ID: 900177708

View in Genome Browser
Species Human (GRCh38)
Location 1:1298165-1298187
Sequence AAGGTGAAGCAGGAAGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 708
Summary {0: 1, 1: 1, 2: 5, 3: 54, 4: 647}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900177708_900177714 -10 Left 900177708 1:1298165-1298187 CCACCCACTTCCTGCTTCACCTT 0: 1
1: 1
2: 5
3: 54
4: 647
Right 900177714 1:1298178-1298200 GCTTCACCTTGGAGACCCGGAGG 0: 1
1: 0
2: 1
3: 3
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900177708 Original CRISPR AAGGTGAAGCAGGAAGTGGG TGG (reversed) Intronic
900177708 1:1298165-1298187 AAGGTGAAGCAGGAAGTGGGTGG - Intronic
900522170 1:3111069-3111091 ATGGGGAAGCTGGAGGTGGGAGG + Intronic
900698172 1:4025882-4025904 AAGGTTGGGCAGGATGTGGGAGG + Intergenic
902242237 1:15096715-15096737 ATGGGGAAGAAGGAAGAGGGAGG + Intronic
902599912 1:17533945-17533967 AAGAAGAAGAAGAAAGTGGGTGG - Intergenic
902828907 1:18997091-18997113 AAGGTCACACAGGAAATGGGTGG + Intergenic
903242442 1:21992436-21992458 AAGGTGAAGCAGGAACATGAAGG + Intronic
903245952 1:22015621-22015643 AAGGTGAAGCAGGAACATGAAGG + Intergenic
903518478 1:23929035-23929057 GAGGAAGAGCAGGAAGTGGGAGG - Intergenic
903671333 1:25037570-25037592 AAGGTCATGCAGCAAGTGAGTGG + Intergenic
903710888 1:25323356-25323378 AAGGAGCAGGAGGAAGTGTGTGG - Intronic
903716058 1:25368073-25368095 AAGGAGCAGGAGGAAGTGTGTGG + Intronic
904634130 1:31866646-31866668 AAGGTGAAGTAGGAACAGGAAGG - Intergenic
904923339 1:34026205-34026227 AAGGTCAACCAGCAAGTGAGTGG + Intronic
905525473 1:38635179-38635201 AAGCTGAAGCGGGGAGTGAGGGG - Intergenic
905842829 1:41199296-41199318 TAGGTGGAGCAGTAACTGGGAGG - Intronic
905872900 1:41415251-41415273 AGGGAGAAGCAGGAAGGTGGAGG - Intergenic
907368539 1:53982198-53982220 AAGGAGGAGGAGGAGGTGGGTGG - Intergenic
907481803 1:54750106-54750128 AAGTTGAAGAAGGAATTGGGGGG + Intergenic
907640826 1:56188613-56188635 CTGGTGAAGTAGGGAGTGGGTGG + Intergenic
907871040 1:58443115-58443137 AAGGAGGAACAGGAAGTGGCAGG - Intronic
908460433 1:64343754-64343776 AAGCTGAAGCAAGCACTGGGAGG - Intergenic
908484186 1:64573984-64574006 AGTGTGAAGCAGAAAGTGAGTGG + Intronic
908511702 1:64854796-64854818 AAGGTGAAGGTGGAAGGGAGGGG - Intronic
908553565 1:65234123-65234145 AATGTGAGGCAGGGAGTGGCAGG + Intergenic
908960786 1:69694742-69694764 AAGGAGGAAGAGGAAGTGGGGGG - Intronic
909391847 1:75129027-75129049 GAGGTGAAGGAGGATGTGGTAGG + Intronic
910206755 1:84755864-84755886 AAAATGAAGGAGGAAGTGGGAGG - Intergenic
911102861 1:94107688-94107710 GAGGGGAAGGAGGAAATGGGAGG - Intronic
911702554 1:100971050-100971072 AAGCTGAAGCAGGAAGTTGGGGG - Intronic
912730324 1:112096597-112096619 ACTGAGAGGCAGGAAGTGGGCGG + Intergenic
912771876 1:112471380-112471402 CAGATGGAGCAGGAAGTGAGTGG - Intronic
915081014 1:153352705-153352727 AAGGTAAGGAAGGAAGTGGAAGG - Intergenic
915119494 1:153619994-153620016 AAGAAGAAGCAGGAAGGGTGCGG + Intronic
916517530 1:165533414-165533436 GAGCTGAAGCAAGAAGAGGGAGG + Intergenic
916611547 1:166396725-166396747 ATGGTGAAGCAGGATGGGAGGGG + Intergenic
916713494 1:167432040-167432062 TAGGTCCAGCAGGAAGTTGGCGG - Intronic
916779054 1:168003574-168003596 AGGTTGAGGTAGGAAGTGGGAGG + Intronic
917598307 1:176551896-176551918 AAGGTGGAGGTGGAAGTTGGAGG + Intronic
917752604 1:178067271-178067293 AAGGTGGAGAAGGAAGAGAGAGG + Intergenic
917865568 1:179191002-179191024 AAGGGGAAGTGGGAAGTGGCTGG - Intronic
918069470 1:181124455-181124477 AAGGGGAAGCAGGGAAGGGGAGG - Intergenic
918105968 1:181415492-181415514 AAGGAGTAGAAGGAGGTGGGAGG + Intronic
918188509 1:182148918-182148940 AGAGTGAAGCAGGAATAGGGAGG - Intergenic
918200912 1:182266100-182266122 AAGGTGAAGCAAGACAAGGGTGG + Intergenic
918263901 1:182822300-182822322 AAGGTAAAGAAAGAAGTGGCTGG - Intronic
918434296 1:184495558-184495580 ATGGTGATGCTGGTAGTGGGGGG - Intronic
919345314 1:196368772-196368794 AATGTGAAGGAGGAAGTAGTAGG - Intronic
919761324 1:201099926-201099948 AAGGTGTGGCAGGATCTGGGAGG + Intronic
919866013 1:201783554-201783576 GGGGTGAAGCAGGAAGGGAGAGG - Exonic
920068515 1:203286278-203286300 AAGGTGAACCTGGGACTGGGAGG + Intergenic
920203215 1:204273478-204273500 AAGGTGACCCAGGAAGAGAGTGG - Intronic
920239118 1:204531098-204531120 TACATGAAGCAGGGAGTGGGTGG + Intronic
920958843 1:210645956-210645978 AGGGTGAAGCAGCAACAGGGAGG - Intronic
922520100 1:226242790-226242812 GAGGAGAAGGAGGAAGTGGAGGG - Intronic
923436943 1:233976083-233976105 AAGGCGAAGGAGGAGGAGGGAGG + Intronic
924800490 1:247326563-247326585 TGGGTTATGCAGGAAGTGGGGGG - Intronic
1064007783 10:11712237-11712259 AAGGGGAAGCAGGAATTTCGTGG - Intergenic
1066608286 10:37206183-37206205 ATTGTGAGGCATGAAGTGGGAGG + Intronic
1067902330 10:50255238-50255260 AAGAAGAAGTAGGAAGGGGGAGG + Intergenic
1068285172 10:54924142-54924164 ATGGTGAAGCAGGAAGTGGGGGG + Intronic
1069547199 10:69337235-69337257 AAGGTGAAGCCCCAAATGGGAGG + Intronic
1069705941 10:70459057-70459079 AGGGTGAAGCAGTGGGTGGGCGG - Intergenic
1069718477 10:70535433-70535455 AGGGGGAAGGAGGAAGCGGGGGG - Intronic
1069729823 10:70603345-70603367 TAGGTTGAGCAGGAAGTGGATGG - Intergenic
1069777753 10:70936699-70936721 GAGGTGAGGCAGGAAGGAGGCGG - Intergenic
1069806881 10:71131802-71131824 AAGGTCATACAGCAAGTGGGTGG + Intergenic
1069874421 10:71552979-71553001 AAGCTGAAGCTGGGAGTGGGGGG - Intronic
1070234742 10:74611647-74611669 AGGGGGAGGCAGGAAGTGGGTGG - Intronic
1070498176 10:77044414-77044436 AAGCTGAGGCAGGAAGTTTGAGG + Intronic
1071002972 10:80852124-80852146 AAGGGAAAGCAGGCAGTGAGAGG + Intergenic
1071464954 10:85931194-85931216 AAGGAGAAGGAGGAAAGGGGAGG - Intronic
1071718445 10:88120006-88120028 AGGGGGAAGCAGGAAGGAGGGGG + Intergenic
1071718513 10:88120213-88120235 AAAGGGAAGCAGGAAGGCGGGGG + Intergenic
1072022532 10:91417077-91417099 AAGATGAATGAGGAAGTAGGTGG + Intronic
1072561522 10:96580242-96580264 AAGATGAAGCAGAAAAGGGGAGG - Intronic
1072903527 10:99430447-99430469 AAGGTCAACCTGGGAGTGGGAGG - Exonic
1072934864 10:99702390-99702412 AAGGTGAAGCGGGAGGAGGTAGG + Intronic
1073442181 10:103558802-103558824 GAGGTGAAGGAGGAAGTGGGGGG - Intronic
1073537566 10:104291566-104291588 AAGGGGAAGGAGGAAGCGCGCGG - Intronic
1073592116 10:104767599-104767621 AAGGGGAAGGGGGAAGGGGGAGG - Intronic
