ID: 900180058

View in Genome Browser
Species Human (GRCh38)
Location 1:1307441-1307463
Sequence CCTGCAGTCCAGCTCTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 499
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 452}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900180058_900180076 24 Left 900180058 1:1307441-1307463 CCTGGCCAGAGCTGGACTGCAGG 0: 1
1: 0
2: 3
3: 43
4: 452
Right 900180076 1:1307488-1307510 GAGGTGCAGACACAGAGCGGGGG 0: 1
1: 0
2: 2
3: 20
4: 315
900180058_900180077 27 Left 900180058 1:1307441-1307463 CCTGGCCAGAGCTGGACTGCAGG 0: 1
1: 0
2: 3
3: 43
4: 452
Right 900180077 1:1307491-1307513 GTGCAGACACAGAGCGGGGGCGG 0: 1
1: 0
2: 1
3: 31
4: 352
900180058_900180074 22 Left 900180058 1:1307441-1307463 CCTGGCCAGAGCTGGACTGCAGG 0: 1
1: 0
2: 3
3: 43
4: 452
Right 900180074 1:1307486-1307508 TGGAGGTGCAGACACAGAGCGGG 0: 1
1: 1
2: 4
3: 62
4: 412
900180058_900180073 21 Left 900180058 1:1307441-1307463 CCTGGCCAGAGCTGGACTGCAGG 0: 1
1: 0
2: 3
3: 43
4: 452
Right 900180073 1:1307485-1307507 GTGGAGGTGCAGACACAGAGCGG 0: 1
1: 0
2: 10
3: 108
4: 565
900180058_900180069 2 Left 900180058 1:1307441-1307463 CCTGGCCAGAGCTGGACTGCAGG 0: 1
1: 0
2: 3
3: 43
4: 452
Right 900180069 1:1307466-1307488 CCGGGAGGGGCTCAGCCCAGTGG 0: 1
1: 1
2: 3
3: 31
4: 363
900180058_900180075 23 Left 900180058 1:1307441-1307463 CCTGGCCAGAGCTGGACTGCAGG 0: 1
1: 0
2: 3
3: 43
4: 452
Right 900180075 1:1307487-1307509 GGAGGTGCAGACACAGAGCGGGG 0: 1
1: 0
2: 3
3: 50
4: 496
900180058_900180070 5 Left 900180058 1:1307441-1307463 CCTGGCCAGAGCTGGACTGCAGG 0: 1
1: 0
2: 3
3: 43
4: 452
Right 900180070 1:1307469-1307491 GGAGGGGCTCAGCCCAGTGGAGG 0: 1
1: 2
2: 4
3: 46
4: 381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900180058 Original CRISPR CCTGCAGTCCAGCTCTGGCC AGG (reversed) Intronic
900153959 1:1196640-1196662 CTTGCAGTCCAGCTTGGGCTTGG - Exonic
900178100 1:1299514-1299536 CCTGCAGCCAACCTCTGCCCGGG + Intronic
900180058 1:1307441-1307463 CCTGCAGTCCAGCTCTGGCCAGG - Intronic
900410630 1:2510965-2510987 CCTGCAGCCCAGCCCAGTCCCGG - Intronic
900991449 1:6100142-6100164 CCTGCTGTCCAGTCCTGGCCGGG + Exonic
901447978 1:9319691-9319713 TCTGCACTGCAGATCTGGCCGGG - Intronic
901628311 1:10635865-10635887 CCTGGAGTCCAGCTCAGGGAGGG + Intergenic
901642933 1:10702190-10702212 CCCGCAGGCCAGCCCTGGCGGGG + Intronic
902331672 1:15734026-15734048 CCTACAGTCCACCCCTGCCCTGG + Exonic
902334513 1:15747378-15747400 CCTGGAGGACAGCCCTGGCCTGG - Intronic
902415417 1:16236104-16236126 TGTGGAGCCCAGCTCTGGCCAGG - Intronic
902422158 1:16289368-16289390 ACTGCACTCCAGCTTTGGCAAGG + Intronic
902501848 1:16916138-16916160 ACTGCACTCCAGCTCAGGCCTGG + Intronic
902727737 1:18348413-18348435 CCTGCAGGCCTGCTCTGGCGGGG - Intronic
903219163 1:21859511-21859533 CCTGCAGCCCAGCCCAGGACAGG + Intronic
903695116 1:25200754-25200776 ACTGCACTCCAGCCTTGGCCTGG - Intergenic
903921787 1:26804804-26804826 AGTACAGTCCAGCTTTGGCCCGG + Intergenic
904209016 1:28873562-28873584 GCTGAAGTCCAGCTCAGGGCAGG + Intergenic
904454916 1:30641748-30641770 CCTGCAGCCCAGCTCTGCTGGGG - Intergenic
905004269 1:34697654-34697676 CATGCAGACAAGCTCAGGCCAGG - Intergenic
905372057 1:37487594-37487616 CCTGCCCACCAGCTCTGGCCTGG + Intergenic
906155959 1:43614085-43614107 CCTGCAGGCCAGCACCGGTCTGG + Intronic
906242356 1:44249707-44249729 CCTCCATCCCAGCTCTGCCCTGG - Intronic
907218480 1:52886569-52886591 ACTGCATTCCAGCTCCAGCCTGG - Intronic
907426162 1:54380545-54380567 TCTGCAAGACAGCTCTGGCCAGG + Intronic
909605248 1:77501268-77501290 CCTGCTCACCAGCTCTGGACTGG - Intronic
910691035 1:89966028-89966050 CCTACAGTCCAGATCTGCCAAGG + Intergenic
910840909 1:91560439-91560461 CCTGCAGCCCAAATCTAGCCAGG - Intergenic
913573476 1:120144629-120144651 CCTTCACTCCAGCCCTGTCCTGG - Intergenic
914294734 1:146309430-146309452 CCTTCACTCCAGCCCTGTCCTGG - Intergenic
914555775 1:148760213-148760235 CCTTCACTCCAGCCCTGTCCTGG - Intergenic
915115780 1:153598653-153598675 TCTGGGGTCCAGCGCTGGCCTGG - Intergenic
915473034 1:156137104-156137126 CCTGCAGCCCAGATCTGGAGAGG - Exonic
915748990 1:158186917-158186939 ACTTCAGGCCAGCTTTGGCCTGG + Intergenic
916732508 1:167579324-167579346 TCTGCAGTCAAGCTGTGGGCAGG - Intergenic
917120133 1:171638403-171638425 CCTGCAGACCTGCTCTGACAAGG + Intronic
917487117 1:175465557-175465579 CCTGCAGTCAGGCTCTTTCCAGG + Intronic
917717798 1:177755677-177755699 CCTGCAGTCCGCCTCTGCACAGG + Intergenic
918401224 1:184164577-184164599 GCTGCAGACCAGCTCTGGCCTGG - Intergenic
919395113 1:197036244-197036266 ACTGCACTCCAGCTCTGTCTGGG + Intergenic
