ID: 900183592

View in Genome Browser
Species Human (GRCh38)
Location 1:1323001-1323023
Sequence CAAGAGGCCAAATGGGAAAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 320}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900183585_900183592 2 Left 900183585 1:1322976-1322998 CCAGAGAGTGGGCAGAACAGGCA 0: 1
1: 1
2: 2
3: 23
4: 280
Right 900183592 1:1323001-1323023 CAAGAGGCCAAATGGGAAAGGGG 0: 1
1: 0
2: 2
3: 30
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900183592 Original CRISPR CAAGAGGCCAAATGGGAAAG GGG Exonic
900183592 1:1323001-1323023 CAAGAGGCCAAATGGGAAAGGGG + Exonic
900618986 1:3578372-3578394 CAAGAAGCCAAACGTGACAGTGG + Intronic
900672662 1:3865530-3865552 GAGGAGGCCAAATGGGAAAGCGG + Intronic
901130941 1:6962399-6962421 GAAGAGGCCAAATCGGAGGGCGG - Intronic
901427671 1:9192906-9192928 AAAGAAGCCAAGTGGCAAAGCGG + Intergenic
901455662 1:9361504-9361526 AAAGAGGCCACAGGGGACAGTGG - Intronic
902844784 1:19101452-19101474 CAAGAGGCTTCATGGCAAAGTGG + Intronic
906804216 1:48764468-48764490 ATAGAAGCCAAATGGGGAAGGGG + Intronic
907918772 1:58894298-58894320 CAAGTGGCCAAATGAGTAACGGG - Intergenic
909018141 1:70401686-70401708 TAAGAGACCAAATTGCAAAGAGG - Intergenic
909096693 1:71296637-71296659 CAAGAGGCCAAGAGAGAAAGAGG - Intergenic
909268584 1:73593936-73593958 CACGAGGTCAAATGGTTAAGTGG + Intergenic
910012806 1:82486388-82486410 CAAGAGGTTAAATGGGAAACAGG - Intergenic
911075658 1:93871759-93871781 CAAGAGTCCATACGGGATAGGGG - Intronic
912085412 1:105996399-105996421 GTAGAGGGCTAATGGGAAAGAGG - Intergenic
912352648 1:109028900-109028922 CCAGAGGCCAGAAGGGAAAGAGG - Intronic
912364428 1:109121500-109121522 CAATAGGCCAAAAGGGAATATGG + Intronic
912642999 1:111364982-111365004 AAAGAGGAGAAAAGGGAAAGGGG + Intergenic
912658103 1:111505597-111505619 CAAAAGGCAATCTGGGAAAGAGG + Intronic
913174940 1:116264946-116264968 CAAGAGGCCATATGGGAGCCTGG + Intergenic
915447355 1:155981565-155981587 CTGGAGCCCAGATGGGAAAGAGG - Intronic
915995078 1:160553736-160553758 CAAGAAGCCTACTGGGAAAGAGG - Intronic
916497463 1:165357990-165358012 AAAGAGGGGAAATGGCAAAGAGG + Intergenic
917840521 1:178973830-178973852 CCAGAGACCAAATAGGAAACAGG - Intergenic
918832946 1:189422186-189422208 GTTGAGGCCAAATGGGACAGTGG + Intergenic
920560969 1:206938209-206938231 CAAGAGTCTAAATGTGAAATGGG + Intronic
920905085 1:210156654-210156676 AAAGAGGTAAACTGGGAAAGTGG + Intronic
921129738 1:212209442-212209464 ACAGAGGGCAAATGGGACAGTGG + Intergenic
921592464 1:217020649-217020671 CAAGAAGTGAAATGGGACAGAGG + Intronic
922020538 1:221700031-221700053 AAAGAGGCAAAGAGGGAAAGAGG + Intergenic
922634550 1:227153863-227153885 CTAGAGCCAAAATGGGTAAGGGG + Intronic
923192305 1:231631003-231631025 CAAAAAGCCAAAGGGGAAATGGG - Intronic
923557689 1:235013655-235013677 CAAGAGGGCAAAAGTGGAAGCGG - Intergenic
923592120 1:235328255-235328277 TAAGAGGCCATCCGGGAAAGAGG - Intronic
923859896 1:237883302-237883324 CAAGATGGCAAATGGAAGAGTGG + Intronic
924508822 1:244711561-244711583 CCAGAGGGCACATTGGAAAGGGG - Intergenic
1064503925 10:16009064-16009086 CTAGAAGCCAAGTGGAAAAGAGG + Intergenic
1064818657 10:19298155-19298177 GAAAAGGCCAAAGGGGAAATGGG + Intronic