1073778945 10:106815845-106815867 AAGTGCAAGGAGGAAGTGGGAGG + Intronic
1073791211 10:106942288-106942310 AAAGGGAAGCCGGAGGTGGGAGG - Intronic
1074049261 10:109867489-109867511 AAAGCTAAGCAGGAAGTGGATGG + Intronic
1074167934 10:110902428-110902450 AAGGTGAATCACTGAGTGGGTGG - Intronic
1074322573 10:112416663-112416685 AAATTGGGGCAGGAAGTGGGAGG + Intronic
1075123607 10:119682180-119682202 TAGGTGGATCAGGACGTGGGAGG - Intergenic
1075155729 10:119974542-119974564 AAGGAGCAGCAGGGAGTTGGAGG + Intergenic
1075279761 10:121129483-121129505 AAACTGAAGCAGGAGTTGGGAGG + Intergenic
1075330264 10:121568954-121568976 AAGGTTAAGCAGGAATGGAGAGG - Intronic
1075434178 10:122420475-122420497 AATATGAAGCAGGAAGTGGGTGG - Intronic
1075923948 10:126235687-126235709 AATCTGGAGCAGAAAGTGGGAGG - Intronic
1077104756 11:837340-837362 CAGCTGCAGCAGGAGGTGGGTGG + Exonic
1077203215 11:1324502-1324524 AAGGAGAAGGAGGCAGTGGAAGG + Intergenic
1078077529 11:8175323-8175345 GAGCTGAAGAAAGAAGTGGGAGG + Intergenic
1078290601 11:10006716-10006738 AAGCTCCAGGAGGAAGTGGGAGG - Intronic
1078414579 11:11155013-11155035 AAGGAGAAGCAGAGAGTGGTGGG + Intergenic
1078787485 11:14509218-14509240 GAGGTGAAGAAGATAGTGGGAGG - Intronic
1079557717 11:21781526-21781548 AAGGCAAAGCAGGAATTTGGAGG + Intergenic
1080237903 11:30092878-30092900 AAGGAGAAGGAGGAAGGAGGAGG - Intergenic
1080415654 11:32067749-32067771 AAGGTCATGCAGCAAGTGTGGGG - Intronic
1080742703 11:35080913-35080935 AGGCTGAAGCAGTAAGTGAGGGG - Intergenic
1080804339 11:35638499-35638521 AGGGAGAGGCAGGAACTGGGAGG + Intergenic
1081620291 11:44615269-44615291 CAGCTGAAGCAGGAGATGGGCGG + Exonic
1082937774 11:58672276-58672298 AAGGTGAAGCAGGGACTGGAAGG - Intronic
1083068299 11:59948572-59948594 AAGGAGAAGGTGTAAGTGGGAGG - Intergenic
1083621943 11:64053582-64053604 GAGTGGGAGCAGGAAGTGGGAGG + Intronic
1083804723 11:65066945-65066967 TGGCTGAAGCAGGAGGTGGGAGG - Intronic
1084735341 11:71101842-71101864 AAGGGGAAGCCGGAGTTGGGGGG + Intronic
1084742780 11:71150130-71150152 AAGGGGAAGGAGGGAGAGGGAGG + Intronic
1085450258 11:76627698-76627720 CACGTGAATGAGGAAGTGGGTGG - Intergenic
1085807658 11:79651052-79651074 AAGGAGAAGAAGGAAGATGGAGG - Intergenic
1085898350 11:80666681-80666703 AAGGTGGAGCTGGAGATGGGAGG - Intergenic
1087864394 11:103206188-103206210 AAGGTGTAACAGAAAGTGAGGGG + Intronic
1087940724 11:104093753-104093775 AAGGAGAAGGAGAAGGTGGGTGG - Intronic
1088813490 11:113406739-113406761 CAGGGGAAGCAGGAAGCTGGTGG - Intergenic
1089295193 11:117463163-117463185 AAGGTGAAGCAGGAAGGCTATGG + Intronic
1089338382 11:117741300-117741322 AATGTGGAGAATGAAGTGGGAGG - Intronic
1089538111 11:119173045-119173067 AAGGAGAAGCAGGGTGAGGGAGG + Intronic
1089597232 11:119588366-119588388 AACCTGGAGCAGGAAGTGGAAGG - Intergenic
1089671795 11:120062050-120062072 GAGGGGCAGCAGGAAGTGGTGGG + Intergenic
1091011527 11:132005754-132005776 CAGGTGAAACAGAAAATGGGAGG - Intronic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1091812356 12:3409940-3409962 AGGGTGTAGCAGCAACTGGGAGG + Intronic
1091929908 12:4387418-4387440 AAAGTTAAGCAGAAAGTGTGAGG - Intergenic
1092244046 12:6853051-6853073 AACGTGAAGCATGGTGTGGGAGG - Intronic
1092641439 12:10515160-10515182 GAGGACAAGCAGGAATTGGGGGG - Intronic
1092744372 12:11659829-11659851 GAGGTGAGGAAGGAAGAGGGAGG + Intronic
1092749368 12:11704289-11704311 AAGGAGAAGAAGGAAGTGGAGGG + Intronic
1092760284 12:11804414-11804436 AAGGTGATGGAGGATGAGGGTGG - Intronic
1093085913 12:14866995-14867017 CAGGGGAAGCTGGAACTGGGTGG - Intronic
1094196957 12:27759801-27759823 TATTTGAAGCAGGGAGTGGGGGG - Intergenic
1094481412 12:30885349-30885371 AGGGTGTAGCAGCAACTGGGAGG - Intergenic
1096072351 12:48782412-48782434 GAGGAGGAGCAGGAGGTGGGAGG - Intronic
1096095488 12:48932765-48932787 GGGGTGAAGGTGGAAGTGGGGGG + Intronic
1096274837 12:50197560-50197582 ACTGTGAATCATGAAGTGGGTGG - Intronic
1096695212 12:53344627-53344649 AAGCTGAGGCAGGATTTGGGGGG + Intronic
1096883788 12:54696673-54696695 ATGGTGAAGCAGAAAGAGAGTGG + Intergenic
1098495425 12:71129550-71129572 AAGGTGAAGCAGGGAGTGGAAGG - Intronic
1099335580 12:81352464-81352486 AAAGTGAGGCAGGCAGTGGGAGG - Intronic
1099424858 12:82511029-82511051 AAGATGAAGGAGGAAGATGGAGG - Intergenic
1099481751 12:83175921-83175943 AAGGTAAAACAGGAAATGGGAGG + Intergenic
1100484718 12:95014247-95014269 AAAATGGAGCAGGAAGTTGGAGG - Intergenic
1100642665 12:96497337-96497359 AAGGAGAAGAAGAAAGTTGGAGG + Intronic
1100745305 12:97639211-97639233 AAGGTTAATCAGTAAGTGGTAGG - Intergenic
1101169297 12:102072480-102072502 AAATTGATGCATGAAGTGGGTGG - Intergenic
1101966550 12:109286161-109286183 AAAGTGGAGCAGGAAGTTAGAGG - Intronic
1102021849 12:109688567-109688589 AAGTGGTAGCAGGGAGTGGGAGG - Intergenic
1102394226 12:112574127-112574149 AAAGTGAAGGAGGGAGGGGGTGG + Intronic
1102510282 12:113410451-113410473 AGGGTTGAGCAGGAAGGGGGTGG + Intronic
1102538393 12:113599671-113599693 AAGTTGGAGCTGGAAGGGGGAGG + Intergenic
1103524763 12:121560461-121560483 AGGCTGATGCAGGAGGTGGGTGG + Intronic
1103936008 12:124477088-124477110 AAGGAGGAGGGGGAAGTGGGGGG + Intronic
1104300244 12:127558412-127558434 AAGGTCAAACAGGCAGTAGGAGG + Intergenic
1104722674 12:131053996-131054018 GAGGGGAAGCAGAAACTGGGAGG - Intronic
1105429956 13:20327276-20327298 ATGGTTAAGCAGGGAGCGGGGGG - Intergenic
1106747367 13:32719536-32719558 ATGGTGGGGCAGGGAGTGGGGGG - Intronic
1106818884 13:33441006-33441028 GAGGTGGAGGAGGAGGTGGGAGG - Intergenic
1106832614 13:33601714-33601736 GAGGAGGAGCAGGAAGTGTGGGG - Intergenic
1107388977 13:39943522-39943544 AGGGTGAGGGAGGAAGTGGAAGG + Intergenic
1107683695 13:42875823-42875845 AAGGTGAAGCAGGGAAAGGAAGG + Intergenic
1107717315 13:43213908-43213930 ACGGGGAAGCAGGAGGTGTGGGG - Exonic
1108514758 13:51190353-51190375 CTGGTGAAACTGGAAGTGGGTGG + Intergenic
1110832845 13:80051554-80051576 AAAGGGAAGCAGGAGGTGAGAGG - Intergenic
1111351493 13:87036878-87036900 AAGGTGAAGCAGGGACAGGAAGG - Intergenic
1111689734 13:91548657-91548679 AAGGAGAAGAACGAAGTTGGAGG + Intronic
1111814014 13:93127916-93127938 AATGTGAATAAGAAAGTGGGGGG - Intergenic
1112215412 13:97425876-97425898 AAGGTGAAGCAGGGACAGGAAGG - Intergenic
1112530208 13:100194284-100194306 GAGGTTAAGCAAGACGTGGGAGG + Intronic
