ID: 900177498

View in Genome Browser
Species Human (GRCh38)
Location 1:1297375-1297397
Sequence GTGTGTGTGTGCACAGGCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1166
Summary {0: 2, 1: 8, 2: 31, 3: 179, 4: 946}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900177492_900177498 -7 Left 900177492 1:1297359-1297381 CCATCCCCGGTGGCACGTGTGTG 0: 8
1: 6
2: 1
3: 11
4: 129
Right 900177498 1:1297375-1297397 GTGTGTGTGTGCACAGGCACGGG 0: 2
1: 8
2: 31
3: 179
4: 946

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900177498 Original CRISPR GTGTGTGTGTGCACAGGCAC GGG Intronic