1065668287 10:28086402-28086424 CCAAAGGCCAAAGGGGAAACAGG + Intronic
1065943615 10:30587405-30587427 TAAGAGGCCAGCAGGGAAAGAGG - Intergenic
1067216716 10:44310070-44310092 CCAGAGGCCGAATGGGAGGGTGG - Intergenic
1068306171 10:55211153-55211175 AATGAGACCAAAGGGGAAAGTGG + Intronic
1068953204 10:62798703-62798725 GAAGAGGACAGATGGGGAAGCGG + Intergenic
1069640202 10:69950056-69950078 GAAGAGGCCAAAAGAGATAGTGG - Intronic
1069748511 10:70731354-70731376 CAAGAGGCTGAGTGGGAAGGAGG - Intronic
1070577201 10:77688095-77688117 CAAAAGGGCAAAAGGCAAAGGGG - Intergenic
1072129671 10:92481872-92481894 ATAGAGGCCAAATGGAAAAGTGG + Intronic
1072566025 10:96617428-96617450 CAGGAGGCCAAACTGGAAAGGGG + Intronic
1073753531 10:106557076-106557098 CAAAAGGACAAATGAGGAAGTGG - Intergenic
1073947296 10:108765773-108765795 AAAGGGGCTAAATGGGAAGGTGG + Intergenic
1074707850 10:116151408-116151430 TAGAAGGCCAAATGGGGAAGGGG + Intronic
1075391173 10:122093343-122093365 ACAGAGACCAAATGGGAAGGAGG - Intronic
1075742494 10:124704426-124704448 CAAGAGGGAAAAAGGAAAAGAGG + Intronic
1076593632 10:131609431-131609453 GCACAGGCCACATGGGAAAGGGG + Intergenic
1076673671 10:132136684-132136706 GAGGAGGCCACATGGGAAATGGG + Intronic
1079459493 11:20668024-20668046 TAAAGGGCCAAATGGGACAGTGG + Intergenic
1080029045 11:27641643-27641665 GAAAAGACCAAATGGGAAAAAGG + Intergenic
1080925373 11:36750628-36750650 CATGAGGGCAAATGGCAATGAGG + Intergenic
1081011414 11:37817425-37817447 GAAGAGGAGAAATGGGAAAAAGG + Intergenic
1081129842 11:39365346-39365368 AAACATTCCAAATGGGAAAGAGG + Intergenic
1081659585 11:44879812-44879834 CTGGAGGCCAGATGGCAAAGCGG + Intronic
1082820759 11:57543287-57543309 CAAGGAGCCCGATGGGAAAGAGG + Exonic
1085271036 11:75269976-75269998 CCAGAGCCCAGTTGGGAAAGAGG + Intronic
1085630392 11:78110804-78110826 CAGCAGGCCAAAGGGGAAAGGGG - Intronic
1086447893 11:86887340-86887362 CAAGATGTGAAATGGGAAATGGG + Intronic
1087530715 11:99377915-99377937 CAAGAGACCAAATGAGGAAATGG - Intronic
1089460379 11:118649750-118649772 CAAGAGGCCAGATATGAACGTGG - Intronic
1090051393 11:123382896-123382918 CAAGAGGAGAATTGGGACAGGGG - Intergenic
1090951117 11:131474301-131474323 TAAGAGGAAAACTGGGAAAGGGG - Intronic
1091888973 12:4037970-4037992 AAAGAGGCAAAATGGAAAAGGGG - Intergenic
1092093465 12:5822905-5822927 CAAGAGGGCAAGAGAGAAAGAGG + Intronic
1092559506 12:9596209-9596231 CAAGAGGCTACATGAGAAAATGG - Intronic
1092938089 12:13382641-13382663 CAAGAGGGAAAAGAGGAAAGAGG + Intronic
1092961216 12:13598363-13598385 GATGAGGCCATATGGGAAGGAGG - Intronic
1093890718 12:24517190-24517212 CAAGAGGCAGCAAGGGAAAGGGG - Intergenic
1094125978 12:27022691-27022713 CAAGAGGCAAAACTTGAAAGTGG + Intronic
1094771409 12:33664968-33664990 CAAGACGTCACATGGCAAAGGGG - Intergenic
1094777861 12:33752786-33752808 CCAGAGGCCAAATGGGAAGTGGG - Intergenic
1095269658 12:40203024-40203046 CAAAAGACCAAATAGAAAAGTGG - Intronic
1095960700 12:47832792-47832814 CAAGAGGCCAAGTGGGGAGGAGG - Intronic
1096385333 12:51191491-51191513 CAAGGGGGCATATGGAAAAGGGG + Intronic
1097269593 12:57765880-57765902 CAAGATGCCCAATGGTAGAGTGG + Intronic