1112972972 13:105283664-105283686 AAGCTGCAGCAGAAAGTGTGTGG + Intergenic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113240288 13:108329094-108329116 AGGGTGGATCAGGCAGTGGGTGG - Intergenic
1113373586 13:109744071-109744093 AAGGTTAAGTAGGAAGAGAGGGG + Intergenic
1113923319 13:113926904-113926926 AAGCTGGAGAAGGATGTGGGAGG - Intergenic
1113950267 13:114067524-114067546 AAGGGGCAGGAGGAAGTTGGTGG - Intronic
1114201220 14:20522572-20522594 AAGGAGAAGGAGGAGGAGGGAGG + Intergenic
1114614842 14:24062852-24062874 AAGGAGGAGCAGGGAGCGGGGGG - Intronic
1115500339 14:34043858-34043880 TAGGTGGAGCAGGAAGTTGGGGG + Intronic
1115806792 14:37060969-37060991 AAACTGAAGCTGGTAGTGGGTGG + Intronic
1116842578 14:49834582-49834604 AGGCTGAGGCAGGAGGTGGGAGG - Intronic
1116866210 14:50033734-50033756 CAGGTAAAGTAGGCAGTGGGAGG + Intergenic
1117651459 14:57910720-57910742 AAGGAGAAGCACAAAGTTGGAGG - Intronic
1117982512 14:61356129-61356151 AGGGTGAAAGAGGAAGTGGAGGG + Intronic
1118254227 14:64191090-64191112 AAGGTGAATAAAGAATTGGGAGG + Intronic
1120222139 14:81746724-81746746 AAGGAAAAGCAGAAAGGGGGTGG - Intergenic
1120502593 14:85315268-85315290 AAAGTAAAGCAAAAAGTGGGTGG - Intergenic
1120754473 14:88229353-88229375 AAGGAGAACCAGGTAGTGTGAGG - Intronic
1120927611 14:89813631-89813653 AAGGTGGGGCAGGGGGTGGGAGG - Intronic
1120948060 14:90016408-90016430 AAGCTGAAGGAGGACTTGGGAGG - Intronic
1121841620 14:97139067-97139089 AAGGTAGAGCAGGAAGTCAGGGG + Intergenic
1122107319 14:99468274-99468296 GAGGTGCAGGAGGAAGTGGCTGG - Intronic
1122552766 14:102558917-102558939 AAAAAGAAGCAGGCAGTGGGTGG - Intergenic
1122949470 14:105033718-105033740 AAGGGGAAGGAGGAACAGGGTGG - Intergenic
1122992603 14:105244502-105244524 AGGGTGGAGGAGGAAGTGGTGGG + Intronic
1202844535 14_GL000009v2_random:156042-156064 AAGAAGAAGCAGGAAGCTGGGGG - Intergenic
1202913926 14_GL000194v1_random:146283-146305 AAGAAGAAGCAGGAAGCTGGGGG - Intergenic
1202878728 14_KI270722v1_random:36419-36441 AAGAAGAAGCAGGAAGCTGGGGG + Intergenic
1123826362 15:24086287-24086309 AAGGTGAAGCAGTTTGTGGCAGG - Intergenic
1127237326 15:57068713-57068735 AAGGTGAAGCTTGAAGTAGGTGG + Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128504121 15:68254343-68254365 AGAGTGAAGCTGCAAGTGGGTGG - Intronic
1128862075 15:71082604-71082626 AAGGTGAAGCAGGAAGCCCGTGG + Intergenic
1129169634 15:73799726-73799748 AGGTTGAAGCAGGAAGTCAGGGG - Intergenic
1129384029 15:75185816-75185838 AAGGTAGGGAAGGAAGTGGGAGG + Intergenic
1129609050 15:77038593-77038615 GATGTGAGGCAGTAAGTGGGGGG + Intergenic
1129700424 15:77764724-77764746 AAGGTGATGCAAGCACTGGGGGG + Intronic
1130025537 15:80267715-80267737 AGGGTTAACCAGGCAGTGGGAGG + Intergenic
1130056820 15:80533293-80533315 AGTGTGGAGCAGGAAGTGGAAGG + Intronic
1130127972 15:81110387-81110409 AAGGGGATGGAGGGAGTGGGGGG - Intronic
1130721069 15:86386186-86386208 AGGGTGGAGGAGGAAGAGGGAGG - Intronic
1131284688 15:91047700-91047722 AAGGTGAAGGGGGAGGAGGGAGG - Intergenic
1132758958 16:1499754-1499776 AGGGTGAAGCAAGATGTGGCCGG - Intronic
1132773452 16:1578189-1578211 AAGGAGAAGACGGAAGCGGGTGG - Intronic
1132850475 16:2022854-2022876 AAGGGGGAGGAGGCAGTGGGAGG - Intergenic
1133124540 16:3637488-3637510 TAGGTGAAACAGGAAGGGAGAGG + Intronic
1133936780 16:10275797-10275819 AATGAGAGACAGGAAGTGGGAGG - Intergenic
1134066088 16:11229288-11229310 AAAGTAAAGCAGGCAGTGGCGGG - Intergenic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134228863 16:12413750-12413772 AGGCTGATGCAGGAAGTGCGGGG - Intronic
1135127694 16:19824748-19824770 AAGATGAACCAGGAAGAGGAAGG + Intronic
1135134350 16:19876590-19876612 ATGGCTGAGCAGGAAGTGGGAGG - Intronic
1135263386 16:21000372-21000394 AAGGTGGAGAAGGAAGTTGTTGG + Exonic
1135295730 16:21278009-21278031 AAGGAGGAGCAGGAAGAGGAGGG - Intronic
1135963420 16:27016402-27016424 AAGAAGAAGGAGGAAGTGGGGGG - Intergenic
1136170512 16:28486550-28486572 CAGGTGGAGCAGGGAGTGTGGGG - Intronic
1136539105 16:30918737-30918759 AAGGAGAAGAAGGAAGGAGGAGG - Intergenic
1137251580 16:46744984-46745006 AATCTGAAGGGGGAAGTGGGTGG + Intronic
1138622690 16:58224458-58224480 AAGGTCATGCAGAAAGTGGCTGG + Intergenic
1138797628 16:59989128-59989150 ACCATGAAGCAGGAACTGGGGGG - Intergenic
1139345026 16:66297255-66297277 AGGGTGCAGGAGGAAGAGGGAGG - Intergenic
1139363613 16:66419271-66419293 AAGGGGAAGGAGGAATGGGGAGG + Intergenic
1140526287 16:75625676-75625698 CAGGTGAGGCAGGAAGGGGCTGG - Intergenic
1140640946 16:76972127-76972149 AAGGTGAAGCAGCTAATCGGTGG - Intergenic
1140926082 16:79585275-79585297 AAGGGGAAGGAGGAGATGGGTGG - Intergenic
1140998814 16:80288551-80288573 AATGTGTGGCAGGAATTGGGAGG - Intergenic
1141293927 16:82749065-82749087 AAGGTGAATCTGGAATTGTGGGG + Intronic
1141514594 16:84535193-84535215 AAGGAGAAGGAGGAAGAGGAGGG - Intronic
1141608452 16:85168821-85168843 AAGGTCAATCAGGACGCGGGAGG - Intergenic
1141766665 16:86063690-86063712 AAGGAGAGGGAGGAAGAGGGAGG + Intergenic
1143150157 17:4802555-4802577 ATGGAGAAGCAGGAGGTGGTTGG + Intergenic
1143262606 17:5611185-5611207 AAGCTCAAGGAGGAAGTGGCCGG + Intronic
1143391364 17:6561092-6561114 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143579731 17:7818491-7818513 AGGGTGAAGCAGGAAGAGTTTGG + Intronic
1143620803 17:8079432-8079454 AAAGTGCAGCAGGCAGAGGGGGG + Exonic
1143789327 17:9281169-9281191 AAGGCGATGCAGGAAGTGACAGG + Intronic
1144781280 17:17809788-17809810 AAGGTGAAGCTGGACGGGGTGGG + Intronic
1144970755 17:19107990-19108012 ATGGTCAAGCAGCAAGTCGGTGG + Intergenic
1144991057 17:19234152-19234174 ATGGTCAAGCAGCAAGTCGGTGG + Intronic
1145775377 17:27524256-27524278 GAGGTCAAGCAGGATGAGGGTGG + Intronic
1146472857 17:33138600-33138622 AAGGTGGGGCAGGAAGGGGCTGG - Intronic
1146615937 17:34357489-34357511 AATGTGAAGCAGCAAGTAGATGG - Exonic
1146901570 17:36592413-36592435 AAGGGGAAGCCGGAGGTCGGGGG + Intronic
1147503313 17:40987383-40987405 AAGGCAAAGAAGGAAGTGGAGGG + Intergenic
1147770835 17:42866888-42866910 AAGGTGCAAGAGGAAGTGGGGGG - Intergenic
1148191426 17:45681328-45681350 AGGGTGGAGCAGGATGAGGGTGG - Intergenic
1148358946 17:46996082-46996104 AGTGGGAAGCAGGGAGTGGGAGG - Intronic
1150294372 17:63999993-64000015 CAGGAGAAGCAGGGACTGGGTGG + Intronic
1150597634 17:66620389-66620411 AAGGGGAAGCAATAAGTGGGAGG + Intronic
1151466425 17:74288734-74288756 AAGGAGTTGCAGAAAGTGGGTGG + Intronic