919739201 1:200972323-200972345 CCTGCAGTCCCCCACTGGGCCGG - Intronic
920219886 1:204389234-204389256 ACTGCACTCCAGCTCCAGCCTGG - Intergenic
920227899 1:204451147-204451169 CCTCCAGCCAAGCCCTGGCCTGG - Intronic
920834680 1:209499029-209499051 ACTGCACTCCAGCTCCAGCCTGG - Intergenic
921297084 1:213714539-213714561 CCTGATGGCCAGCTCTGGGCTGG + Intergenic
922179040 1:223219293-223219315 TCTGCACTCCGGCTCTAGCCAGG + Intergenic
922250401 1:223844986-223845008 CCTGCTGTTCATCTGTGGCCTGG + Intronic
922367495 1:224879559-224879581 CATGCTGTCCTGCTCTGTCCTGG + Intergenic
923218848 1:231874871-231874893 ACTACACTCCAGCTCTAGCCTGG + Intronic
923413295 1:233731011-233731033 CATGCATTCCAGCCCTGGCCAGG + Intergenic
1062799414 10:368402-368424 CCTGCCTCCCAGCTGTGGCCAGG - Intronic
1063357267 10:5412799-5412821 CCTCCCGTCCAGCTCCGACCCGG - Exonic
1063852425 10:10208032-10208054 CCTGCATCCCAGCTCAGTCCAGG - Intergenic
1063992239 10:11578564-11578586 ACTGCACTCCACCTCTAGCCTGG + Intronic
1064088114 10:12360876-12360898 TCTGCAGTCCCGGCCTGGCCCGG - Intronic
1065282139 10:24150458-24150480 CCTGCAGACCTTCTCTGGTCTGG - Intronic
1065840208 10:29695998-29696020 AGTACAGTCCAGCTTTGGCCCGG - Intronic
1067352399 10:45488221-45488243 CCTGTGATCCAGTTCTGGCCAGG + Intronic
1067557974 10:47285551-47285573 CCTGCAGGACAGCTCTGCACAGG + Intergenic
1067662971 10:48250227-48250249 ACTGCAGACCACCTCTGGCAGGG + Intronic
1067763654 10:49069470-49069492 CCTGCAGCCCAGCACAGGCTGGG + Intronic
1069775334 10:70923896-70923918 CCTCCAGCCCTGCCCTGGCCTGG - Intergenic
1070820836 10:79353188-79353210 CCTGCAGTTCTGCTCTTGGCTGG + Intronic
1070832225 10:79425057-79425079 TCTGGAGTCCTGCTCTGTCCTGG + Intronic
1070931223 10:80261810-80261832 AGCTCAGTCCAGCTCTGGCCAGG + Intergenic
1072999524 10:100276548-100276570 AGTACAGTCCAGCTTTGGCCCGG - Intronic
1073821510 10:107269824-107269846 CCTGCTGTCTCACTCTGGCCTGG + Intergenic
1074375967 10:112940951-112940973 CCTGCATTCCAGTCCTGGTCTGG + Intergenic
1074752062 10:116596301-116596323 CCTGTAATCCTGCTCAGGCCTGG - Exonic
1074974280 10:118567681-118567703 CCTGCAGGCCAGCTCAGAGCAGG - Intergenic
1075331787 10:121579300-121579322 CCTGCAACTCAGCCCTGGCCAGG + Intronic
1075809423 10:125214188-125214210 ACTGCAGTCAAGCTGTGGCCTGG + Intergenic
1076260084 10:129058430-129058452 GCTGCAGTCTAGCGCTGGGCAGG + Intergenic
1076280356 10:129241716-129241738 CCTGCTGTCCTGCACTGGGCAGG - Intergenic
1076535553 10:131174473-131174495 CCTGCAGCCCAGCCCCGACCAGG - Intronic
1076703621 10:132288461-132288483 CAGGAAGTCCAGCTCTGGGCTGG - Intronic
1076769355 10:132654550-132654572 GCTGCTGCCCAGCTCTGCCCAGG - Intronic
1076837923 10:133030376-133030398 CCTCGAGCCCGGCTCTGGCCTGG + Intergenic
1076864778 10:133161190-133161212 CCTGTAGCTCAGCTCTGGCTTGG + Intronic
1076904519 10:133355454-133355476 CCTGCAGCCCAGCTCAGTGCTGG - Exonic
1076999084 11:313622-313644 GCTGCAGTCCTGCTCTGTGCGGG - Intronic
1077043049 11:532988-533010 CCTGAACTCCAGGTCTGGCCAGG + Intronic
1077115061 11:880403-880425 CCTGGGGTCCAGCACAGGCCTGG - Intronic
1077545185 11:3166059-3166081 CCTGCAGTGCACCTCAGGCTTGG - Intronic
1078095889 11:8296994-8297016 CCTTCAGTGCATCTCTGGGCAGG + Intergenic
1079209977 11:18452777-18452799 GCTGCACTCCAGCTCCAGCCTGG - Intergenic
1079458640 11:20660069-20660091 CCTGCAGTCAAGCTCCAGGCTGG + Intergenic
1080312659 11:30912636-30912658 ACTACAGACAAGCTCTGGCCAGG + Intronic
1080395152 11:31883156-31883178 CCTGCAGCCCGGGTCTGGCTGGG + Intronic
1080451520 11:32382194-32382216 CCCGCATTCCAGCCCTGCCCTGG - Intergenic
1081535813 11:43995567-43995589 CCTCAAGCCCAGCTCAGGCCAGG - Intergenic
1081538491 11:44013315-44013337 ACTGCACTCCAGCTCCAGCCTGG - Intergenic
1081794383 11:45809567-45809589 CCTGAAGTCCAGATCGGTCCAGG - Intronic
1082981639 11:59129280-59129302 CATGATGTCCAGCTCTGGCAGGG + Intergenic
1083170529 11:60921793-60921815 CCTGAAGCTCAGCCCTGGCCAGG + Exonic
1083301068 11:61739841-61739863 CCTGGAGTCCTGCTCAGGGCTGG - Intronic
1083731289 11:64653927-64653949 CCTGCCTTCCAGCTCTGGGGAGG - Intronic
1083794582 11:65007829-65007851 CCTGCACTCCAGCATGGGCCTGG + Intergenic
1083894436 11:65613136-65613158 CCCTCAGCCGAGCTCTGGCCGGG - Exonic
1083897982 11:65629818-65629840 GGTCCAGTCCAGCTCTGTCCAGG + Intronic
1084564076 11:69919824-69919846 CCAGCCATCCAGCTCTTGCCTGG + Intergenic
1085116878 11:73937622-73937644 AGTACAGTCCAGCTTTGGCCCGG + Intergenic
1085347771 11:75779295-75779317 CCTGAAGTCCAGGTGTGGGCTGG + Intronic
1085754327 11:79191173-79191195 AGTACAGTCCAGCTTTGGCCCGG - Intronic
1086084886 11:82944137-82944159 CCTGCAGCACACCCCTGGCCTGG + Intronic