1100744307 12:97628680-97628702 CACGAGGACAAATTTGAAAGTGG + Intergenic
1100950400 12:99842605-99842627 CAAGAGGAAACATGGGTAAGAGG - Intronic
1101390999 12:104300315-104300337 AAAGAGGAAAAAGGGGAAAGAGG + Intronic
1102759387 12:115372361-115372383 CAACAGGCCTAATGAGAAAGGGG - Intergenic
1102796669 12:115695004-115695026 CAGGAGGCAGAATGGGAAAGTGG - Intergenic
1103086191 12:118062683-118062705 CAGGAGGCCAAACGGGACACAGG - Intergenic
1104072382 12:125356873-125356895 CAAGAGGCCCAGTGGGGCAGGGG - Intronic
1104166447 12:126234915-126234937 CATGAGGTCAAATGTGACAGAGG - Intergenic
1106909066 13:34443691-34443713 CCTGTGGCCAAATGGGAAACAGG - Intergenic
1107723452 13:43273677-43273699 CAGCAGGCCAAAGGGGTAAGTGG - Intronic
1108817448 13:54308894-54308916 CACCAGGCCAAAAGAGAAAGGGG + Intergenic
1109208381 13:59506593-59506615 CAAGAGGCAACAAAGGAAAGTGG - Intergenic
1109350168 13:61169874-61169896 CAACAGTTTAAATGGGAAAGAGG - Intergenic
1109381796 13:61571236-61571258 CAATAGGACAAATGAGAAAAAGG + Intergenic
1109772433 13:66994409-66994431 TAAGAAGCCAGATGGCAAAGCGG + Intronic
1110471690 13:75866843-75866865 CCATGGGCCAGATGGGAAAGTGG - Intergenic
1112006506 13:95258352-95258374 CAAGGGGACAAACGGGAATGTGG - Intronic
1112768428 13:102771778-102771800 CAACAGGTGAAATGGGGAAGGGG + Intronic
1112792823 13:103021944-103021966 AAAGAGGCCACTTGGGATAGTGG - Intergenic
1114473191 14:22977793-22977815 CAGGAGGCCCACTTGGAAAGGGG - Intronic
1115630246 14:35237627-35237649 GAAAAGGCAAAATTGGAAAGGGG - Intronic
1115984989 14:39095690-39095712 AAAGAGACCAAATGTAAAAGTGG - Intronic
1117156200 14:52944496-52944518 CAAGATGCACACTGGGAAAGAGG - Intronic
1118123136 14:62868350-62868372 CAACAGGCCAAATGGCAAGTAGG + Intronic
1118649707 14:67877512-67877534 CTAGAAGCCCAATGGGAAATGGG - Intronic
1118886688 14:69873100-69873122 CAAGAGTCCAGTTGGAAAAGGGG - Intronic
1121394341 14:93606271-93606293 AAAGTGGCCAGATGGAAAAGAGG + Intronic
1121661877 14:95641121-95641143 CAAGAGGCTCATTGGGAATGGGG + Intergenic
1121834589 14:97080394-97080416 CAAGAGGCAAGTTGGAAAAGGGG + Intergenic
1124415878 15:29473002-29473024 CAAGAGGCCAGTTAGGAAGGGGG + Intronic
1124632468 15:31345428-31345450 CAGGTGCCCGAATGGGAAAGAGG - Intronic
1126145455 15:45469276-45469298 AAAGTGGCCAAGTGGGAAAAGGG - Intergenic
1127484691 15:59408136-59408158 CAAGATGCCAAAAGGGAAGAAGG - Intronic
1127500912 15:59553469-59553491 GAAGAGGCCAAAGAGGAAGGTGG + Intergenic
1127674726 15:61228599-61228621 CAAGAGGAGAAAAGGTAAAGCGG + Intronic
1127897529 15:63315559-63315581 GAAGAGACCATAGGGGAAAGAGG + Intergenic
1129360446 15:75020889-75020911 CAAGAGAGAAAATGGGAGAGGGG - Exonic
1129480691 15:75823264-75823286 CAAGATGCAAAATGGAAATGAGG + Intergenic
1131473205 15:92714199-92714221 CAAAAGGACAAATGGGACTGTGG + Intronic
1131944545 15:97605446-97605468 AAACAGGCCAAATGGCAAAAGGG - Intergenic
1132488462 16:210636-210658 CGAGGGGTCAAATGGGAAATAGG + Intronic
1136589203 16:31207231-31207253 CAGGAGGCCACATGGCAAAGGGG - Intergenic
1137582737 16:49643744-49643766 AAAAAGGCCAAATAGGAAATGGG + Intronic
1138352889 16:56355828-56355850 CAAGAGGGCATGTGGGAAGGTGG + Intronic
1138593979 16:58019529-58019551 CAAGGGCGCAGATGGGAAAGTGG - Intronic
