ID: 900177024

View in Genome Browser
Species Human (GRCh38)
Location 1:1295460-1295482
Sequence ACTTCGACGCAGGGGCCGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 29}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900177024_900177035 24 Left 900177024 1:1295460-1295482 CCCTGCGGCCCCTGCGTCGAAGT 0: 1
1: 0
2: 0
3: 4
4: 29
Right 900177035 1:1295507-1295529 CGGGACAGAAGAGGGAGTCTCGG 0: 1
1: 0
2: 0
3: 21
4: 230
900177024_900177034 16 Left 900177024 1:1295460-1295482 CCCTGCGGCCCCTGCGTCGAAGT 0: 1
1: 0
2: 0
3: 4
4: 29
Right 900177034 1:1295499-1295521 CAGCTCGTCGGGACAGAAGAGGG 0: 1
1: 0
2: 0
3: 5
4: 70
900177024_900177031 5 Left 900177024 1:1295460-1295482 CCCTGCGGCCCCTGCGTCGAAGT 0: 1
1: 0
2: 0
3: 4
4: 29
Right 900177031 1:1295488-1295510 AAGAGCGAGTCCAGCTCGTCGGG 0: 1
1: 0
2: 0
3: 2
4: 40
900177024_900177036 27 Left 900177024 1:1295460-1295482 CCCTGCGGCCCCTGCGTCGAAGT 0: 1
1: 0
2: 0
3: 4
4: 29
Right 900177036 1:1295510-1295532 GACAGAAGAGGGAGTCTCGGCGG 0: 1
1: 0
2: 0
3: 12
4: 169
900177024_900177030 4 Left 900177024 1:1295460-1295482 CCCTGCGGCCCCTGCGTCGAAGT 0: 1
1: 0
2: 0
3: 4
4: 29
Right 900177030 1:1295487-1295509 GAAGAGCGAGTCCAGCTCGTCGG 0: 1
1: 0
2: 0
3: 4
4: 48
900177024_900177033 15 Left 900177024 1:1295460-1295482 CCCTGCGGCCCCTGCGTCGAAGT 0: 1
1: 0
2: 0
3: 4
4: 29
Right 900177033 1:1295498-1295520 CCAGCTCGTCGGGACAGAAGAGG 0: 1
1: 0
2: 0
3: 2
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900177024 Original CRISPR ACTTCGACGCAGGGGCCGCA GGG (reversed) Exonic
900177024 1:1295460-1295482 ACTTCGACGCAGGGGCCGCAGGG - Exonic
902067577 1:13700542-13700564 ACTTCGCCGCAGGGACCCCACGG - Intronic
902070062 1:13726872-13726894 ACTTCTATTCAGGGGCAGCAAGG + Intronic
912481453 1:109984922-109984944 AGCTCGACGCAGGGGCCGGCAGG + Exonic
1067296246 10:44976681-44976703 ACTTCCACACAGGGGCCTCATGG - Exonic
1070657906 10:78283765-78283787 ACTTTGACACAGGGGCCAGAGGG - Intergenic
1081962605 11:47149299-47149321 ACTTCAAAGCAGGGGCGGCCGGG + Intronic
1089368219 11:117934066-117934088 TCTTAAACGCAGGGGCCCCAGGG + Intergenic
1092143798 12:6201076-6201098 ACTTTTACGCAGGAGCGGCAGGG + Intronic
1103524913 12:121561133-121561155 CCTTCAAAGCAGGGGCCACAGGG - Intronic
1117974026 14:61280582-61280604 ACCTCGACGTAGGGCCCGCCGGG + Exonic
1118997392 14:70848940-70848962 ACTTGGAGGCAGAGGCTGCAGGG + Intergenic
1134077734 16:11303893-11303915 AATTCGACGCAGGGGGCATAAGG - Intronic
1134124266 16:11605509-11605531 ACTCCTAGGCAGGGGCCGCAAGG + Intronic
1139366789 16:66438623-66438645 ACTTGGACTCAGGGGCCTCAGGG - Intronic
1152717691 17:81907732-81907754 ACCTCGACCCAGGGGCCTCGGGG + Intronic
1166749941 19:45159832-45159854 AGTTGGAAGCAGGGGCCGCCTGG - Intronic
928123222 2:28598893-28598915 CCTTCGTCACAGGGGCAGCAGGG - Intronic
1169080848 20:2797056-2797078 ATCCCGACGCAGGGGCCTCAAGG + Exonic
1180256958 21:46636067-46636089 GCTTCGGGGCAGGGGCCGCCAGG - Exonic
961404513 3:126668724-126668746 CCTGCGGGGCAGGGGCCGCAGGG + Intergenic
961644803 3:128387156-128387178 ACCTGGCCGCAGGGGCTGCAGGG + Intronic
962754199 3:138455907-138455929 ACTTCGAGGCAGGAGGCGTAGGG - Intronic
968574456 4:1358631-1358653 ACTCGGACGCAGCGGCCGCGCGG - Intronic
1026156138 7:67827427-67827449 AATTCGACTGAGGGGCCACAAGG - Intergenic
1026525104 7:71146538-71146560 ACTTCTTCCCAGGGGCCACATGG - Intronic
1034430928 7:151040832-151040854 ACCTCGAAGCCGGGGCGGCAGGG - Exonic
1043472856 8:80578811-80578833 ACTTCGTCCCCGGGGCCCCAGGG - Intergenic
1044569455 8:93700747-93700769 AATTCGGCGCAGAGGCCCCATGG - Intronic
1049200931 8:141340160-141340182 ACTGGGCCGCAGGGGCCTCAAGG - Intergenic
1061424166 9:130488852-130488874 ACCTGGCCGCAGGGGCCCCATGG + Intronic
1186423173 X:9443057-9443079 ACTTGGACGAAGGGGCGGGAGGG + Intergenic
1186423181 X:9443082-9443104 ACTTGGACGAAGGGGCGGGAGGG + Intergenic
1186423189 X:9443107-9443129 ACTTGGACGAAGGGGCGGGAGGG + Intergenic