1151734852 17:75932908-75932930 AATGTGAAGTAGAAAGTGGGGGG + Intronic
1152457388 17:80424071-80424093 AAGGTGAGGTAGGAAGAGTGTGG - Intronic
1152577267 17:81148352-81148374 AGGGTGGAGGAGCAAGTGGGAGG - Intronic
1152743329 17:82028132-82028154 AAGCTGGAGCAGCAGGTGGGTGG + Exonic
1153568994 18:6449425-6449447 GAGCAGAGGCAGGAAGTGGGTGG - Intergenic
1153680643 18:7497352-7497374 GAGGAGAAGGAGGAAGGGGGAGG + Intergenic
1153921454 18:9793875-9793897 AAAATGAAGCAGGAAGTGAGTGG - Intronic
1154500534 18:14994331-14994353 AAGCTGAAGGAGGAAGTCTGTGG - Intergenic
1155099583 18:22596142-22596164 AAGAAGCAGCAAGAAGTGGGTGG - Intergenic
1155292300 18:24354404-24354426 AGGGTGAAGCAGGAACACGGGGG + Intronic
1155381364 18:25226044-25226066 AAGATGATGCAGGCAGTAGGAGG - Exonic
1156244783 18:35287941-35287963 AAGGTGGAGCTTGCAGTGGGTGG - Intronic
1156789976 18:40959795-40959817 AGAGTGAAGCAGGAATTGGCCGG - Intergenic
1157381950 18:47226495-47226517 AAGGAGAAGCTGGAATTGAGTGG - Intronic
1157530459 18:48416077-48416099 AAGGTTATGCAGGATGGGGGTGG + Intergenic
1157564741 18:48672453-48672475 TAGGTGAATCTGGAAGTAGGAGG - Intronic
1158411379 18:57208765-57208787 GAGGTGAGGCAGGAAGGGGTTGG + Intergenic
1158540974 18:58354367-58354389 AAGGACAAGAAGGAAGTGGAAGG - Intronic
1158596750 18:58823294-58823316 AGGGTGAAAAAGGAGGTGGGAGG + Intergenic
1158835881 18:61331726-61331748 AAGGAGAAGGAGGAAGAGGGAGG - Intergenic
1159115373 18:64107333-64107355 AATGTGAAGGAGTAAGGGGGAGG + Intergenic
1159593582 18:70361030-70361052 AAGGTGAAGCAGGTACAGGAAGG + Intergenic
1159960410 18:74551141-74551163 AAGGTGAAGCAGGAACAGGCAGG - Intronic
1160788509 19:912518-912540 GGGGTGGAGCAGGGAGTGGGGGG + Intronic
1160811540 19:1015025-1015047 AAGGTGAGGCAGGAAGCAGCAGG - Intronic
1160950836 19:1666515-1666537 AAGGAGAAGAAGGAAGAAGGAGG - Intergenic
1161458181 19:4380402-4380424 AGGGTGAGGCAGGAAGGAGGTGG + Intronic
1162781902 19:13011021-13011043 AACGTGGAGCGGGAAGAGGGGGG - Intronic
1162934394 19:13974190-13974212 TGAGTGAAGCAGGAAGGGGGTGG + Intronic
1162959339 19:14117146-14117168 GAGGTGAGTGAGGAAGTGGGGGG + Intronic
1162991872 19:14308261-14308283 GAGGTGAGGCCTGAAGTGGGAGG + Intergenic
1163398165 19:17076047-17076069 ACGGTGAAGGAGAAAGTGGATGG + Intronic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1163609316 19:18292824-18292846 AAGCTGAAGCAGGAAGGGGAGGG - Intergenic
1165204876 19:34174461-34174483 AAGGTGAAGAGGGAAATGTGGGG - Intronic
1166329350 19:42069556-42069578 AAGGTGAAAACGGAAGGGGGGGG + Intronic
1166976978 19:46610481-46610503 GAGGGGAAGCAGGGGGTGGGGGG - Exonic
1167083538 19:47293567-47293589 AAAATGAAGGAGGAAGTGGCTGG - Intronic
1167643023 19:50692530-50692552 AAGCAGAAGCAGGAACAGGGTGG - Intronic
1167808463 19:51807200-51807222 AAGAGATAGCAGGAAGTGGGGGG + Intronic
1168006627 19:53495170-53495192 AAGGTGATGCATGGAGTGGCAGG + Exonic
1168433168 19:56297306-56297328 CAGGTGAATTATGAAGTGGGTGG - Intronic
1202654351 1_KI270708v1_random:5453-5475 AAGAAGAAGCAGGAAGCTGGGGG + Intergenic
924963423 2:55373-55395 AAGGGAAAGCAAGAAGGGGGTGG + Intergenic
925979489 2:9165332-9165354 AAGGTGAACCAGGCAGTCGGGGG + Intergenic
926190709 2:10725435-10725457 TAGGTGAATGATGAAGTGGGAGG + Intronic
926312749 2:11686348-11686370 AGGGGGAACCAGAAAGTGGGTGG + Intronic
926918402 2:17915455-17915477 AAGGTCAAGCAGGGATTGGGGGG - Intronic
927098421 2:19766345-19766367 AGGGTAAAGCAGGGAGTGGTGGG - Intergenic
927273380 2:21238736-21238758 AAAGTGAAGCAAAAAGTGAGGGG - Intergenic
928105857 2:28470155-28470177 GAGGAGGAGGAGGAAGTGGGAGG + Intronic
929197080 2:39196087-39196109 AGGGTGGATCAGGCAGTGGGTGG - Intronic
929288516 2:40163468-40163490 AGGGTGAATGAGGAAGAGGGAGG + Intronic
929301025 2:40303838-40303860 AACGTGAAGCAGGAAAAGGAAGG + Intronic
929819529 2:45262077-45262099 AGGGTGTCACAGGAAGTGGGTGG + Intergenic
930049829 2:47206373-47206395 AACTTGAAGCAGGAAGTGAATGG - Intergenic
930570317 2:53077820-53077842 AAGGTGGAGCAGCAACTGGGAGG - Intergenic
930820524 2:55642065-55642087 CAGGTGGATCAGGAAGTGGGGGG - Intronic
931388212 2:61816287-61816309 AATGTGACCCAGGCAGTGGGAGG - Intergenic
933035698 2:77394773-77394795 AAGGTGAAGCAGGAACACGAAGG + Intronic
933493009 2:83012342-83012364 AAGGAGAAGAAGAAAGTTGGAGG + Intergenic
933649658 2:84840409-84840431 AAGGTGGAGCAGGATGTCAGAGG - Intronic
933728619 2:85440292-85440314 AAGGTTACGCAGGAAGTGAGTGG - Intergenic
934104288 2:88681709-88681731 AAGCTACAGGAGGAAGTGGGAGG - Intergenic
934763465 2:96868583-96868605 AGAGGGAGGCAGGAAGTGGGTGG + Intronic
935135341 2:100295622-100295644 AAGGTGAACAAGGAGGTGGTGGG + Intronic
935684760 2:105673480-105673502 AAAGTGAAGCGGAAAGTGGATGG - Intergenic
935699354 2:105797639-105797661 ACAGTGAGGCAGGAAGTGGCTGG + Intronic
936590546 2:113799754-113799776 ACAAAGAAGCAGGAAGTGGGGGG - Intergenic
936912729 2:117609535-117609557 AGGCTGAGGCAGGAGGTGGGAGG + Intergenic
937102633 2:119283388-119283410 AAGGCAAAGCAGGAAGGAGGAGG - Intergenic
937999870 2:127724423-127724445 AGGGTAGAGAAGGAAGTGGGTGG - Exonic
938064519 2:128273803-128273825 AAACAGAAGCAGGAAGAGGGCGG + Intronic
938149345 2:128868672-128868694 CAGGTGAAGGTAGAAGTGGGTGG - Intergenic
938444497 2:131366827-131366849 AAGGCCCTGCAGGAAGTGGGAGG - Intergenic
938499737 2:131824658-131824680 AAGCTGAAGGAGGAAGTCTGTGG - Intergenic
938939956 2:136161484-136161506 TAGTTGAAGTAGGAGGTGGGGGG + Intergenic
939065878 2:137482840-137482862 GAGGAAAGGCAGGAAGTGGGTGG + Intronic
939135376 2:138287309-138287331 GAGGGGAAGGAGGTAGTGGGAGG + Intergenic
939582258 2:143964646-143964668 AAGGAGAAGATGGAAGTGGAGGG + Intronic
939858557 2:147390657-147390679 AAGGTGAAGCTGGAAGCTGCAGG + Intergenic
940823561 2:158385015-158385037 ATGGTGAGCAAGGAAGTGGGGGG - Intronic
942524801 2:176841779-176841801 AAGGTGGAGAAGGAAGGAGGAGG - Intergenic
942991840 2:182211455-182211477 AAGGAGAAGCACAAAGTTGGAGG - Intronic
943291314 2:186075562-186075584 AAGGAGAAGGAGGAAGAGGAGGG - Intergenic
943321937 2:186455366-186455388 AAGGTGAATAAAGAAGAGGGAGG - Intergenic
943359665 2:186902107-186902129 AAGCTGAAGCAGGGGGTGGGAGG - Intergenic
943360277 2:186911116-186911138 TACGTGATGCAGGAAGTGGCAGG + Intergenic
943653038 2:190477819-190477841 TTTGTGAAGCAGGGAGTGGGAGG + Intronic