1142128185 16:88420476-88420498 CAGGAGGCCCAATTGGACAGTGG + Intergenic
1142715635 17:1745502-1745524 CCAGAGGCCAGAAGGGAGAGAGG + Intronic
1143448856 17:7023871-7023893 GGCGGGGCCAAATGGGAAAGGGG + Intronic
1143476673 17:7207204-7207226 CAAGAGGGAACATGGGAAAGGGG + Intronic
1145126557 17:20304910-20304932 CAAGAGGCCAGATGAGAAGGAGG + Intronic
1146569900 17:33943297-33943319 CATGAGGGCAGATGGGGAAGTGG - Intronic
1147398786 17:40166158-40166180 CAATAGGCAAAATGGGTAATAGG - Intronic
1147443581 17:40461896-40461918 AAGGAGACCAAATGGGACAGGGG + Intergenic
1148113761 17:45162550-45162572 CAAGGGGCCAAATGGGATTCAGG - Exonic
1148179396 17:45592781-45592803 CAGAAGGGCAAATGGAAAAGGGG + Intergenic
1148695241 17:49554900-49554922 CAGGAGGCCACAAGGGGAAGGGG + Intergenic
1148794662 17:50191238-50191260 AAAAAGGCCAGAGGGGAAAGGGG + Intronic
1149511299 17:57243904-57243926 CGAGAGGCCAAAGGAGAAAATGG + Intergenic
1150316696 17:64175050-64175072 CAAGAGCCAAAATGGGAATAGGG - Intronic
1150495127 17:65601934-65601956 CAAAAGTCAAAATGGGAAATTGG - Intronic
1150760812 17:67959227-67959249 AAAGAGCCCAGATGGGACAGGGG + Intronic
1152072851 17:78142592-78142614 GATGAGGCCAAGAGGGAAAGAGG + Exonic
1153952375 18:10068221-10068243 ACAGAGGGCAAATGTGAAAGTGG + Intergenic
1155316672 18:24578413-24578435 CACAAGGCCAGATGGCAAAGAGG + Intergenic
1155546335 18:26919713-26919735 CCAGAGGCCACAGGGGAAGGTGG - Intronic
1155757755 18:29522986-29523008 CATGAGGCAAAGTGGGAAAAAGG - Intergenic
1156253000 18:35370109-35370131 CAAGGGGCCAAAAAGGAATGTGG + Intronic
1159038420 18:63299446-63299468 AAGGAGGCCAGATGGGAAGGTGG - Intronic
1159994452 18:74950034-74950056 TTTGAGGCCAAATGGGAAATGGG + Intronic
1163874467 19:19855702-19855724 CAAGAGGAGAAAGGGGAACGTGG + Intergenic
1163876311 19:19872232-19872254 CAAAAAGACAAAGGGGAAAGTGG - Intronic
1163879906 19:19910097-19910119 CAAGAGGAGGAAGGGGAAAGTGG - Intronic
1163882879 19:19942750-19942772 CAAGAGGAGGAAGGGGAAAGTGG + Intergenic
1163904065 19:20135979-20136001 CAAGAGGAGGAATGGGAAAGTGG + Intergenic
1163918690 19:20266875-20266897 CAAGAGGAGGAAGGGGAAAGTGG + Intergenic
1164044381 19:21523149-21523171 CAAGAGGAGGAAGGGGAAAGTGG - Intronic
1164140668 19:22459189-22459211 CAAGAGGAGAAAGGGGAACGTGG - Intronic
1164339928 19:24382281-24382303 CAAGAGGCCTAAGGTGAAAAAGG + Intergenic
1164914038 19:32035723-32035745 CAAGAAGCCAAGGGAGAAAGAGG + Intergenic
1166147042 19:40845022-40845044 CAAAAGGCCGAATGGAAAGGGGG + Intronic
1166151197 19:40876919-40876941 CAAAAGGCCTAATGGAAAGGGGG + Intronic
1166179105 19:41094686-41094708 CAAAAGGCCTAATGGAAAGGGGG - Intronic
1166205072 19:41264407-41264429 CAGGAGGCGAAGGGGGAAAGGGG - Exonic
1167833865 19:52050173-52050195 TAAGAGGGCACAGGGGAAAGGGG - Intronic
926095454 2:10078652-10078674 CAAAAGGCCACAGGAGAAAGCGG - Intronic
926275878 2:11402829-11402851 CAAGAGACCAGATGGGAAGAAGG + Intergenic
926521183 2:13916203-13916225 CAAGAGCCAAAATGACAAAGAGG - Intergenic
926584046 2:14665716-14665738 CAAGAAGCCAAGTTGGAAAGAGG + Intergenic
926702003 2:15810076-15810098 CAAGAGGGCAAGAGGGCAAGAGG - Intergenic
926969330 2:18451398-18451420 CAGGAGGCCAGAAGGGAAACTGG - Intergenic