1088950754 11:114567392-114567414 ACTGCAGACCCGCTCTAGCCTGG + Intergenic
1089304109 11:117516142-117516164 CATGCAGCCCATCTCTGACCTGG + Intronic
1089456383 11:118628199-118628221 CCTTAAGTCCATCTCTGTCCCGG + Exonic
1089499751 11:118925264-118925286 CATGGCGTCCAGCTCCGGCCTGG - Intronic
1089525018 11:119091475-119091497 GCTGCAGGCCAGCTGTTGCCAGG - Exonic
1089661516 11:119989156-119989178 CCTTCAGACCTGCGCTGGCCTGG - Intergenic
1090014285 11:123072061-123072083 CCAGAAGTCTAGCTCTGGGCTGG - Exonic
1091198542 11:133752692-133752714 CCTGCACTCCGGGTCTTGCCAGG + Intergenic
1091428110 12:409165-409187 ACTGCACTCCAGCTCCAGCCTGG + Intronic
1092081177 12:5717656-5717678 CTTGTACTCCAGATCTGGCCTGG + Intronic
1094104090 12:26790803-26790825 CCTGCATTCAATCTCTGGCTTGG + Intronic
1095745782 12:45657010-45657032 CCTGCACTCCAGCTCCAGCCTGG + Intergenic
1096201890 12:49689866-49689888 CCTCCCATACAGCTCTGGCCTGG + Intronic
1096340043 12:50790240-50790262 ACTGCACTCCAACTCTAGCCTGG - Intronic
1096516306 12:52157407-52157429 CCAGGTGTCCAGCTCAGGCCTGG + Intergenic
1097482988 12:60154668-60154690 CCTACAGTCCAGTTCAGTCCTGG - Intergenic
1100251184 12:92825414-92825436 ACTGCACTCCAGCTCCAGCCTGG + Intronic
1100397365 12:94196703-94196725 CCTCGAGTCCAGGCCTGGCCAGG + Intronic
1100579305 12:95923378-95923400 TCTGGGGTCCAGCCCTGGCCTGG - Intronic
1100721999 12:97369042-97369064 ACTCTAGACCAGCTCTGGCCTGG + Intergenic
1100867245 12:98870025-98870047 GCTGGAGCCCAGCTCTGGCATGG + Intronic
1102859349 12:116321903-116321925 ACTGCACTCCAGCTCCAGCCTGG - Intergenic
1103209647 12:119156997-119157019 CCTGGGGCCCAGCTCAGGCCTGG + Exonic
1103671054 12:122615747-122615769 ATTGCACTCCAGCTCCGGCCTGG + Intronic
1103764165 12:123269985-123270007 CCTGAAGTCCTGTTCTGGGCTGG - Intronic
1103818078 12:123674913-123674935 CCTGCACTCTAGCTCCAGCCTGG - Intronic
1103881163 12:124166963-124166985 CCTCCAGGCCCGCTCTGGGCAGG + Intronic
1104587526 12:130059437-130059459 GGTGCAGCCCAGCTGTGGCCAGG + Intergenic
1104617121 12:130279966-130279988 ACTGCACTCCAGCTCCAGCCTGG + Intergenic
1104896652 12:132168158-132168180 CCGCCAGACCAGCTCTGACCTGG - Intergenic
1105769923 13:23599551-23599573 CCTGCAATCCACCTGTGACCTGG - Intronic
1106745282 13:32697922-32697944 CCAGCAGTTCAGCACTAGCCTGG - Intronic
1106759726 13:32857016-32857038 CCTGAGCTCCAACTCTGGCCGGG - Intergenic
1107535936 13:41332100-41332122 ACTGCACTCCAGCTCCAGCCTGG - Intronic
1107710320 13:43144869-43144891 GCTGCAGTCCAGCGTTGCCCAGG - Intergenic
1108150862 13:47532188-47532210 CCAGCAGCCCACCTCTGGGCTGG - Intergenic
1109475431 13:62875054-62875076 TCTTCAGACCAGCTCTGGCCTGG + Intergenic
1112459417 13:99590173-99590195 CCTGCAGCCCAGCCCAGCCCAGG - Intergenic
1112580705 13:100674607-100674629 CCAGCAGCGCCGCTCTGGCCCGG + Intronic
1114908632 14:27163960-27163982 CCTGCAGTTCGGCTCTCTCCAGG - Intergenic
1115221026 14:31058603-31058625 ACTGCACTCCTACTCTGGCCTGG - Intronic
1115405796 14:33014839-33014861 CCTGCTGTGCAGCTCTGGTGAGG - Intronic
1115477945 14:33834340-33834362 ATTACAGTCCAGCTCTTGCCAGG - Intergenic
1115741249 14:36391311-36391333 CCTGCAGGCCACCTCTGCCATGG + Intergenic
1119266476 14:73265607-73265629 CCTGGAGTCCGGCTCAGGACTGG - Intronic
1119671891 14:76526277-76526299 ACTGCACTCCAGCTCCAGCCTGG + Intergenic
1120620416 14:86756551-86756573 CCAGCAGTCCAAGACTGGCCTGG + Intergenic
1120712532 14:87807607-87807629 CCTGACCTCCAGCTCTGACCTGG + Intergenic
1121035860 14:90703107-90703129 CTTGTCTTCCAGCTCTGGCCAGG - Intronic
1121125059 14:91400495-91400517 CCGGGAGTCCAGCTCTGGCCTGG - Intronic
1121406853 14:93724428-93724450 TCTGCAGCCAAGCTCTGCCCTGG + Intronic
1121777914 14:96602960-96602982 CATGCAGTCCAGGCCAGGCCAGG + Intergenic
1122117588 14:99535538-99535560 CCTGCTGCCCAGCTCTGCACAGG + Intronic
1122787660 14:104171385-104171407 CCTGCAGAGCAGCTCAGTCCAGG - Intronic
1123023111 14:105411474-105411496 CCTGCAGTGCAGCTGGGTCCCGG - Exonic
1123627760 15:22239251-22239273 CCTTCAGCCTGGCTCTGGCCAGG - Intergenic
1124233681 15:27968375-27968397 CGGGCAGTCCAGCTCTGCCTTGG + Intronic
1124881666 15:33648693-33648715 CCTGCAGCTCAGATCTGCCCTGG + Intronic
1125650810 15:41316088-41316110 ACTGCACTCCAGCTCCAGCCTGG + Intronic
1126146616 15:45479388-45479410 CTTGCAGGCCAGATTTGGCCTGG + Intergenic
1127303272 15:57678322-57678344 CCTGCACTCCAGCCTGGGCCTGG + Intronic
1128720484 15:69944017-69944039 CCTGCAGCCCAGCTGTCTCCAGG - Intergenic
1128800883 15:70496160-70496182 CAAGCAGTCCAGTGCTGGCCAGG + Intergenic
1128982462 15:72197555-72197577 CGCGCGGTGCAGCTCTGGCCCGG + Intronic
1129323222 15:74786340-74786362 CCTGCCTCCCAGCTCTGGCTAGG + Intronic
