-32139932 TAGGACAGCTTCCCTGAGGAAGG - Intronic
1173437563 20:43046593-43046615 TTGGACAGCGGGACTGAGGTCGG + Intronic
1173879057 20:46397229-46397251 AAGGACAGAGTCACTGAGAATGG - Intronic
1179424965 21:41268902-41268924 GTAGTCAGCGTGACTGAGGTTGG + Intronic
1180116649 21:45710733-45710755 GTGCTCTGCCTCACTGAGGATGG + Intronic
1180966126 22:19788796-19788818 CTGGACAGCGGCGCTGTGGAAGG + Exonic
1182777623 22:32842444-32842466 TTGGGAAGGGTCACTGAGGAAGG + Intronic
1183147780 22:36010379-36010401 GTGGCCCGAGTCACAGAGGAAGG - Intronic
1183184916 22:36286234-36286256 GTGGACAGAGTCACTCAGGGCGG + Intronic
1184923130 22:47619825-47619847 GTGGGCAGCCTCCCTCAGGAGGG - Intergenic
950540610 3:13610085-13610107 AGGGACAGCCTCACTGAGGAGGG + Intronic
952551069 3:34477493-34477515 CTGGACAGAGGCAGTGAGGAAGG - Intergenic
954837043 3:53479007-53479029 GTGGCCAGCAGCACAGAGGAGGG - Intergenic
956096109 3:65717999-65718021 GTGGGCAGAGTTACTGTGGAAGG + Intronic
961516880 3:127443605-127443627 GTGGAGGGTGTCACTGGGGATGG + Intergenic
961780765 3:129318953-129318975 AGGGACAGGGTCACGGAGGAAGG + Intergenic
962365939 3:134781490-134781512 GGGGACGGCTTCAGTGAGGAAGG + Intronic
966129792 3:176624555-176624577 GTGGAGAGTGGTACTGAGGATGG + Intergenic
970998140 4:22291539-22291561 GTGGGCAGGGCCTCTGAGGAAGG + Intergenic
972266526 4:37465403-37465425 GTGGATGGCTTCCCTGAGGAAGG + Intronic
975629540 4:76386673-76386695 GTGGAAAGAGGCATTGAGGAGGG + Intronic
975667714 4:76749614-76749636 ATGAACAGCTTCACAGAGGAAGG + Intronic
975866976 4:78733941-78733963 GGGGACAGGCTCACTTAGGAGGG + Intergenic
976186729 4:82449570-82449592 GAGGACAGCATCAAGGAGGATGG + Intronic
976281412 4:83330359-83330381 GTGGACAGGGTTAGTGGGGAAGG + Intronic
976443903 4:85108535-85108557 GTTGACTGCTTCACTGAAGATGG - Intergenic
977167021 4:93711812-93711834 GAGGAAAGAGGCACTGAGGAGGG - Intronic
977266321 4:94860022-94860044 TAGGACAGTTTCACTGAGGAAGG - Intronic
979529939 4:121759498-121759520 GTGGCTAGTGTGACTGAGGAAGG - Exonic
982158985 4:152548469-152548491 GAGGACAGCGACACTGGGGAGGG - Intergenic
984843520 4:184090731-184090753 GTGGCCACAGACACTGAGGATGG + Exonic
985486467 5:154396-154418 GCGGGCAGCGGCCCTGAGGACGG + Intronic
990611010 5:57456922-57456944 GTGGTCAGCCTCCCTGCGGAAGG + Intergenic
994282474 5:97921994-97922016 CTGTACAGCCTCACTGACGATGG + Intergenic
997194114 5:131966341-131966363 GTGGTCCGGGTCACTGAGGCAGG - Intronic
997388871 5:133497109-133497131 GTGGGCAGTGCCAGTGAGGATGG - Intronic
1000380867 5:160628265-160628287 GTGAACAGTGTCACTGAGGCTGG + Intronic
1001086177 5:168701546-168701568 GAGGGCAGCGGCCCTGAGGAAGG + Intronic
1001975820 5:175997518-175997540 GGTGACAGCGTCACTGAGCTGGG - Intronic
1002056193 5:176599138-176599160 GTATACAGTGTCACCGAGGAAGG - Exonic
1002241605 5:177846254-177846276 GGTGACAGCGTCACTGAGCTGGG + Intergenic
1002304191 5:178273786-178273808 GTGGGTATGGTCACTGAGGAGGG + Intronic
1003393408 6:5732594-5732616 GTGGACATTCTCAATGAGGAGGG + Intronic
1004584594 6:16987299-16987321 GAATACAGAGTCACTGAGGAGGG + Intergenic
1006377573 6:33680116-33680138 GAGGACTGCATCACTGAGGTGGG + Exonic