943727878 2:191270436-191270458 AGGGTGATGCAGGGAGGGGGAGG + Intronic
944006948 2:194921111-194921133 AAGGTGAAGCAGGGACAGGAAGG - Intergenic
944215225 2:197247891-197247913 AAGGTGAAGCGGGAAATGGCTGG + Intronic
944227639 2:197364188-197364210 AAGGTGGGACAGGAAGAGGGTGG - Intergenic
945235635 2:207629010-207629032 AGGCTGAAGAAGGAGGTGGGGGG - Intergenic
945307686 2:208274405-208274427 AAGGTGACAAAGGAAGTGGGAGG + Intronic
945347242 2:208732545-208732567 GAAGAGAAGGAGGAAGTGGGTGG + Intronic
946018191 2:216620918-216620940 AAGCTGCAGCAGGAAGCAGGGGG + Intergenic
946071492 2:217037955-217037977 AAGATAAAGGAGAAAGTGGGTGG - Intergenic
946322605 2:218962391-218962413 AAGATGGAGGCGGAAGTGGGGGG - Intergenic
947722314 2:232377732-232377754 AAGATGAAGCAGGAGGTAGAAGG + Intergenic
947726211 2:232402536-232402558 AAGATGAAGCAGGAGGTAGAGGG + Intergenic
947837452 2:233185867-233185889 AAAATGAAGAAGGAAGTGAGGGG + Exonic
948417261 2:237819401-237819423 GTGGAGAACCAGGAAGTGGGAGG + Intronic
948681686 2:239639479-239639501 AAGGTGAAGCAGGGACAGGAAGG - Intergenic
1168838195 20:891693-891715 GAGATGAAGGAGGAAGTGGCTGG - Intronic
1169467777 20:5856694-5856716 AAGGTGAACCAGGGAGTAGTGGG - Intronic
1169485799 20:6030840-6030862 GAGGTGGAGAAGGATGTGGGAGG - Intronic
1169825629 20:9765654-9765676 AGGGAGAAGCAGGGAGAGGGCGG - Intronic
1170429797 20:16265534-16265556 AAGTTGCAGCAGGATGCGGGTGG - Intergenic
1170432344 20:16287948-16287970 TGGTTGAAGCAGAAAGTGGGAGG + Intronic
1170466171 20:16624236-16624258 GAGGTGGGGCTGGAAGTGGGAGG + Intergenic
1170914350 20:20608227-20608249 AGAGTGAAGTAGGAAGTGGTTGG - Intronic
1171042294 20:21776659-21776681 AAGCTGAAGGAAGAAGTGGATGG - Intergenic
1171474522 20:25397836-25397858 AAGGGGAAGGGGGAAGGGGGAGG + Intergenic
1171774231 20:29350539-29350561 AAGGTGAACTAGGAGCTGGGAGG + Intergenic
1172014210 20:31863347-31863369 AAGGGGAAGGAGGGAGAGGGTGG + Intronic
1172227543 20:33315104-33315126 AAGGTGACACAGGTAGTGAGTGG - Intergenic
1173646756 20:44638110-44638132 AGGGTCAAGCAGGGAGTGAGTGG - Intronic
1173891504 20:46514918-46514940 CAGGAGAAGTAGGAAGTGAGAGG + Intergenic
1174109652 20:48189869-48189891 CAGGTGGGGCGGGAAGTGGGTGG + Intergenic
1174761162 20:53208534-53208556 CAAGTCAAGCAGGATGTGGGTGG - Intronic
1175586101 20:60141144-60141166 AAGGTGGAGCAGGAAGCTGCTGG + Intergenic
1175834478 20:61984881-61984903 AAGGTGCAGCAGGACTAGGGAGG + Intronic
1175918807 20:62440363-62440385 AAGGTGAGGGAGGAAGGGCGGGG - Intergenic
1175935598 20:62512546-62512568 AAGGAGCAGCAGGGGGTGGGTGG - Intergenic
1175996073 20:62812891-62812913 ACGGGGACCCAGGAAGTGGGCGG + Exonic
1176097748 20:63352102-63352124 GAGGTGGAGCAGGAGGTGTGTGG - Intronic
1176633281 21:9160958-9160980 AAGAAGAAGCAGGAAGCTGGGGG - Intergenic
1178498316 21:33105307-33105329 CAGGTGACTCAGGAAATGGGAGG - Intergenic
1178932885 21:36834940-36834962 AATGAGCAGCAGGAAGTGTGGGG + Intronic
1180389144 22:12208972-12208994 AAGAAGAAGCAGGAAGCTGGGGG - Intergenic
1180416797 22:12725499-12725521 AAGAAGAAGCAGGAAGCTGGGGG + Intergenic
1181009699 22:20033057-20033079 GAGGTGAAGCTGGCAGGGGGAGG + Intronic
1181639620 22:24189746-24189768 AGGGTGAGGCTGGAAGTTGGGGG + Intergenic
1182051831 22:27318157-27318179 GAGGAGAAGCAGGAGGCGGGTGG + Intergenic
1182093372 22:27610858-27610880 AATGTGAAGCAGAAAGGGAGGGG + Intergenic
1182330645 22:29549419-29549441 AGTGTGGAGCAGGATGTGGGTGG - Intronic
1182793175 22:32970258-32970280 AAGGTTACTCAGGAAGTGGTGGG + Intronic
1182871436 22:33651038-33651060 AAGGAGTACCAGGAAGTGGAGGG + Intronic
1183023080 22:35043030-35043052 AAGGTGGTGTGGGAAGTGGGGGG + Intergenic
1183201502 22:36388079-36388101 TGGGTGTAGCAGGAAGGGGGCGG - Intergenic
1183385433 22:37511460-37511482 AAGGAGAAGGAGGAGGCGGGAGG + Intronic
1183771427 22:39929493-39929515 GAGGAGAGGCAGGAAGTAGGTGG - Intronic
1184309837 22:43634008-43634030 GAGGAGAAGCAGGAAGTGAGGGG + Intronic
1184386624 22:44180234-44180256 AGGGTGAAGGAGGGAGTGGGTGG - Intronic
1184606252 22:45576404-45576426 AAGGTGAGGAAGGAAGCCGGCGG - Intronic
1184750368 22:46482547-46482569 AAGGTCACAGAGGAAGTGGGTGG + Intronic
1185150180 22:49159787-49159809 ATGGTGAAGCAGGAAGGATGGGG - Intergenic
1185285327 22:49997392-49997414 CAGGTGCACCTGGAAGTGGGCGG + Exonic
1185361940 22:50413673-50413695 AAGGGGAAGAAGGAAGAGGAGGG - Intronic
949360914 3:3231291-3231313 AAGGTGAAGCAGAAGCTGGCAGG + Intergenic
949465387 3:4338161-4338183 AAGGTGAAGCAGGCGGAGGATGG + Intronic
949495562 3:4628453-4628475 AAGGTGAAACAGGATGAGAGAGG - Intronic
949803198 3:7925965-7925987 AAAGTCAAGGAGTAAGTGGGTGG + Intergenic
949854019 3:8443534-8443556 AAGGTGGAGCAGGAAGAGGCAGG + Intergenic
950208330 3:11096945-11096967 AAGGTGTTGCAGGAAGGAGGAGG + Intergenic
950445645 3:13035991-13036013 AAGGTGAGGAAGGGAGTGAGTGG + Intronic
950580028 3:13855987-13856009 AAGGTGAATGAGAAGGTGGGTGG - Intronic
950828202 3:15847776-15847798 AAGGTGAAGCTGGAGGCAGGTGG - Intronic
950849105 3:16045161-16045183 CAGGTGAAGAAGGCAGTGGCTGG + Intergenic
951543240 3:23802802-23802824 AAGGTCATGCAGTAAGTTGGTGG - Intergenic
952408390 3:33025933-33025955 AGGGTGCAGCAGGAAGGAGGTGG + Intronic
953557440 3:43957879-43957901 AAGGTGAAGGAGGGAGAGTGGGG + Intergenic
953591945 3:44266052-44266074 AAGGTCAAACAGGAAGTGCAAGG - Intronic
954384447 3:50236905-50236927 AAGGAGAAGGAGGGAGTGGGTGG - Intronic
954995036 3:54873354-54873376 AAAGTGAAGAAGGAAGAGGAAGG - Intronic
955130472 3:56161146-56161168 AAGCTGGAGCAAGAACTGGGAGG - Intronic
955725953 3:61932946-61932968 AAAGTGAAGTAGCAAGTGGGGGG - Intronic
956097644 3:65734216-65734238 AGGCTGAGGCAGGAGGTGGGAGG + Intronic
956209471 3:66788323-66788345 AAGGAAAAGATGGAAGTGGGTGG - Intergenic
956225053 3:66947861-66947883 AAAATGAAGCAGAAAGTGGAAGG - Intergenic
956423834 3:69112452-69112474 AACCTGAAGCAGAATGTGGGAGG + Intronic
958641666 3:96814051-96814073 AATGTGGAGAAGTAAGTGGGAGG + Intergenic
960705972 3:120481274-120481296 CAAGTGAAGGAGGAAGTGAGTGG + Intergenic
960854210 3:122086347-122086369 AGGATGAAACAGGAAGTGAGAGG - Intronic
960854880 3:122092659-122092681 AAGGAGCAGCAGGAAGGGGTGGG - Intronic
960865467 3:122194994-122195016 GAGGAGGAGCAGGAAGTAGGAGG - Intronic
962074962 3:132071998-132072020 ATGGTGAAACAGGAAAGGGGTGG - Intronic
962149419 3:132877205-132877227 TTGATGAAGCAGAAAGTGGGAGG - Intergenic