1129458676 15:75689123-75689145 CCTGCAGTCCATCGCTGACCCGG + Exonic
1130273177 15:82462955-82462977 CCTGCAGTCCATTGCTGACCCGG - Intergenic
1130315905 15:82796342-82796364 ACTGGGGACCAGCTCTGGCCAGG - Intronic
1130381851 15:83378687-83378709 CCTCCAGTCCAGGTCTGGAGAGG - Intergenic
1130465529 15:84190326-84190348 CCTGCAGTCCATTGCTGACCCGG - Intergenic
1130487163 15:84404494-84404516 CCTGCAGTCCATTGCTGACCCGG + Intergenic
1130498736 15:84483210-84483232 CCTGCAGTCCATTGCTGACCCGG + Intergenic
1130587818 15:85194921-85194943 CCTGCAGTCCATTGCTGACCCGG - Intergenic
1130888546 15:88113665-88113687 CCTGCAGGCCAAATCTGGCCTGG + Intronic
1131933188 15:97469374-97469396 CCTCCACTACAGCTCTGGCCAGG - Intergenic
1132805883 16:1774956-1774978 TCTGCAAACCAGCTGTGGCCTGG + Intronic
1132827868 16:1913977-1913999 TCTGTAGGCCAGCTCTGCCCAGG - Intronic
1133215937 16:4292570-4292592 CCTCCAGCCCTCCTCTGGCCTGG - Intergenic
1133761824 16:8805093-8805115 GCTGCACTCCAGCTCCAGCCTGG - Intronic
1134289809 16:12894942-12894964 CTTGCAGGCCAGCTGTGTCCAGG - Intergenic
1136843595 16:33558539-33558561 CCTGAAAGCCAGGTCTGGCCAGG - Intergenic
1138230496 16:55332427-55332449 CCTGCAGTTCAGCTCTAACCTGG + Intergenic
1138438808 16:57022186-57022208 GCTGGGGACCAGCTCTGGCCTGG - Intronic
1138512224 16:57515330-57515352 CCTGCAGTCCAGGTGGGCCCCGG - Exonic
1139893710 16:70271236-70271258 ACAGCAGTCCAGTTCTGGCACGG + Intronic
1139961306 16:70719055-70719077 GCTGCAGACCACCGCTGGCCTGG + Intronic
1139966077 16:70746170-70746192 CCTCTAGGCCAGCCCTGGCCGGG + Intronic
1140572560 16:76125760-76125782 ACTGCACTCCAGCTCCAGCCTGG + Intergenic
1141764836 16:86051555-86051577 GCTGCTGACCACCTCTGGCCAGG - Intergenic
1141945234 16:87305118-87305140 CCCGAAGCCCAGCTGTGGCCCGG + Intronic
1142178654 16:88656675-88656697 TGTGGAGTCCAGCTCTGTCCTGG - Intronic
1203148754 16_KI270728v1_random:1820651-1820673 CCTGAAAGCCAGGTCTGGCCAGG - Intergenic
1203153760 16_KI270728v1_random:1858837-1858859 CCTGAAAGCCAGGTCTGGCCAGG - Intergenic
1142559321 17:800688-800710 CATGCAGCCCCGCTCTGGCCGGG + Exonic
1142622871 17:1176051-1176073 ACTGCACTCCAGCTCCAGCCTGG + Intronic
1142676467 17:1516557-1516579 CCCGCAGGGCTGCTCTGGCCGGG - Exonic
1143108570 17:4541367-4541389 CCTGCAGTCCAGCCCGGGCATGG + Intronic
1143393381 17:6573627-6573649 GCTGCAGCTCAGCTCTGACCTGG + Intergenic
1143479262 17:7219257-7219279 CCTGCAGTTCCTCTCAGGCCCGG + Exonic
1144022795 17:11251940-11251962 CCTGGTGTGCAGCTCTTGCCAGG + Intronic
1144099518 17:11931496-11931518 CCAGCAGCCCAACTCTGGGCGGG + Intronic
1144425828 17:15141389-15141411 CCTGCACTCCAGCTATGGATTGG - Intergenic
1144621262 17:16819991-16820013 TCTCCAGGTCAGCTCTGGCCAGG + Intergenic
1144843550 17:18203740-18203762 CTTGGAGTCAAGCTCTAGCCTGG + Intronic
1145294766 17:21579292-21579314 CCTGAAGTCTACCTCTGGCTGGG - Intergenic
1147573242 17:41584313-41584335 TCTCCAGGTCAGCTCTGGCCAGG + Exonic
1147965191 17:44190922-44190944 CCTTGGGCCCAGCTCTGGCCAGG - Exonic
1148179723 17:45595604-45595626 CAAGTAGTCCAGCTTTGGCCAGG - Intergenic
1148269180 17:46250297-46250319 CAAGTAGTCCAGCTTTGGCCAGG + Intergenic
1148332395 17:46820296-46820318 CCTCCAGTCCAGCAATGGGCTGG - Intronic
1148511391 17:48173140-48173162 ACTGCAGTCCAGCCTGGGCCTGG + Intronic
1148757197 17:49979719-49979741 CTTGGAGTCCAGCTCTGCCACGG + Intergenic
1149205791 17:54245040-54245062 ACTGCAGTCAAGATGTGGCCAGG - Intergenic
1150285294 17:63950686-63950708 CCCACTGTCCAGCTCTGGCAGGG - Intronic
1150618732 17:66792667-66792689 TCTGCAGTACAGCTGTGGGCTGG + Intronic
1151693358 17:75701084-75701106 TCTGCAGTTCAGCTCTGCTCTGG + Intronic
1152169579 17:78735479-78735501 CAGGCAGTTCAGCCCTGGCCTGG + Intronic
1152219036 17:79050824-79050846 CCTGCAATCCTGCTCTGTACGGG + Intergenic
1152572445 17:81126744-81126766 CCTTCAGTCCAGCCCAGCCCTGG - Intronic
1152614856 17:81333398-81333420 CCTGCTGTCCAGCTCTGGGGTGG - Intergenic
1152621282 17:81366133-81366155 CCTGCAGCCCAGGGCAGGCCTGG - Intergenic
1152935937 17:83136857-83136879 CCTGTATTCCAGCTCTTCCCCGG + Intergenic
1154981911 18:21509379-21509401 CCTCCAGTCCAGCTCTAGGCTGG - Intronic
1155513911 18:26604928-26604950 CCTGCAGTCCAGGGCTGACTTGG + Intronic
1157220704 18:45826790-45826812 ACTGGAGTCCAGCTCGGGGCTGG + Intronic
1157386583 18:47263478-47263500 CCTGCAGGGCAGCGCGGGCCGGG + Intergenic
1157588437 18:48820114-48820136 GCTCCAGACCAGCTCTGGCATGG - Intronic
1159016672 18:63106441-63106463 CCTGCTTGGCAGCTCTGGCCAGG + Intergenic
1159797926 18:72867135-72867157 CCTGCAGTCCCGCGCGGGTCGGG - Intronic
1160333405 18:78016017-78016039 CCTGCAGTCTGGCTCTGGTGGGG - Intergenic
1160507629 18:79436420-79436442 CCTGCAGTGCAGCTGAGCCCTGG + Intronic