927293544 2:21427624-21427646 CAAGAAGCCAGATTGGAGAGGGG - Intergenic
927601394 2:24444937-24444959 TAAGATGTCAAATGGGAAATAGG - Intergenic
927879796 2:26682296-26682318 CAAAAGGACAATTGGGAAAGTGG - Intergenic
928178830 2:29053357-29053379 ACAGAGGCAAGATGGGAAAGTGG - Exonic
929670978 2:43876264-43876286 CAAGAGGCAAAAGGGCAGAGGGG - Intronic
932018551 2:68058866-68058888 CAAGTGGCCACAGAGGAAAGAGG + Intronic
932126721 2:69151569-69151591 CAAGTGGCTACATGGGAATGAGG - Intronic
932127208 2:69155118-69155140 TAAGAGCCCAAATGGGGGAGTGG - Intronic
933267704 2:80200130-80200152 CAAGGGTCAAAATGGGAAAGTGG - Intronic
933431067 2:82179934-82179956 CAATAGCCCAGATGTGAAAGAGG - Intergenic
933769100 2:85731942-85731964 CAAGAAGCCTAATGAGGAAGAGG - Intergenic
934922708 2:98359063-98359085 GGAGAGGGCAAAAGGGAAAGAGG + Intronic
935070669 2:99691013-99691035 CATGAGGGCAAATGAGAAATGGG - Intronic
935334022 2:101998404-101998426 CCAGATGGCAAATTGGAAAGAGG - Intronic
935371437 2:102350965-102350987 ATAAATGCCAAATGGGAAAGGGG + Intronic
936370215 2:111897503-111897525 GATGAGGCCAAAGAGGAAAGGGG + Intergenic
936804647 2:116314770-116314792 GAAGAGGAGAAATGAGAAAGAGG + Intergenic
938742424 2:134245461-134245483 CAGGTGGACAAAAGGGAAAGAGG - Intronic
942249924 2:174038797-174038819 CCAGAAGCCAAATGGGGAGGGGG + Intergenic
947241029 2:227994867-227994889 ACAGAGGCCAAATGGAAAATGGG - Intronic
948093749 2:235316969-235316991 CAGGAGGTGAAATGGGAGAGTGG + Intergenic
948593076 2:239063641-239063663 CACGAGGCAGAAGGGGAAAGGGG - Intronic
1169005230 20:2201127-2201149 CAAGGGAACAAATGGGAAATTGG - Intergenic
1169266558 20:4170762-4170784 CAAGAGGCCACATTGGACACAGG - Intronic
1169298767 20:4423764-4423786 CATGAGGACAGATGGGATAGGGG + Intergenic
1169593304 20:7169663-7169685 AAGAAGGACAAATGGGAAAGAGG + Intergenic
1169912942 20:10662075-10662097 AAAGAGGCCAAATAGGCAAGTGG + Intronic
1169986816 20:11454204-11454226 CAAGAGGTCAAATGGGACAAGGG + Intergenic
1170117526 20:12876377-12876399 CAAGAAGCCAGAAGAGAAAGTGG + Intergenic
1170125578 20:12959820-12959842 CAGGATCCCAAATGGGAAATAGG + Intergenic
1170738661 20:19033318-19033340 CAAGTGGTCACAGGGGAAAGGGG - Intergenic
1171183702 20:23110032-23110054 CAGGAGGGCACATGGGAAGGAGG + Intergenic
1172439027 20:34952402-34952424 CAAGAGGCCTGATGGGAAGGAGG + Intronic
1172919354 20:38468330-38468352 CAAGAAGGCAAGTGGGGAAGAGG + Intergenic
1173478868 20:43383576-43383598 CAAGATTCCACATGGGAAGGAGG + Intergenic
1173738136 20:45376167-45376189 CTAGAGGCCAAATCAGAAAGAGG + Intronic
1173958736 20:47055046-47055068 CAAGATGACATATGGTAAAGAGG - Intronic
1174138025 20:48393846-48393868 CAAGAGTCCTTATGGGAAACAGG + Intergenic
1175183999 20:57167522-57167544 CAGAGGGCCAAAAGGGAAAGTGG + Intergenic
1176718657 21:10376135-10376157 CAAGATGCCAGATGGAGAAGGGG - Intergenic
1178556943 21:33600525-33600547 GAAGAGGACAAAAGGGAAAGGGG + Intronic
1179198725 21:39193101-39193123 CAGAAGGGCAAATGGAAAAGGGG - Intronic
1180228514 21:46412663-46412685 CAGCAGGCCACATGGGAACGGGG - Intronic
1180299887 22:11029029-11029051 CAAGATGCCAGATGGAGAAGGGG - Intergenic
1181781310 22:25195580-25195602 CAAGAAGCCAAAAGAGAAATAGG + Exonic
1182006750 22:26966730-26966752 GAAGAGGCCAAATTGGAAGCTGG - Intergenic