962171620 3:133107228-133107250 AAGATGAAGCAGGAAGTATTTGG - Intronic
962238957 3:133733947-133733969 GGGGTGAAGCAGGCAGTGGGAGG + Intergenic
962357871 3:134710245-134710267 AAGGTCAAGCTGGAAGTTTGAGG + Intronic
962467019 3:135670044-135670066 ATGGTGAGGCTGGGAGTGGGAGG - Intergenic
962858995 3:139379730-139379752 AAGGTGAGGCTGGAAAAGGGAGG - Intronic
964067099 3:152593442-152593464 AAGGGGGAGAAGGAAGAGGGAGG + Intergenic
964185723 3:153940347-153940369 AAAGAGAAGCAGGGAGTGGGTGG - Intergenic
964327547 3:155563577-155563599 AACTGGAAGCAGGAAGTTGGTGG - Intronic
964739866 3:159954031-159954053 AAGATGAAGGAGGAAATGGGGGG + Intergenic
965361973 3:167752593-167752615 AAGCTGAAGAAGAAATTGGGTGG - Intronic
965509694 3:169554826-169554848 AAGGTGAAGGAGGTAATAGGGGG + Intronic
965556049 3:170019419-170019441 AATGTGTGGGAGGAAGTGGGTGG + Intergenic
966025964 3:175282474-175282496 AAGGAGAAAGAGGAAGAGGGAGG + Intronic
966532212 3:180993627-180993649 AAGAGCAAGCAGGAAGTGGAAGG + Intergenic
966799695 3:183751366-183751388 AAGGTGAAGAACAAAGTTGGAGG - Intronic
966895108 3:184439084-184439106 AAGGAGAAGGAGAAAGGGGGAGG + Intronic
966932594 3:184685467-184685489 CAGATAAAGCAGGCAGTGGGTGG + Intergenic
967094496 3:186165640-186165662 AAGGAGGGGCAGGAAGTAGGAGG + Intronic
967297345 3:187978312-187978334 AAGGTGAAAGAGTCAGTGGGTGG + Intergenic
967489017 3:190067295-190067317 AAGGAGAAGGAAGAAGTGGGAGG + Intronic
967693635 3:192506073-192506095 AAGGTGAAGCAGGGATAGGAAGG + Intronic
968288170 3:197520160-197520182 GAGGGGAAGCAGGGAGAGGGAGG + Intronic
969286973 4:6208648-6208670 CAGGTGATGCAGGGAGTGAGCGG - Intergenic
969302823 4:6307309-6307331 AAGGAGCAGCAGGAAGGTGGTGG - Intergenic
969345086 4:6564918-6564940 AAGGCCAAGAAGGAAGAGGGAGG - Intergenic
969551277 4:7869230-7869252 AAGGGGAAGGAGGAAGGGGAAGG + Intronic
970195577 4:13547597-13547619 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
970280784 4:14452472-14452494 AAGGGGTTGCAGTAAGTGGGTGG + Intergenic
970767250 4:19564410-19564432 AATGTGAGGCAGGGAATGGGTGG - Intergenic
970916184 4:21338002-21338024 ATGGTGGAGCAGAAAGTGGAAGG - Intronic
970938322 4:21601157-21601179 AATGTGAAGAAGGAATTGAGAGG - Intronic
971090622 4:23340535-23340557 AAGGAGAAGAAGAAAGTTGGAGG + Intergenic
971205933 4:24568597-24568619 TATGTGTAGTAGGAAGTGGGTGG - Intronic
971413887 4:26404825-26404847 AAGTAGACACAGGAAGTGGGAGG - Intronic
972025892 4:34376939-34376961 AAGGAGAAGCAGAAAGTGTGAGG + Intergenic
972351835 4:38243316-38243338 GACGGGAAGTAGGAAGTGGGGGG + Intergenic
972563544 4:40249607-40249629 AGGCTGAGGCAGGAATTGGGAGG + Intergenic
973905943 4:55530931-55530953 AGACTGAAGCAGGAAGTAGGAGG + Intronic
974394000 4:61311644-61311666 AAGCTGAAGAATGAAGTAGGAGG + Intronic
974942113 4:68482104-68482126 AAGGTGAAGTGTGAAATGGGAGG + Intronic
975484758 4:74923438-74923460 AGGCTGAAGCAGGAAGTTCGAGG + Intergenic
977177069 4:93830232-93830254 AAGGGGGAGCAGAAGGTGGGCGG - Exonic
977613956 4:99066488-99066510 AAGATGAAGCAGGAATAAGGTGG + Intergenic
977821359 4:101475799-101475821 AGGGTGAGGTGGGAAGTGGGAGG + Intronic
977984237 4:103362609-103362631 AGGGTGAGGCAGGAAGTAGAAGG - Intergenic
978119872 4:105065524-105065546 AAGATGAAGAAGGAAGGGGCAGG + Intergenic
978404477 4:108364724-108364746 ATGGGGAAGCAGGAGGAGGGTGG - Intergenic
978421481 4:108537991-108538013 AAGGTCAAGAAAGAAGAGGGAGG - Intergenic
979131209 4:117047539-117047561 AAGGAGAAGCAGGAAGAGAGGGG - Intergenic
979492046 4:121339477-121339499 AAGGAAAAGTATGAAGTGGGTGG + Intronic
980433722 4:132740688-132740710 AAGATGAAGCAGAAAGTGCTGGG + Intergenic
981718734 4:147777748-147777770 AAGGTGAACCAGGAGGTGTTGGG + Intronic
982255452 4:153447057-153447079 AAGGAGAAGCAGGAGGTTGATGG - Intergenic
982485773 4:155964212-155964234 AGGTTGAGGAAGGAAGTGGGTGG + Intergenic
982726093 4:158908302-158908324 AGGGTTACGCAGGAGGTGGGTGG - Intronic
983253826 4:165376402-165376424 GAGGTGAAGCAAGAAGTGGAGGG + Intronic
983524709 4:168749178-168749200 AAGGTGAAGCAGGAGCAGGCAGG - Intronic
983759211 4:171384744-171384766 AAGGTGAAGGAGGAGGAGGGGGG - Intergenic
983922862 4:173365987-173366009 AATGTCAAGCAGGAAGGAGGAGG + Intergenic
984949000 4:184992715-184992737 AAGGTGATGCTGGAACAGGGTGG - Intergenic
985155671 4:186984842-186984864 GAGGTGAAACAGGACGAGGGAGG - Intergenic
985900039 5:2780955-2780977 AAGGTGAGGCAGGGACTAGGAGG - Intergenic
986609069 5:9548885-9548907 GAGGTGAATCAGGAAATGGATGG - Intergenic
987032852 5:13991503-13991525 AAGGAGAAGGAGGAAGAGGAGGG + Intergenic
988936831 5:36092258-36092280 GAGCTGGAGCAAGAAGTGGGAGG - Intergenic
989483726 5:41963725-41963747 AAGGAGGAGCAGGAAGAGGAAGG + Intergenic
990526483 5:56633170-56633192 AAGGAGGAGCAGGAGGAGGGAGG + Intergenic
992248266 5:74851161-74851183 AAGGTGAAGGAAGAAGAGAGAGG + Intronic
992898682 5:81270577-81270599 AGGGAGAACCAGGCAGTGGGCGG - Intergenic
993599084 5:89898223-89898245 AAAGTGAAGCAGGATTTGTGGGG - Intergenic
993602603 5:89947107-89947129 AAGGGGAAGCAGAGAGTTGGGGG - Intergenic
994155811 5:96503330-96503352 AAGGTGAAGGTGAAAGGGGGTGG + Intergenic
994625975 5:102219523-102219545 AATATGAAGCAGCAAGTGCGTGG + Intergenic
995229576 5:109743921-109743943 AGTGTGAAGCAGGAAGTGACTGG - Intronic
995454523 5:112337583-112337605 AAGGTCACACAGTAAGTGGGAGG + Intronic
996936293 5:128952606-128952628 CAGGTGAGACAGTAAGTGGGTGG + Intronic
997372893 5:133373308-133373330 GGGGTGATGCAGGAGGTGGGCGG + Intronic
997411259 5:133692739-133692761 AGGGAGCAGCAGGAAGTGAGAGG - Intergenic
997468696 5:134104610-134104632 AAGCTGAAGCAGGAGGTAGGTGG - Intergenic
997506534 5:134421993-134422015 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
997634680 5:135396592-135396614 AAGGTCAAGCAGGAGATGGCTGG - Intronic
997730582 5:136170519-136170541 AAGGAGAAGAATGAAGTCGGAGG - Intronic
999469920 5:151844964-151844986 GAGAGGAAGCAAGAAGTGGGTGG + Intronic
1000380537 5:160625151-160625173 AAGGTCACACAGTAAGTGGGAGG + Intronic
1001185098 5:169563271-169563293 AAGCTTAAAAAGGAAGTGGGAGG - Intergenic
1001196503 5:169677876-169677898 AAAGGGAAGCTGGATGTGGGAGG + Intronic
1001245614 5:170104216-170104238 TAGGGCATGCAGGAAGTGGGAGG + Intergenic
1002316919 5:178349571-178349593 AAGGTGAGGCAGGAAGCGGGAGG - Intronic
1002447036 5:179296102-179296124 ATGGTGAAGCAGGAGGATGGGGG + Intronic