1006981923 6:38154180-38154202 GGGGGCTGCCTCACTGAGGATGG - Exonic
1007397796 6:41587364-41587386 GAGGACAGCGTCAAGCAGGAGGG + Exonic
1011640330 6:89411848-89411870 CCGGACAGCGGCACAGAGGAGGG - Exonic
1014012873 6:116496664-116496686 ATGAACAGCTTCTCTGAGGATGG + Exonic
1017194610 6:151686283-151686305 GTATACAGTGTCATTGAGGATGG + Intronic
1019262882 7:91930-91952 GTGGAGTGAGTCACTGGGGAGGG + Intergenic
1019279009 7:191046-191068 GTAGACAGGGTCACTGAGAGAGG - Intergenic
1019593195 7:1846026-1846048 GCGTTCAGCGTCACTGGGGAAGG + Intronic
1020260281 7:6527017-6527039 GTGGCCAGAGTCATGGAGGACGG - Intronic
1022136368 7:27453202-27453224 GTTGACAGTGTCACTGAAGATGG + Intergenic
1022363325 7:29684871-29684893 GTGCACAGCAGCCCTGAGGATGG - Intergenic
1022427999 7:30285706-30285728 GTGCACAGCAGCCCTGAGGACGG + Exonic
1022698061 7:32728886-32728908 GTGCACAGCAGCCCTGAGGATGG + Intergenic
1024232783 7:47375312-47375334 GTGGACAGCCTCCCTTGGGAGGG - Intronic
1027141673 7:75662009-75662031 GTGGACAGGGTCTCTGAGGAGGG + Intronic
1027655826 7:80929921-80929943 GATGTCAGCGTCACTTAGGAGGG + Intergenic
1031098343 7:117448083-117448105 GTGGAAAGAGACATTGAGGAAGG + Intergenic
1031633626 7:124074871-124074893 GTGGACAGAGTCAGACAGGATGG + Intergenic
1033374720 7:140747129-140747151 TGGGGCAGCTTCACTGAGGATGG + Intronic
1034312410 7:150100321-150100343 GAGGCCAGCTGCACTGAGGATGG - Intergenic
1034536231 7:151727597-151727619 GTGGCCAGTGACCCTGAGGAGGG - Intronic
1034794444 7:154000343-154000365 GGGGCCAGCTGCACTGAGGATGG + Intronic
1035409007 7:158623512-158623534 GTGGTGAGCCTCAGTGAGGAGGG - Intergenic
1036480243 8:9133064-9133086 GTGGACAGAGACATTGAGGTCGG - Intergenic
1036671652 8:10792453-10792475 GCGCACAGCGTCACGGGGGAGGG - Intronic
1038286110 8:26207599-26207621 GTGGATGGCGTCACTGGGTAGGG - Intergenic
1044194600 8:89359261-89359283 TTTGACAGCTTCACTGAGAAAGG - Intergenic
1049513147 8:143039757-143039779 GTGGAGAGGGTCACTGGAGAGGG + Intronic
1049596879 8:143488933-143488955 ATGGACAGCGGATCTGAGGAGGG - Intronic
1050248039 9:3712889-3712911 GTGGAAAGGGGCACTGAGGAGGG + Intergenic
1051971522 9:22893353-22893375 GTTCACAGCGTCACTGAACATGG + Intergenic
1055633313 9:78247300-78247322 GGGGACAGCTTCACTGAAAAAGG + Intronic
1056420079 9:86415885-86415907 TAGGACAGCCTCTCTGAGGAGGG + Intergenic
1056794001 9:89644413-89644435 GGTGACAGGGCCACTGAGGAGGG + Intergenic
1057824066 9:98358857-98358879 GTGGAAAGGGTCCCTGAGGCAGG - Intronic
1058190418 9:101907836-101907858 GTGGATAGAGTCAGTGAGCATGG + Intergenic
1058816471 9:108687446-108687468 GTTGGCGACGTCACTGAGGAGGG + Intergenic
1059288144 9:113195574-113195596 TAGGAAAGCGTCACTGAGAAGGG + Intronic
1061745055 9:132733585-132733607 GGGGACAGCCTCGCTGCGGAGGG + Intronic
1062059970 9:134490052-134490074 GGGGACAGCCACACTGGGGAGGG - Intergenic
1192134928 X:68588414-68588436 GTGGAAAGTGGCATTGAGGAGGG + Intergenic
1199413707 X:147555586-147555608 GTGGAGAGCCTCACTTAGGCAGG - Intergenic
1200102203 X:153693788-153693810 GTTGACAGCGCCTCTGAGGCAGG + Intronic
1200166623 X:154040008-154040030 GTGGAGGAAGTCACTGAGGAGGG + Intronic