1182510646 22:30817518-30817540 CAAGGGTGCAAAGGGGAAAGGGG + Intronic
1182985489 22:34712368-34712390 CATGAGGCTATCTGGGAAAGAGG - Intergenic
1184668309 22:46000051-46000073 GCAGAGGCAAAAAGGGAAAGGGG + Intergenic
954100811 3:48371181-48371203 AAAGAGGACAGATGAGAAAGAGG - Intergenic
955366868 3:58318270-58318292 CATAAGGCCAAACTGGAAAGTGG - Exonic
957872065 3:86101985-86102007 CAAGAGCCCAAATGGACAAATGG - Intergenic
958926299 3:100161276-100161298 CAAATGGCCAAATAGGAAAATGG + Intronic
959211937 3:103396172-103396194 CATGAAGCCAGATGTGAAAGTGG + Intergenic
959628615 3:108482406-108482428 GAAGAAGCCAAAAGGGAGAGTGG + Intronic
960242981 3:115367071-115367093 CAAGAGGGAAAAGGGGAGAGGGG + Intergenic
960389076 3:117054743-117054765 CAACAAGCCAAATGGAAAAAGGG + Intronic
962359638 3:134727002-134727024 AAAGAGGAGAAATGGGACAGGGG - Intronic
963667157 3:148202612-148202634 CCAGAGGGCAAATGAGGAAGGGG - Intergenic
963912951 3:150830520-150830542 CAAGTGGCCAGATGTGACAGAGG + Intergenic
964900948 3:161658109-161658131 CATCAGGCAAAAGGGGAAAGGGG - Intergenic
965307365 3:167083181-167083203 AAAGAAGCCAAATGGTTAAGGGG - Intergenic
965612206 3:170556334-170556356 CCAGAGGCAATATGGCAAAGTGG + Intronic
965862480 3:173163505-173163527 CAAACGGATAAATGGGAAAGTGG + Intergenic
965967685 3:174514626-174514648 AAAGAGCCCAAATGTGAAATAGG - Intronic
967402681 3:189081325-189081347 CAAGAGGCAGAAGGAGAAAGAGG + Intronic
969855592 4:9996641-9996663 CAAATGCCCAAAGGGGAAAGGGG - Intronic
969937499 4:10696716-10696738 AATGAGGGCAAATGGGAAAGTGG - Intergenic
971284420 4:25273934-25273956 CAAGAGCACCACTGGGAAAGGGG - Intronic
971412084 4:26384884-26384906 CAAGAGGCAAGAGGGGAGAGGGG - Intronic
972358060 4:38300496-38300518 CAAGAGACAAAATGACAAAGAGG + Intergenic
973029249 4:45314590-45314612 CAAGATGCCAAAGGTGAATGTGG + Intergenic
973654249 4:53029343-53029365 CAAGAGGCAAGAGGGGAATGAGG + Intronic
974339095 4:60590701-60590723 CATTATGCCAAATGGGAAAAGGG + Intergenic
975804734 4:78099937-78099959 CTGGAGGCCACAGGGGAAAGAGG + Intronic
976520028 4:86016181-86016203 CAAGAGGCCACTGGAGAAAGTGG - Intronic
978239603 4:106499729-106499751 CAAGAAGCCAAAGTGGAAAGGGG - Intergenic
978885809 4:113764745-113764767 CAAGTTGCCAAAGAGGAAAGAGG - Intergenic
979472609 4:121118408-121118430 CAATAGCCCACAAGGGAAAGGGG - Intergenic
981414611 4:144477446-144477468 CAAGAGGACACAAGGGGAAGAGG - Intergenic
981415860 4:144492656-144492678 CAGGAGTACAAAAGGGAAAGGGG + Intergenic
982123368 4:152162897-152162919 GAAGAGGAGAAAGGGGAAAGGGG + Intergenic
982693140 4:158570734-158570756 CAAGGGGCCAATTAGGAAACAGG - Intronic
983321953 4:166206022-166206044 AAAGAGGCTAAATGTGAGAGGGG - Intergenic
983478015 4:168239746-168239768 TAGCAGGCCATATGGGAAAGAGG + Intronic
985352403 4:189079219-189079241 CAAAAGTCCCAATGGGAAAATGG + Intergenic
986805903 5:11308943-11308965 GAAGAGGGCAAAGGGGAACGTGG + Intronic
989331307 5:40262085-40262107 CAAGAGACTAAATGCCAAAGAGG + Intergenic
990148933 5:52794685-52794707 CAAAAGGGTAAAAGGGAAAGTGG - Intronic
992283161 5:75203226-75203248 CAGGAGGCCAAATGGGCAGGAGG + Intronic
992717836 5:79529298-79529320 CAAGATGCCAAAAGGAAAAAAGG + Intergenic