1160613778 18:80109132-80109154 CCTCCAGTCCATCTTTAGCCAGG + Exonic
1160752923 19:743179-743201 CCCGCAGCCCAGCTCTGGAGTGG + Intronic
1160833344 19:1113356-1113378 CGTGCTGTCCAGCTCGGCCCGGG - Intronic
1161490246 19:4557400-4557422 CCTGCACTCCACCTCCTGCCCGG + Intronic
1161685119 19:5698710-5698732 CCGGCCCTGCAGCTCTGGCCCGG + Intronic
1162904133 19:13813402-13813424 CCTGCAGTCCTGGGCTGGTCTGG + Intronic
1163020112 19:14477203-14477225 CCTTCCCTCCAGGTCTGGCCAGG + Intergenic
1163596180 19:18222256-18222278 CCCTCAGTCCAGCCCTGGCCTGG - Exonic
1163605282 19:18271623-18271645 ACTCCAGACCAGCTCTGGCTTGG - Intronic
1163688791 19:18727035-18727057 CCAGGAGTCCAGGTCTAGCCTGG + Intronic
1165067267 19:33236562-33236584 CCTCCACCCCAGCTCGGGCCTGG + Intergenic
1165117365 19:33536960-33536982 ACTGCACTTCAGCTCTAGCCTGG - Intergenic
1165118550 19:33544542-33544564 CCTGCAGTCCAGCCCCAGCCTGG + Intergenic
1165369544 19:35395999-35396021 CATCCAGTGCAGCTCTGGGCCGG + Intergenic
1165690938 19:37862623-37862645 ACTGCAGACCAGCTCCAGCCTGG - Intergenic
1166838444 19:45681824-45681846 CCTGCCCTCCGGCTCCGGCCCGG + Exonic
1167146031 19:47681159-47681181 CCCCCAGCCCAGCCCTGGCCTGG + Exonic
1167587449 19:50383008-50383030 CTTGCACTCCAGCTCCGGGCTGG - Intergenic
1167647612 19:50714125-50714147 CCTGCTCCCCAGCTCTGTCCTGG + Intronic
1168721832 19:58558572-58558594 CCCGTAGTCCGGCTCCGGCCTGG + Exonic
925608523 2:5683686-5683708 CTTCCAGGGCAGCTCTGGCCAGG - Intergenic
925893445 2:8454336-8454358 CCTTCAGTGCAGCCCTTGCCAGG + Intergenic
926147280 2:10404466-10404488 CCTGCTGACCAGCACAGGCCAGG - Intronic
926281741 2:11454390-11454412 ACTGCACTCCAGCTCCAGCCTGG - Intronic
926474696 2:13308253-13308275 CCTGCAGCCCGGGTCTGGGCGGG - Intergenic
927038397 2:19204078-19204100 CATGCAGGCCTGCTCTTGCCTGG - Intergenic
927572447 2:24171708-24171730 CATCGAGTCCACCTCTGGCCAGG + Intronic
927964566 2:27261330-27261352 CCTCCAGGGAAGCTCTGGCCTGG - Intronic
928280585 2:29942942-29942964 CCAGGAGTCCAGCCCTGACCTGG + Intergenic
928401129 2:30979506-30979528 CCACCACGCCAGCTCTGGCCAGG + Intronic
929564224 2:42974873-42974895 CCAGCATTCCAGCTCGGGACGGG + Intergenic
929620339 2:43348238-43348260 CCTGCTGCTCAGCTCCGGCCAGG - Intronic
930208990 2:48615422-48615444 AGTACAGTCCAGCTTTGGCCCGG + Intronic
930989139 2:57629480-57629502 ACTGCACTCTAGCTCTAGCCCGG + Intergenic
931725410 2:65105465-65105487 ACTGCATTCCAGCTCCAGCCTGG + Intronic
931751918 2:65338344-65338366 AGTACAGTCCAGCTTTGGCCCGG - Intronic
932171947 2:69565522-69565544 CTTGCAGTCTAGCCCTGGTCCGG - Intronic
932699650 2:73984501-73984523 CCTGCGGGCCAGATCTGTCCGGG - Intergenic
933751234 2:85602985-85603007 CCTGCATTCCAGCTCTACCTGGG + Intronic
935197197 2:100824233-100824255 CCTGCCCTCCAGCCCTGGCCCGG - Intronic
935849690 2:107205038-107205060 CCTGCAGCCCAGCCTTGCCCTGG + Intergenic
936238003 2:110761720-110761742 ACTCCAGACCAACTCTGGCCTGG + Intronic
937290578 2:120779351-120779373 CCTACTGCCCAGCACTGGCCAGG - Intronic
938082714 2:128378733-128378755 CCTGCAGACCAGCTCTGGAAGGG + Intergenic
938382926 2:130846711-130846733 CTGGCTGTCCAGCTCTGGCCTGG - Intronic
939178643 2:138780375-138780397 CGTGCCGCGCAGCTCTGGCCGGG + Intergenic
941953480 2:171180165-171180187 ACTGCACTCTGGCTCTGGCCTGG + Intronic
942741427 2:179183767-179183789 CCAGGAGTCCAGTACTGGCCGGG + Intronic
943743360 2:191435404-191435426 CATGCAGGCCAGCTGTGGGCTGG - Intergenic
943773220 2:191741263-191741285 AGTACAGTCCAGCTTTGGCCCGG - Intergenic
946001377 2:216485353-216485375 TCTGCAGGCCAGTTGTGGCCAGG - Intergenic
947731609 2:232434518-232434540 CCATCAGCTCAGCTCTGGCCTGG - Intergenic
948948682 2:241235159-241235181 CCAGCAGTCCAGCCTTGGCCCGG + Exonic
1169215138 20:3789193-3789215 CCTGAAGGACAGCTCTGGGCAGG - Intronic
1169226866 20:3862319-3862341 CCTGGAGTCCTCCTCTGACCTGG + Exonic
1169541395 20:6603871-6603893 CCTGCAGTCCAAATCCAGCCTGG - Intergenic
1170185348 20:13583307-13583329 ACTGTAGACCAGCTCTGGCCTGG + Intronic
1170419433 20:16178168-16178190 CTTGCAGGCTAGCTCAGGCCGGG + Intergenic
1170839953 20:19916555-19916577 GCTGCACTCCAGCTCCAGCCTGG + Intronic
1171218934 20:23375955-23375977 CCTGCAGTCGACCCTTGGCCTGG + Exonic
1171425118 20:25044111-25044133 CCTGGAGTCCAACCCTAGCCTGG + Intronic
1172000016 20:31767412-31767434 ACTGCACTCCAGCTCCAGCCTGG - Intronic
1172223203 20:33287635-33287657 ACTGTGGACCAGCTCTGGCCTGG - Intronic
1172838762 20:37889288-37889310 CTAGAAGTCCAGCACTGGCCAGG - Intergenic
1174054084 20:47785905-47785927 CCCGAAGTCCAGCTCCGGACGGG + Exonic
1174384605 20:50179674-50179696 CCTGAAGTCCAGCTGGAGCCTGG + Intergenic