1002493493 5:179596611-179596633 AAGCTGCAGCAGGAGCTGGGCGG + Exonic
1002512430 5:179731694-179731716 AAGGTTAAGCAGGAGGTGGCAGG - Intergenic
1002612927 5:180433213-180433235 AGAGTGAAGCAGGAAGTGGCAGG - Intergenic
1002716246 5:181229951-181229973 GAGGTGAGGCTGGAAGTGTGGGG + Intronic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1003264266 6:4551685-4551707 AAGGATCAGCAGGAAGTGGGAGG + Intergenic
1003404559 6:5817622-5817644 ATGGTGAAGCAGGTATTGGAGGG - Intergenic
1005591011 6:27327328-27327350 AAGGTGAAGCAGGGACACGGAGG - Intergenic
1005850211 6:29815182-29815204 AAGGGAAAGCAAGAAGTAGGGGG - Intergenic
1006535949 6:34698801-34698823 AAGGTCAATGAGGAGGTGGGAGG + Intergenic
1006710560 6:36065576-36065598 AAGATGAAGCTGGAATGGGGAGG + Intronic
1006750112 6:36371694-36371716 AAGGTCAGGGAGGCAGTGGGGGG + Intronic
1007310781 6:40944471-40944493 AAGGCCAAGAAGCAAGTGGGGGG - Intergenic
1007458223 6:41997383-41997405 AAGGTGCAGTAGGAAGCAGGTGG + Intronic
1007734743 6:43973504-43973526 CGGGTGAAGGAGGAAGTGGTAGG - Intergenic
1007848576 6:44781615-44781637 GAGGTGAACCTGGAAGTAGGGGG - Intergenic
1007939971 6:45771506-45771528 AAGCTGAAGCAGGAGGTCTGTGG - Intergenic
1008246760 6:49184687-49184709 AAGAAGAAGAAGGAGGTGGGGGG - Intergenic
1008623113 6:53291364-53291386 TAGGGGAGGAAGGAAGTGGGTGG - Intronic
1009337491 6:62510367-62510389 AAAGTGCTGAAGGAAGTGGGTGG + Intergenic
1009936482 6:70240695-70240717 AAGGTGAAGCAGGAGAAAGGGGG - Exonic
1010974711 6:82298844-82298866 AAGGTGAAGCTTGCAGTGAGCGG - Intergenic
1011484746 6:87829964-87829986 AAGGAGAAGGAGGAAGAAGGAGG - Intergenic
1011505063 6:88032594-88032616 AAGTTGAAGTATGAAGTGGCGGG + Intergenic
1012199453 6:96387242-96387264 AAGGTGATGCAGTAAATGGTGGG + Intergenic
1012305101 6:97645939-97645961 AAGGTGAAGGAGAAAGTGTCAGG + Intergenic
1012648159 6:101716023-101716045 AAGGGGAAGCAGGTAGAAGGTGG - Intronic
1013597693 6:111674754-111674776 GAGGTGAAGCAGGAATGGGCTGG + Intronic
1014177212 6:118343683-118343705 GAGGAGAAGCAGGAATTAGGTGG + Intergenic
1014398800 6:120961424-120961446 AAGGTGTTGCAGCATGTGGGTGG - Intergenic
1015018160 6:128439196-128439218 TATGTGAAGCAGGAAGGGGAAGG - Intronic
1015110352 6:129585866-129585888 AAGATGAAGCAGGAATTGAGGGG - Intronic
1017013988 6:150085135-150085157 AAGGAGAAGCAGGAAAGAGGAGG + Intergenic
1017133127 6:151124940-151124962 AAGCTGAAGGAGGAAGTTTGTGG - Intergenic
1017234276 6:152103423-152103445 CAGGTGTATCAGGAAGTGTGTGG + Intronic
1017952309 6:159146226-159146248 AAGGTGCAGAAAGTAGTGGGAGG - Intergenic
1018051640 6:160014368-160014390 TTGCTGTAGCAGGAAGTGGGAGG + Intronic
1018063784 6:160111326-160111348 GAGGAGGAGGAGGAAGTGGGGGG - Intronic
1018069302 6:160147948-160147970 AAGGTGAAGCAGGGAGGGCAAGG + Intronic
1018297503 6:162364746-162364768 AAGGGGAATCAGGAAGAGGGAGG + Intronic
1018844736 6:167547608-167547630 AAGGTGAGGAGGGAAGAGGGAGG - Intergenic
1019504099 7:1382008-1382030 AAGCAGAAGCTGGAAGTGGGGGG - Intergenic
1019775910 7:2912152-2912174 AAGGTGAGGCGGGGACTGGGAGG - Exonic
1019890658 7:3943386-3943408 ACGGAGGAGGAGGAAGTGGGGGG - Intronic
1020275889 7:6624129-6624151 CAGGTCAAGCAGGAAGTGACTGG - Exonic
1020552914 7:9629858-9629880 AAGGTGATGCAGTAAATAGGCGG - Intergenic
1020776312 7:12458366-12458388 AGTGTGAAACAGGAAGTGTGAGG - Intergenic
1020830918 7:13094439-13094461 AACAGGAAGCAGTAAGTGGGAGG - Intergenic
1021256039 7:18393535-18393557 GAGGTGAGGCAGGGAGGGGGAGG + Intronic
1021341806 7:19473352-19473374 AAGGTGAAGGACAAAGTTGGAGG + Intergenic
1022311598 7:29201356-29201378 AGGATGAGCCAGGAAGTGGGTGG - Intronic
1022507243 7:30914788-30914810 AAGATGTGGCAGGAAGTGGTTGG + Intronic
1023149129 7:37183196-37183218 AAGGAGAAGGAGGAAGGAGGAGG + Intronic
1023200722 7:37694248-37694270 CAGGTGCAGCAGCAAGTGGGAGG + Intronic
1023498655 7:40825095-40825117 AAGGTTGTGCAGGAGGTGGGAGG + Intronic
1023548627 7:41345095-41345117 ATGGTATATCAGGAAGTGGGAGG + Intergenic
1023799794 7:43824026-43824048 ATGGCCAAGCAGGCAGTGGGTGG + Intergenic
1023879912 7:44312462-44312484 AAGGAGAGGGAGGAAGAGGGAGG + Intronic
1024117424 7:46207275-46207297 AAGATGGAGCAGGAAGTGCCTGG + Intergenic
1024226643 7:47330608-47330630 AAGGTGAAGCAAGGAGGGAGAGG + Intronic
1025269683 7:57497819-57497841 TAGGTTGAGCAGGAAGAGGGAGG - Intergenic
1025922658 7:65927940-65927962 AAGGGGAGGCAGGAAGGAGGAGG + Intronic
1026600103 7:71770747-71770769 AAAGTTAATCAGGAAGTGTGGGG - Intergenic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1027788924 7:82614791-82614813 GAGTTGAAGCAGGAAGATGGAGG + Intergenic
1028516905 7:91687880-91687902 AAGGGGAAGGAGAAAATGGGAGG - Intergenic
1029219083 7:98973829-98973851 AAGGACATGCAGCAAGTGGGCGG - Intronic
1029590511 7:101503896-101503918 ACTGTGAAACAGGAAGTGGCAGG - Intronic
1029969603 7:104776447-104776469 AAGGAGAAGCTGGCTGTGGGGGG - Intronic
1030089073 7:105841273-105841295 AAGGTGAGGCAGCCAGTGAGAGG - Intronic
1031649840 7:124275281-124275303 AAGGAGAAACAGGAAGTTGATGG + Intergenic
1032086489 7:128886635-128886657 CAGGTATAGCAGGAGGTGGGGGG - Exonic
1033128615 7:138726377-138726399 AAGGGGAAACAGAACGTGGGGGG + Intronic
1033227368 7:139572708-139572730 AACTTGAACCGGGAAGTGGGAGG - Exonic
1033658047 7:143386552-143386574 AAGCAGAAACAGGAAGAGGGTGG + Intronic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1033961549 7:146919714-146919736 AAGGAGGATCAGGCAGTGGGCGG + Intronic
1034250477 7:149686594-149686616 AAGGTGAAACAGAGAGAGGGAGG + Intergenic
1034572751 7:151970188-151970210 AAGGGAAAGCAGGAAGGGGCGGG + Intronic
1034627458 7:152504378-152504400 AAGGTGAAGCAGGCAGATGTGGG - Intergenic
1034892345 7:154852399-154852421 AAGAGGAAGTGGGAAGTGGGTGG - Intronic
1035183954 7:157111443-157111465 GGGGTGGAGCAGGAAGTGAGTGG - Intergenic
1036021430 8:4851373-4851395 AAGGAAAAGCAGGAATTGGTGGG - Intronic
1037121914 8:15298731-15298753 TAGGAGAAACAGGGAGTGGGAGG + Intergenic
1037779541 8:21858320-21858342 AAATGGAGGCAGGAAGTGGGAGG + Intergenic
1038013132 8:23490596-23490618 AAGGTGAAGGAGGAAGTAAGAGG + Intergenic
1038050676 8:23807582-23807604 AAAGAGAAGCAGGAAGGGTGAGG + Intergenic
1038220186 8:25599851-25599873 TAAGGGAGGCAGGAAGTGGGTGG - Intergenic
1039030149 8:33299803-33299825 AGGGAGAATCAGGAAGTGGTTGG - Intergenic
1039553592 8:38460806-38460828 GAGGTGAAGCAGGAGGTGGCAGG - Intronic