992930810 5:81643057-81643079 CAGGAAGCCAAATGGCAAGGAGG - Intronic
995807476 5:116069540-116069562 CAACAAGACAAATGTGAAAGAGG + Intergenic
998360535 5:141582419-141582441 CAAGATTAAAAATGGGAAAGGGG - Intronic
998481987 5:142470321-142470343 CATGAGGCCCCAAGGGAAAGGGG - Intergenic
998706834 5:144771839-144771861 CAAGAGGCCATGTGGGACATGGG - Intergenic
998718048 5:144908564-144908586 TAAATGGCCAAAGGGGAAAGTGG + Intergenic
998823849 5:146081523-146081545 GAAGAAGCAAAAGGGGAAAGGGG + Exonic
998840871 5:146252273-146252295 CAAGGGGCAAAAGGGGAAAAAGG - Intronic
1001162733 5:169335824-169335846 CTGGAGGCCAAGTGGGAAGGAGG - Intergenic
1001942325 5:175749660-175749682 TCATAGGTCAAATGGGAAAGAGG - Intergenic
1003088619 6:3082127-3082149 CAAGAATCCAAAAGGGGAAGCGG + Intronic
1004485722 6:16064759-16064781 CAGGAGACCAAATGGCACAGCGG - Intergenic
1006100392 6:31682833-31682855 GAAGAGGGCAAAGGGCAAAGGGG + Intronic
1006257520 6:32843684-32843706 GAAGAGGCCACATGGGGATGGGG - Intronic
1006401565 6:33820863-33820885 CAAGAGGCCAAATGGGAGAATGG + Intergenic
1006744233 6:36330309-36330331 CAGGAGGCCAAGGGGGAAGGAGG - Exonic
1008440533 6:51527268-51527290 CAAGATGGCAAATCTGAAAGAGG - Intergenic
1010220073 6:73441301-73441323 GGAGAGGCCAGATGGGCAAGAGG + Intronic
1012103808 6:95127195-95127217 CAAGAGGCCAACTGCAAAAATGG - Intergenic
1013301636 6:108809651-108809673 CAAGATCCCAGATGGGAAATGGG + Intergenic
1014526015 6:122502466-122502488 GAAGAGGGCAAAGGGGAAACAGG + Intronic
1016347243 6:143127257-143127279 GGAGAGAACAAATGGGAAAGAGG - Intronic
1019854783 7:3593750-3593772 CAAGAGGGCATATGGCACAGTGG + Intronic
1021340308 7:19456216-19456238 CAAGAGGGAAAATGGCAAACAGG - Intergenic
1021951226 7:25776876-25776898 CAAGAGGCCACATGGAGCAGGGG - Intergenic
1022460091 7:30596233-30596255 GAAGAGGACAGATGGCAAAGTGG - Intronic
1022512282 7:30946614-30946636 AAAGAGCACAAATGGGAAGGAGG - Intronic
1024490422 7:49975905-49975927 AAAGAAGCCAAGTTGGAAAGGGG - Intronic
1027389478 7:77691107-77691129 CAAGAGGCTTCATGGGCAAGTGG + Intergenic
1027395729 7:77751843-77751865 CAAGAGGCCCAATAGAAAACCGG - Intronic
1028016123 7:85715126-85715148 GAAGAAGCCAAATGGTAATGTGG + Intergenic
1028264220 7:88703519-88703541 AAAAAGGACAAATGGGAAAATGG - Intergenic
1030003823 7:105095564-105095586 CAAAAGGCCAAAAGGGGTAGAGG - Intronic
1031621008 7:123933479-123933501 GAAGTGACAAAATGGGAAAGGGG + Intronic
1032300608 7:130682658-130682680 CAAGAGGGCTAATGGAGAAGAGG + Intronic
1033313829 7:140281884-140281906 TAAGAGGCATGATGGGAAAGCGG - Intergenic
1034204750 7:149305597-149305619 ATAGAGGCCCAATGGGAAGGGGG + Intergenic
1035172074 7:157022295-157022317 CTAGAGGCCAGGTCGGAAAGGGG + Intergenic
1035666120 8:1380965-1380987 CAAAAGGCCAAAAAGGAAAAAGG + Intergenic
1039084212 8:33763761-33763783 AAATAGACCAAATGGGGAAGGGG - Intergenic
1041758192 8:61336613-61336635 AAAGAGGCCAAAGCAGAAAGAGG + Intronic
1041801187 8:61802009-61802031 TAAGAAGCAAAATGAGAAAGAGG - Intergenic
1043566781 8:81558004-81558026 CAGGAGGCCAGCTGGGGAAGAGG + Intergenic
1044208620 8:89522543-89522565 AAAGAGGCCAATTTGGGAAGTGG + Intergenic
1044766744 8:95584109-95584131 CAAGAGGTCAAATGGAAATTAGG + Intergenic