1174481417 20:50833892-50833914 CCTCTGTTCCAGCTCTGGCCAGG - Intronic
1175620994 20:60447471-60447493 CCTGCAGTCCTGCCCTGACAGGG - Intergenic
1175676162 20:60948561-60948583 CCTGCAGTCCCGCTCAAGCCTGG - Intergenic
1175785460 20:61709031-61709053 GCTGCGGCCCAGCTCAGGCCTGG + Intronic
1175900443 20:62357906-62357928 CCTGCAGCCCAGCCCAGGTCAGG + Intronic
1175925153 20:62467769-62467791 CCTGCTGTCTGGCTCTGTCCTGG - Intronic
1178485911 21:33020175-33020197 CCCGCAGTCCCGCCATGGCCTGG + Intergenic
1179195053 21:39156675-39156697 AGTACAGTCCAGCTTTGGCCCGG - Intergenic
1179243188 21:39609652-39609674 CCTGAAGTCCCGTTCTGGCAGGG + Exonic
1182080359 22:27524451-27524473 CATGCAGGCCAGCCCTGGCGTGG - Intergenic
1183197803 22:36365352-36365374 CATGCAGCTCAGCTCGGGCCTGG + Intronic
1183361030 22:37383609-37383631 CCTGCAGTTCAGCCCTGGGCTGG + Intronic
1183414905 22:37676435-37676457 CCTGCAGTCGGGCTGTGGCTGGG - Intronic
1183426649 22:37743283-37743305 CCTGGAGTCGAGTTCTGGCTTGG + Intronic
1184534598 22:45077888-45077910 GCTGTGGTCCAGCTCTGCCCTGG + Intergenic
1184927186 22:47651217-47651239 GCTGAAGTCCAGCACTGGACAGG + Intergenic
1185079202 22:48700413-48700435 CCTGCCGGCCTGCTCTGCCCCGG - Intronic
949851085 3:8421148-8421170 ACTGCATACCAGCTCTGGTCAGG + Intergenic
949950105 3:9221961-9221983 ACTACAGTCCTGCCCTGGCCAGG - Intronic
951144775 3:19214114-19214136 ACTCCAGACCACCTCTGGCCTGG + Intronic
951986314 3:28625549-28625571 CCTGCACTCCTGCTCTGTCAGGG + Intergenic
952230391 3:31423678-31423700 TCTGCAGTCCAGCTGTGGATTGG + Intergenic
953409670 3:42683557-42683579 CCTGCAGTCCAGGGCTGGGCTGG + Intergenic
953814634 3:46144438-46144460 CCTGCAGTGCTGCCCAGGCCAGG + Intergenic
954259564 3:49428869-49428891 CCTGCATGCCAGCGCTGTCCTGG + Intronic
954423644 3:50432044-50432066 CCTGCAGCCCAGCCATGGCCTGG - Intronic
954431342 3:50472442-50472464 CTTCTAGCCCAGCTCTGGCCAGG + Intronic
954915081 3:54142036-54142058 CCTGAAGACCTGCTCTGGTCTGG + Intronic
955705168 3:61720159-61720181 ACTGCACTCCAGCTCCAGCCTGG - Intronic
955886473 3:63604341-63604363 CCTTCAGTTCAGCTCTGGTTTGG + Intronic
956026015 3:64983905-64983927 CCTGGAGGCCAGCTCAGTCCAGG - Intergenic
956527603 3:70182072-70182094 CCTCCAGCCCATCTCGGGCCTGG - Intergenic
958864361 3:99483903-99483925 CCTGCAGACAAGATTTGGCCTGG - Intergenic
960939135 3:122922208-122922230 CCTGCAGTCCAGGTTGGACCGGG + Intronic
961441832 3:126958004-126958026 CCTGTAGACCAGCTCAGGGCAGG - Intronic
961483985 3:127204805-127204827 CCCACAGTGCAGCTCTTGCCTGG + Intergenic
961534910 3:127564454-127564476 CCTGCTGTCCAGTTCTGTCTAGG - Intergenic
962053534 3:131844302-131844324 ACTGCACTCCAGCTCCAGCCTGG - Intronic
962197137 3:133373914-133373936 ATTGCAGTCCAGCAGTGGCCAGG + Intronic
962359856 3:134729798-134729820 CCTTCAGTACAGCTCTGACTGGG - Intronic
962916481 3:139908914-139908936 ACTGCAGTCCATCTCTTGCCTGG + Intergenic
963225855 3:142860885-142860907 CCTGCAGCACAGCTGTGGGCTGG + Intronic
964917999 3:161859208-161859230 CTTGCAATCGAGCTTTGGCCTGG - Intergenic
967248249 3:187510614-187510636 ACTGCACTCCAGCTCCAGCCTGG + Intergenic
967789384 3:193530933-193530955 CCTGCACTCCAGCTTTGCCAAGG + Intronic
968565944 4:1312911-1312933 CCTGCCCTCCGGTTCTGGCCTGG - Intronic
968612245 4:1562637-1562659 CCTGCTGTCCAGCCCAGGGCTGG + Intergenic
968684794 4:1950585-1950607 CGTGCAGTCCAGCTGCCGCCGGG - Intronic
969363956 4:6683094-6683116 CCTGGAGCCCAGCTCAGGACAGG - Intergenic
969642124 4:8405226-8405248 CCTGCATCCCAGCACAGGCCTGG + Intronic
972327670 4:38032795-38032817 ACTGCACTCCAGCTCCAGCCTGG + Intronic
972340801 4:38150908-38150930 CCTGCAGCCCAGCAGTGTCCTGG + Intergenic
972418895 4:38868236-38868258 CCTGCAGCCCACCTCTGACTTGG - Intronic
972783745 4:42308523-42308545 AGTGCAGTCCAGTCCTGGCCTGG + Intergenic
972879005 4:43400328-43400350 TTTGCAGTCAAGCTCTTGCCTGG - Intergenic
974028824 4:56757529-56757551 CCTGCATTCTGGCTGTGGCCTGG - Intergenic
975370048 4:73574429-73574451 TCTGTGGTCCTGCTCTGGCCTGG + Exonic
975719395 4:77235264-77235286 CCTGCAGTCTAGTGCTGCCCTGG - Intronic
976664963 4:87580454-87580476 CCTGGAGTCCAGCTCTGATATGG - Intergenic
977495594 4:97771468-97771490 ACTACAGACCAGCTCTGGTCTGG - Intronic
977535350 4:98250761-98250783 CCTGCAGTTCCGCTCTGCCTGGG + Intergenic
977938108 4:102828271-102828293 CCTTTAGTCTAGCTCGGGCCGGG + Intronic
979104252 4:116664386-116664408 CATGCATTCTAGCCCTGGCCAGG - Intergenic
981193771 4:141894544-141894566 ACTGCACTCCAGCTCCAGCCTGG - Intergenic
981310211 4:143290509-143290531 CCTGTAGTACAGCTGTTGCCTGG - Intergenic
982478130 4:155877701-155877723 CATGCAGCCCAGCCCTGGCAGGG + Intronic
