ID: 900180962

View in Genome Browser
Species Human (GRCh38)
Location 1:1310759-1310781
Sequence TCTGGGTCGTGGGCGGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 119}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900180943_900180962 29 Left 900180943 1:1310707-1310729 CCGTCCCCAGGGGGTGGGGCTGA 0: 1
1: 1
2: 3
3: 53
4: 411
Right 900180962 1:1310759-1310781 TCTGGGTCGTGGGCGGCTCTGGG 0: 1
1: 0
2: 0
3: 10
4: 119
900180947_900180962 24 Left 900180947 1:1310712-1310734 CCCAGGGGGTGGGGCTGAGGGTG 0: 1
1: 0
2: 10
3: 99
4: 741
Right 900180962 1:1310759-1310781 TCTGGGTCGTGGGCGGCTCTGGG 0: 1
1: 0
2: 0
3: 10
4: 119
900180957_900180962 -7 Left 900180957 1:1310743-1310765 CCTGTGCAGTCTTGGCTCTGGGT 0: 1
1: 0
2: 2
3: 19
4: 196
Right 900180962 1:1310759-1310781 TCTGGGTCGTGGGCGGCTCTGGG 0: 1
1: 0
2: 0
3: 10
4: 119
900180955_900180962 -6 Left 900180955 1:1310742-1310764 CCCTGTGCAGTCTTGGCTCTGGG 0: 1
1: 0
2: 0
3: 24
4: 242
Right 900180962 1:1310759-1310781 TCTGGGTCGTGGGCGGCTCTGGG 0: 1
1: 0
2: 0
3: 10
4: 119
900180953_900180962 -5 Left 900180953 1:1310741-1310763 CCCCTGTGCAGTCTTGGCTCTGG 0: 1
1: 0
2: 2
3: 31
4: 235
Right 900180962 1:1310759-1310781 TCTGGGTCGTGGGCGGCTCTGGG 0: 1
1: 0
2: 0
3: 10
4: 119
900180946_900180962 25 Left 900180946 1:1310711-1310733 CCCCAGGGGGTGGGGCTGAGGGT 0: 1
1: 1
2: 26
3: 108
4: 543
Right 900180962 1:1310759-1310781 TCTGGGTCGTGGGCGGCTCTGGG 0: 1
1: 0
2: 0
3: 10
4: 119
900180948_900180962 23 Left 900180948 1:1310713-1310735 CCAGGGGGTGGGGCTGAGGGTGG 0: 1
1: 2
2: 31
3: 239
4: 1347
Right 900180962 1:1310759-1310781 TCTGGGTCGTGGGCGGCTCTGGG 0: 1
1: 0
2: 0
3: 10
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900180962 Original CRISPR TCTGGGTCGTGGGCGGCTCT GGG Intronic