1045732088 8:105254600-105254622 AAAGAAGCCAATTCGGAAAGAGG - Intronic
1046806811 8:118487656-118487678 CAAGAGGTCATTTGGGAAACTGG - Intronic
1047085018 8:121506528-121506550 CAAGAGGCAGAAAGAGAAAGGGG - Intergenic
1047569455 8:126082346-126082368 CAGGAAGCCAGATGGCAAAGAGG - Intergenic
1047747884 8:127858568-127858590 CAAAAGGCCAGATGTCAAAGTGG + Intergenic
1048072004 8:131030929-131030951 CAAGAGGCCAAAATGGTAAAAGG - Intronic
1048523801 8:135182477-135182499 CTAAGGGCCAAATTGGAAAGAGG + Intergenic
1049150984 8:141035430-141035452 CAGGAGGGGAGATGGGAAAGAGG - Intergenic
1050353296 9:4760720-4760742 CAAGAGACACAAAGGGAAAGAGG - Intergenic
1050535654 9:6628461-6628483 AAAGAGACCAAATGAGAAAAGGG + Intronic
1053263839 9:36695840-36695862 CCAGAGGCCAAAGGTGAGAGTGG + Intergenic
1055272945 9:74582352-74582374 CAAGAGGGCAAATGGGCCAGTGG + Intronic
1055902556 9:81257879-81257901 CCAGAGGCAAAAAGGCAAAGAGG + Intergenic
1056126397 9:83539175-83539197 TAAGAGGTCTAATGGCAAAGCGG + Intergenic
1056139605 9:83663101-83663123 AAAGAGGAAAAAGGGGAAAGGGG + Intronic
1056304826 9:85279720-85279742 CATTAGTGCAAATGGGAAAGAGG - Intergenic
1056558082 9:87706484-87706506 AAAGATGCCACATGGGAAGGGGG - Exonic
1056661254 9:88545305-88545327 CAAGAGGCCACAGGGGAAGCTGG - Intronic
1056902751 9:90615263-90615285 CATGAGGCAAAATGAGAAGGTGG - Intronic
1057167268 9:92938880-92938902 CAAGAGGAAGAAGGGGAAAGGGG - Intergenic
1057554369 9:96075884-96075906 TAAGAAGCCAAATGTGAATGTGG - Intergenic
1058770328 9:108224894-108224916 AAAGAAGCCAAATGGGGCAGGGG - Intergenic
1059476281 9:114550533-114550555 CCAGGGGGCAACTGGGAAAGAGG + Intergenic
1061432172 9:130537881-130537903 GATGAGGCCAAAAGGGAAATTGG - Intergenic
1061593601 9:131614437-131614459 CTAAAGGCCAAACAGGAAAGGGG - Intronic
1185541936 X:909055-909077 CAAGATGCCAGATGGAGAAGGGG + Intergenic
1186137768 X:6537306-6537328 CCAGAGGCCAGAAGGGGAAGGGG - Intergenic
1186298427 X:8173318-8173340 CCAGAGGCCAGAAGGGGAAGCGG - Intergenic
1186324351 X:8462587-8462609 CCAGAGGCCAGAAGGGGAAGGGG + Intergenic
1186485234 X:9929517-9929539 CAAGAGACCCACTGAGAAAGTGG - Intronic
1186575385 X:10759895-10759917 GAAGAGGCCAAATGGGAATCTGG + Intronic
1187037524 X:15557465-15557487 CAAGAGAAAAAAGGGGAAAGTGG + Intergenic
1187970671 X:24654908-24654930 CATGTGGACAACTGGGAAAGTGG - Intronic
1190713826 X:53087981-53088003 GAGGAGGGCAAATGGGATAGTGG - Exonic
1190916575 X:54815591-54815613 GAAGAGCCCAAATGTGAGAGTGG - Exonic
1195001650 X:100648577-100648599 AAAGAGGGGAAATGGGAAAATGG + Intronic
1195105990 X:101601582-101601604 CAAGAGGCAATAAGGGAAAATGG - Intergenic
1195106893 X:101612185-101612207 CAAGAGGCAATAAGGGAAAATGG + Intergenic
1195303212 X:103552835-103552857 CAAGAGGGAAAAAGGGAGAGAGG - Intergenic
1195902843 X:109816580-109816602 TTAGAGAACAAATGGGAAAGAGG - Intergenic
1196149746 X:112360177-112360199 GAAGAGGTCAAAGGAGAAAGAGG - Intergenic
1198567815 X:137922909-137922931 CAAGAGGAGAAATGGGACTGTGG + Intergenic
1199726486 X:150587801-150587823 CTAGAGGCCAAATTGGAAATGGG + Intronic
1200054335 X:153450876-153450898 CAAGGGGTCAGATGGGAAACGGG + Intronic
1201867930 Y:18674108-18674130 TAAGAGGCCTAACAGGAAAGGGG - Intergenic