984331112 4:178319816-178319838 CTTGCAGACCAGCTCTGTGCTGG - Intergenic
984358515 4:178696720-178696742 CATGTTGTCCAGCTCTGTCCTGG - Intergenic
984738758 4:183138430-183138452 TCTGCAGACCAAGTCTGGCCTGG + Intronic
985542665 5:494038-494060 CCTGCAGGCCAGCTCTGAGCGGG - Intronic
987721243 5:21635099-21635121 CCTTCAGTTGAGCTATGGCCAGG - Intergenic
989828728 5:45890022-45890044 AGTACAGTCCAGCTCTGGCTTGG - Intergenic
990884857 5:60579707-60579729 ACTACAGACCAGCTCTGGCATGG + Intergenic
991073980 5:62514541-62514563 AGTACAGTCCAGCTTTGGCCCGG + Intronic
991301547 5:65133574-65133596 CCAGCAGTCCAAGTCTGGCCTGG - Intergenic
991407785 5:66318714-66318736 CCTGCAGTGCAGAACTGACCAGG + Intergenic
992413962 5:76535080-76535102 CCTGAGGTCCAGCCCTGACCTGG - Intronic
995469461 5:112485163-112485185 CCTGAAGTCCAGCTATTTCCAGG - Intergenic
996355031 5:122586131-122586153 ACTGCTGTCTAGCTCTGTCCAGG - Intergenic
997207535 5:132058890-132058912 CCTGCAGGTCAGCCCTGCCCGGG - Intergenic
998141074 5:139699870-139699892 ACAGCAGCCCAGCTCTGGCTAGG - Intergenic
999151421 5:149428823-149428845 CCACCTCTCCAGCTCTGGCCGGG - Intergenic
1000116789 5:158161134-158161156 CGTGCAGACCAGCACTGCCCTGG + Intergenic
1000719616 5:164690934-164690956 AATGCAGTCCAGCTCGGGCACGG + Intergenic
1000744721 5:165018598-165018620 CCTGCAGTCCTGCAGTGTCCTGG - Intergenic
1001122597 5:168992633-168992655 CCTGGGGTCCTGCTCAGGCCTGG + Intronic
1001436488 5:171703340-171703362 CATGCAGTCCTCCTCTGGCTGGG - Intergenic
1001873774 5:175181697-175181719 ACTGCACTCCAGCCCTAGCCTGG - Intergenic
1001982067 5:176044537-176044559 CCTGATGTCCATCTGTGGCCAGG + Intergenic
1001982574 5:176046969-176046991 CCTGCTGTTCATCTGTGGCCTGG - Intergenic
1002234888 5:177797088-177797110 CCTGCTGTTCATCTGTGGCCTGG + Intergenic
1002235395 5:177799520-177799542 CCTGATGTCCATCTGTGGCCAGG - Intergenic
1002347134 5:178555872-178555894 CCTGCAGGGAGGCTCTGGCCAGG - Intronic
1003195866 6:3914031-3914053 CCTGAAGGGCTGCTCTGGCCAGG + Intergenic
1003624317 6:7727938-7727960 ACTTCTGCCCAGCTCTGGCCAGG + Intronic
1004929321 6:20446601-20446623 ACTGCACTCCAGCTCTAGTCCGG - Intronic
1006615214 6:35321455-35321477 CCCACAGGCCAGCTGTGGCCAGG - Exonic
1006898194 6:37484034-37484056 CCTGCAGAGCTGCTCTGGGCAGG + Intronic
1007399421 6:41595285-41595307 CCTGTGTGCCAGCTCTGGCCAGG - Intronic
1007480786 6:42148538-42148560 CCTGCATTCCAGAACTGCCCAGG - Intergenic
1007588023 6:43004058-43004080 ACTGCACTCCAGCTCCAGCCTGG - Intronic
1010964075 6:82182932-82182954 GCTGCAGTCAAGGTTTGGCCAGG - Intronic
1011109934 6:83826401-83826423 ATTGCACTCCAGCTCTAGCCTGG + Intergenic
1015196293 6:130527601-130527623 AGTGCAGCCCAACTCTGGCCTGG - Intergenic
1017162658 6:151380552-151380574 CCTCCAGGCCAGCTCCCGCCCGG + Intronic
1018865812 6:167746286-167746308 CGTGAAGCCCAGCTCTGGCCGGG - Intergenic
1019223156 6:170490868-170490890 AGTGCAGTCCAGCTGTGCCCTGG - Intergenic
1019282763 7:208734-208756 TCTGCAGTGAAGCTCTCGCCTGG - Intronic
1019307385 7:342286-342308 CCTGCCATCCCGGTCTGGCCAGG - Intergenic
1019606839 7:1914158-1914180 CCTCCAGGCCAGCACTGGCCAGG - Intronic
1019933837 7:4241711-4241733 CCCGCTGGCCAGCTCTGGCTTGG + Intronic
1020090108 7:5333961-5333983 CCTGGACACCAGCTCTGACCTGG - Intronic
1020213392 7:6171417-6171439 CCTGGGGTACAGCTCTGGCAGGG + Intronic
1021038651 7:15833197-15833219 TTTGAAGCCCAGCTCTGGCCTGG - Intergenic
1021622644 7:22563667-22563689 CCCGAAGCCCAGCTCTGCCCTGG - Intronic
1021761058 7:23903562-23903584 TGTGCAGTCCAGCTCTTCCCTGG - Intergenic
1022457828 7:30574405-30574427 CCACCAGTCCAGCTTTGGCAAGG - Intergenic
1022975228 7:35550252-35550274 CCTGCATTCAAGCTCTGGGCTGG - Intergenic
1023011054 7:35925093-35925115 TATGTAGCCCAGCTCTGGCCAGG + Intergenic
1023044029 7:36196458-36196480 AGTACAGTCCAGCTTTGGCCCGG - Intronic
1023291991 7:38678461-38678483 ACTGTGGGCCAGCTCTGGCCTGG - Intergenic
1023302809 7:38792027-38792049 TGTGAATTCCAGCTCTGGCCAGG - Intronic
1023863574 7:44228655-44228677 CCTGGAGTCCTGCCCTGGCGGGG - Intronic
1024080073 7:45848750-45848772 TATGTAGCCCAGCTCTGGCCAGG - Intergenic
1025078369 7:55962763-55962785 TCTGCAGCCCCGCACTGGCCTGG + Intronic
1025144828 7:56493905-56493927 CCTGGGGTCCAGCTCTGCACAGG + Intergenic
1025260415 7:57414360-57414382 CCTGGGGTCCAGCTCTGCACAGG + Intergenic
1026153406 7:67807473-67807495 CCTGCAACCCAGCTCTGCCAAGG - Intergenic
1026667814 7:72358918-72358940 ACTGCACTCCAGCTCCAGCCTGG + Intronic
1027002852 7:74666136-74666158 CCAACTGTCAAGCTCTGGCCAGG - Intronic
1027190605 7:75993915-75993937 CCTGCAGGGACGCTCTGGCCTGG - Intronic
1027979188 7:85195488-85195510 ACTGCACTCTAGCTCTAGCCTGG - Intergenic