1040079788 8:43274964-43274986 AAGGGGGAGGAGGAAGAGGGAGG - Intergenic
1040364280 8:46699008-46699030 AAGGTGAGGCAAGAACTGGAAGG - Intergenic
1040754625 8:50757963-50757985 AAGGAGAGGCAGGAATTAGGAGG - Intronic
1040788453 8:51195509-51195531 GAGGTAAACCAGTAAGTGGGAGG - Intergenic
1041383695 8:57278369-57278391 GAGGGGAAGCGGGAAGTTGGAGG - Intergenic
1042504095 8:69541105-69541127 ATGGTGGAGCAGGAAGGTGGTGG + Intronic
1043148127 8:76681440-76681462 ACGCTGGAGCAGAAAGTGGGGGG - Exonic
1043185089 8:77138233-77138255 AAGGTGGAGAAGGAGGTGGAGGG - Intergenic
1045740570 8:105353984-105354006 ACGATGATCCAGGAAGTGGGTGG - Intronic
1046155853 8:110289353-110289375 AATGAGAGGAAGGAAGTGGGGGG - Intergenic
1047345132 8:124020424-124020446 AAGATGAAGCAGACAGTGGCAGG + Intronic
1047605885 8:126473941-126473963 CAGGAGAGGCAGGGAGTGGGCGG - Intergenic
1047691183 8:127356274-127356296 GAGCTGAGGCAGGAAGGGGGTGG + Intergenic
1048034735 8:130666658-130666680 AAGGTAAAGGGGTAAGTGGGTGG + Intergenic
1048179207 8:132179995-132180017 GAGGAGAAACAGGAAGTGGCGGG - Intronic
1048299076 8:133238466-133238488 AAGAGGAAACGGGAAGTGGGCGG + Exonic
1048445897 8:134493165-134493187 CAGGTGACACAGGAAATGGGTGG - Intronic
1048829605 8:138463470-138463492 ATGGTGAAGCAGGAAGAGCCTGG + Intronic
1049199515 8:141333215-141333237 CAGGTGAAGGAGGAGATGGGTGG + Intergenic
1049812251 8:144580768-144580790 CAGGTGAGGCAGGTAGGGGGTGG - Intronic
1050084184 9:1947342-1947364 AAGGGGAAACATGAAATGGGAGG + Intergenic
1050690400 9:8221172-8221194 AAGGAGAAGCAGGGTGGGGGAGG + Intergenic
1051362070 9:16289811-16289833 AAGCTGAATGGGGAAGTGGGAGG + Intergenic
1051686893 9:19667459-19667481 GAGCTGAAGCAGTAATTGGGAGG - Intronic
1051848912 9:21486320-21486342 AAGAAGAAGCAGGAGGTGGTAGG - Intergenic
1052243303 9:26301969-26301991 AAGGAGAAAGAGGAAGAGGGTGG - Intergenic
1052679087 9:31665555-31665577 GAGATGATGCAGGAATTGGGTGG - Intergenic
1052861251 9:33439236-33439258 AAGGGGAGGGAGGAAGTGTGAGG - Intergenic
1055148943 9:72971595-72971617 AAGAGGAAGCAGGAACTGAGAGG - Intronic
1057302499 9:93894948-93894970 AGGGAGATGCAGGAAGGGGGCGG - Intergenic
1058705055 9:107631075-107631097 CAGTTGAACCAGGAAGTTGGAGG - Intergenic
1059332259 9:113542991-113543013 GAGGTGCAGCAGGCAGTGAGTGG - Intronic
1059340013 9:113592364-113592386 AATGTGGTGCTGGAAGTGGGAGG + Intronic
1059392156 9:114006061-114006083 GAGGTGAAGCTGGTGGTGGGAGG + Intronic
1059403545 9:114085761-114085783 AAGGTCACGCAGCCAGTGGGTGG - Intergenic
1059692101 9:116695595-116695617 CAGGAGAAGGAGGAAGTGGAGGG - Intronic
1060027512 9:120185463-120185485 AACCTGAGGCAGGAAGAGGGAGG - Intergenic
1060176169 9:121499187-121499209 AAGGGGAATCTGGGAGTGGGGGG - Intergenic
1060297890 9:122355508-122355530 GAGGAGAAGCTGGGAGTGGGTGG - Intergenic
1060523952 9:124310017-124310039 AGGCTGGAGCAGGAAGTGGCAGG + Intronic
1060558239 9:124521264-124521286 AAGGTGGGGCAGGTAGTGAGAGG + Exonic
1060679789 9:125552034-125552056 GAGGAGAAGTAGGGAGTGGGAGG - Intronic
1061102188 9:128500415-128500437 AAGGTGAAGCAGGAAGCACTTGG + Exonic
1061374481 9:130215904-130215926 AAGAGGGAGCAGGATGTGGGAGG - Intronic
1061430214 9:130526189-130526211 AAGGTGAAGGAAGAAATGGCTGG + Intergenic
1061637899 9:131926478-131926500 GAGGGGAAGCAGGGAGTGAGGGG - Intronic
1061972291 9:134051265-134051287 AAGGGGGAGCAGGATTTGGGAGG + Intronic
1062638411 9:137503594-137503616 AAGGAGAAGGAGGAAGAAGGAGG + Intronic
1203756122 Un_GL000218v1:128586-128608 AAGAAGAAGCAGGAAGCTGGGGG - Intergenic
1203649738 Un_KI270751v1:104834-104856 AAGAAGAAGCAGGAAGCTGGGGG - Intergenic
1185499165 X:584408-584430 AAGTAGAAGCAGGAAGAGTGGGG + Intergenic
1185717788 X:2356667-2356689 GAGGAGAAGGAGGAAGAGGGAGG - Intronic
1185814985 X:3146310-3146332 AAGAAGAAGAAGGAAGAGGGAGG - Intergenic
1186313163 X:8342079-8342101 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
1186459946 X:9740034-9740056 CAGGAGAAGGAGAAAGTGGGAGG + Intronic
1187012933 X:15298412-15298434 AAGTAGAAGCAGGAGATGGGAGG + Intronic
1189149310 X:38688086-38688108 AAGGTGGAGCAGAGACTGGGTGG - Exonic
1189288097 X:39866409-39866431 CAGGAGAGGCAGGAGGTGGGAGG + Intergenic
1189333227 X:40155445-40155467 GTGGGGAAGCAGGAAGGGGGTGG + Intronic
1190969763 X:55337151-55337173 AAGATCAAGCAGGAAGTTAGTGG - Intergenic
1191007513 X:55726018-55726040 AGAGGGAAGCAGGAAGTGGGTGG + Intronic
1191702384 X:64056952-64056974 AAGGAGAAGAACGAAGTTGGAGG - Intergenic
1191841862 X:65519032-65519054 AAGACAAAGCAGGATGTGGGAGG + Intronic
1191850429 X:65582040-65582062 AAGGCAAAGCAGGATGTGGTTGG + Intergenic
1191859745 X:65656645-65656667 AAGACAAAGCAGGATGTGGGAGG + Intronic
1191980689 X:66921632-66921654 AAAGTGAAAAAGGAAGTAGGAGG - Intergenic
1192214175 X:69146703-69146725 CAAGGGAAGCAGGAAGCGGGAGG + Intergenic
1192433660 X:71129153-71129175 AAGGTGAAGGAGGATGCGGCAGG - Exonic
1192555019 X:72082340-72082362 AAGGAGAGGCAGGAAAGGGGAGG - Intergenic
1192576255 X:72245600-72245622 CAGGGGAAGCAGGAAGGAGGAGG + Intronic
1192759350 X:74079332-74079354 AAGGTGAAGAAGGGAGTGGCAGG + Intergenic
1194771021 X:97905110-97905132 CAGGTGAAGTTGGAAGTGAGAGG + Intergenic
1195675101 X:107502016-107502038 AAGGTTAAGGAGGGTGTGGGTGG + Intergenic
1195702629 X:107716529-107716551 GAGGGGACGCAGGAAGGGGGGGG - Intronic
1196398684 X:115291478-115291500 AAGGAGAAGCAGGAACAAGGAGG + Intronic
1196417942 X:115492956-115492978 AAGGGGAAACAGGAATTTGGGGG - Intergenic
1197520492 X:127490947-127490969 CAGGAGCAGGAGGAAGTGGGGGG + Intergenic
1199635413 X:149807976-149807998 AACCTGAAGGAGGAAGTGAGAGG - Intergenic
1199860925 X:151800000-151800022 AAGGTGGAAGAGGAAGGGGGAGG - Intergenic
1199950229 X:152700602-152700624 AACCTGAAGGAGGAAGTGAGAGG - Exonic
1199952514 X:152716876-152716898 AACCTGAAGGAGGAAGTGGGAGG - Exonic
1199957169 X:152751572-152751594 AACCTGAAGGAGGAAGTGGGAGG + Exonic
1199959447 X:152767859-152767881 AACCTGAAGGAGGAAGTGAGAGG + Exonic
1200018410 X:153182157-153182179 AACCTGAAGGAGGAAGTGAGAGG - Exonic
1200078409 X:153563544-153563566 AAAATGAAACAGGAACTGGGTGG - Intronic
1200118686 X:153780566-153780588 TAGAAGAAGCAGGAAGTGGCTGG + Intronic
1200414211 Y:2890864-2890886 AAGGAGGAGAAGGAAGAGGGAGG + Intronic
1201146592 Y:11068049-11068071 AGGGAGAAGAAGGAAGAGGGAGG + Intergenic
1201146606 Y:11068098-11068120 AGGGAGAAGAAGGAAGAGGGAGG + Intergenic