1029733450 7:102452473-102452495 ACTGCACTCCAGCTCTGGCCTGG - Exonic
1030656490 7:112173917-112173939 CCAGCAGACCAGCCCTGGGCAGG + Intronic
1031995437 7:128227403-128227425 CCCGCACTCCTGCTCTGCCCAGG + Intergenic
1033116263 7:138628308-138628330 CCAGCAGCTCAGCACTGGCCAGG + Exonic
1033619333 7:143048421-143048443 CCTCCAGCCCTGCTCTGCCCAGG + Intergenic
1033661058 7:143402428-143402450 ACTGCACTCCAGCTCCAGCCTGG - Intronic
1033864587 7:145673283-145673305 GCTGCAGAACAGCTCTGTCCTGG + Intergenic
1034127224 7:148684412-148684434 ACTCCAGACCAGCTCTGGCCTGG - Intergenic
1034993401 7:155562289-155562311 CCTGAAGTCCAGCTCCACCCGGG - Intergenic
1035045167 7:155960936-155960958 CCTGAAGGCCAGCTCAGGGCAGG - Intergenic
1035899040 8:3437549-3437571 CCTGCAGTCCAGTTTTTCCCTGG - Intronic
1036049172 8:5176992-5177014 ACTGCACTCCAGCTCCAGCCTGG - Intergenic
1036593439 8:10190487-10190509 TCTCCAGATCAGCTCTGGCCTGG + Intronic
1036752206 8:11450507-11450529 TCTGCAGTCTAGCTCTGAGCTGG + Intronic
1036811977 8:11873339-11873361 ACTGCACTCCAGCTCCAGCCTGG - Intergenic
1037899853 8:22681566-22681588 CCTGCAGCCCAGGGCTGGCCTGG + Intergenic
1038680800 8:29665080-29665102 ACTGCACTCCAGCTCCAGCCTGG + Intergenic
1040997215 8:53414011-53414033 CATACACTCCAGCCCTGGCCGGG + Intergenic
1041026660 8:53693626-53693648 ACTGCACTCCAGCTTTGGCAAGG - Intergenic
1041179870 8:55236307-55236329 CATACAGTCCAGCCCTGGCCTGG + Intronic
1041357891 8:57021280-57021302 AGTACAGTCCAGCTTTGGCCCGG - Intergenic
1041729532 8:61050789-61050811 CCTGCAGCCCAGCGGTGGCAGGG + Intergenic
1041952960 8:63525124-63525146 CCTCCAGCTCAGCTTTGGCCTGG - Intergenic
1041967884 8:63701529-63701551 TCTGCAGACCAGTGCTGGCCAGG - Intergenic
1045054688 8:98358912-98358934 GCTGCAGTCCAGCTCAGGGGTGG - Intergenic
1048023175 8:130559440-130559462 GTTCCAGTCCAGCTCTGCCCAGG - Intergenic
1048073180 8:131041645-131041667 CCTGCCATCCAGATCTGGCCAGG + Exonic
1049379015 8:142302795-142302817 CCTGCACCCCAGGTCTAGCCTGG - Intronic
1049545173 8:143227468-143227490 CCAGCAGGCAACCTCTGGCCTGG - Intergenic
1049554251 8:143274329-143274351 CCTGCAGTGCTGCTCTGGACCGG - Intronic
1049572387 8:143375355-143375377 CCTCCTGTCCTGCTCTGGCCAGG + Intronic
1049615510 8:143574159-143574181 CGTGCAGTGCCACTCTGGCCAGG + Intergenic
1049747761 8:144270204-144270226 CCTGCATTCCCGCTCTGAGCTGG - Intronic
1052990031 9:34513740-34513762 CATTCAGACCAGCTCTGGCTGGG - Intronic
1054349915 9:64012198-64012220 CCTGATGTCCAGCTGGGGCCTGG - Intergenic
1057206178 9:93174099-93174121 ACTGCACTCCAGCTCCAGCCTGG - Intergenic
1057753365 9:97810001-97810023 CTTGAAGTCCAACTCTGTCCTGG - Intergenic
1059329816 9:113527857-113527879 CCTTGAGCCCAGCACTGGCCTGG + Intronic
1059333150 9:113549053-113549075 CCTGCAGGCCAGATCTAGGCTGG - Intronic
1060471596 9:123952540-123952562 CCTGCAGTGCAGCTCTTGCAGGG + Intergenic
1060548314 9:124473594-124473616 CGTGCAGGCCAGCCCTGGCATGG - Intronic
1060972988 9:127749347-127749369 CCTCGAGGCCAGCTATGGCCTGG - Exonic
1061542011 9:131282710-131282732 CCTCCACTCCCCCTCTGGCCGGG + Intergenic
1061661248 9:132131724-132131746 CATGCAGCCCAGCTCTGCTCAGG - Intergenic
1062104991 9:134750480-134750502 GCTGCAGCCCAGCCCTGGCCTGG + Intronic
1062222204 9:135422775-135422797 GCTGGTGCCCAGCTCTGGCCTGG + Intergenic
1062232030 9:135487125-135487147 CCTGCACAGCACCTCTGGCCTGG - Exonic
1062536454 9:137023203-137023225 CCTGTAGCCCAGCTGGGGCCAGG - Intronic
1187677699 X:21734300-21734322 CCTGCAGAACCGCTCTGGGCTGG - Intronic
1188100202 X:26073273-26073295 ACTGCAGACAAGCTCTGGTCTGG + Intergenic
1190817151 X:53938820-53938842 CCTGCCTTCCAGCTCTAGCGGGG + Exonic
1192119907 X:68445811-68445833 CCAGCAGACCATCTCTAGCCAGG + Intergenic
1192234877 X:69289382-69289404 CCTGCAGCCCAGCTTGGGCTGGG + Intergenic
1192259120 X:69493465-69493487 CCTGCAGGCCAGCGCAGACCTGG + Intergenic
1192362659 X:70449352-70449374 TCTGCAGGGCAACTCTGGCCTGG + Exonic
1193698511 X:84737962-84737984 CATGCACCCCAGCCCTGGCCTGG - Intergenic
1194810256 X:98380284-98380306 CATACATTCCAGCTCTGGCCGGG + Intergenic
1197038259 X:121904015-121904037 CATGCATCCCAGCCCTGGCCGGG - Intergenic
1198154778 X:133948014-133948036 CCCGCACTCCAGCTCTGTGCAGG - Intronic
1198448850 X:136745948-136745970 CATCCAGCTCAGCTCTGGCCTGG - Intronic
1198533055 X:137563928-137563950 GCGGCTGTCGAGCTCTGGCCGGG - Intergenic
1198996372 X:142578437-142578459 CCTGCAGCACACCTGTGGCCTGG - Intergenic
1199322310 X:146455247-146455269 CCTGCTCTCCATCTCTGGTCTGG - Intergenic
1202369701 Y:24188398-24188420 CCTGCAGTCCATTGCTGACCCGG + Intergenic
1202501084 Y:25481719-25481741 CCTGCAGTCCATTGCTGACCCGG - Intergenic