ID: 900183781

View in Genome Browser
Species Human (GRCh38)
Location 1:1323944-1323966
Sequence CTGAGGGTCTGGGGGTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 610
Summary {0: 1, 1: 0, 2: 4, 3: 58, 4: 547}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900183781 Original CRISPR CTGAGGGTCTGGGGGTCTGC TGG Intronic
900108315 1:995573-995595 CTGAGGGTCCAGTGATCTGCAGG - Intergenic
900183768 1:1323912-1323934 CTGGGGGACTGGGGGGCTGAGGG + Intronic
900183776 1:1323928-1323950 CTGAGGGGCTGGGGGGCTGAGGG + Intronic
900183780 1:1323936-1323958 CTGGGGGGCTGAGGGTCTGGGGG + Intronic
900183781 1:1323944-1323966 CTGAGGGTCTGGGGGTCTGCTGG + Intronic
900183791 1:1323968-1323990 CTGAGGGGCTGGGGGACTGAGGG + Intronic
900183798 1:1323984-1324006 CTGAGGGGCTGGGGGACTGAGGG + Intronic
900183799 1:1323992-1324014 CTGGGGGACTGAGGGTCTGCTGG + Intronic
900183802 1:1324000-1324022 CTGAGGGTCTGCTGGGCTGAGGG + Intronic
900183819 1:1324040-1324062 CTGGGGGGCTGGGGGGCTGAGGG + Intronic
900183824 1:1324056-1324078 CTGAGGGACTGAGGGGCTGAGGG + Intronic
900183841 1:1324104-1324126 CTGGGGGGCTGAGGGTCTGCGGG + Intronic
900183844 1:1324112-1324134 CTGAGGGTCTGCGGGGCTGAGGG + Intronic
900183854 1:1324128-1324150 CTGAGGGGCTGGGGGGCTGGGGG + Intronic
900183857 1:1324136-1324158 CTGGGGGGCTGGGGGGCTGAGGG + Intronic
900183865 1:1324152-1324174 CTGAGGGGCTGGGGGGCTGAGGG + Intronic
900183882 1:1324200-1324222 CTGGGGGGCTGAGGGTCTGCGGG + Intronic
900183885 1:1324208-1324230 CTGAGGGTCTGCGGGGCTGAGGG + Intronic
900301622 1:1980832-1980854 CTGAGGGTCTCGGTTTCTGAGGG - Intronic
900309843 1:2028425-2028447 CAGAGGCCCTGGGGGCCTGCGGG - Intronic
900319254 1:2074426-2074448 TTGTGGGTCTGTGGGTCTGTCGG + Intronic
900384905 1:2406039-2406061 CTCAGGGTGTGGGGCTCGGCCGG + Intronic
900429601 1:2595492-2595514 GTGAGGGGCTGGGGGGCTCCGGG + Intronic
900868011 1:5282601-5282623 CTGTGGGTCTGTGGGTCTGTGGG + Intergenic
901002573 1:6155880-6155902 CTGCGGGGCTGCGGGGCTGCAGG - Intronic
901761534 1:11474951-11474973 CTCAGAGCCTGGGTGTCTGCAGG + Intergenic
901823880 1:11847968-11847990 CTGAGGGTCTGGGGGGCTGTTGG - Intronic
902067442 1:13700141-13700163 CTGCGGGGCTGGGGGGCTCCGGG - Intergenic
902466174 1:16620104-16620126 CTGAGGGTATGGGGGCCAGATGG - Intergenic
902508516 1:16953199-16953221 CTGAGGGTATGGGGGCCAGATGG + Intronic
902551641 1:17223078-17223100 CTGAGGGACTGCTGGACTGCAGG + Intronic
902774664 1:18666958-18666980 CTGAGGGAGTGGGGGTCCTCTGG + Intronic
902801152 1:18831031-18831053 CAGTGGGTCTGAGGGTCTCCTGG + Intergenic
903033499 1:20479869-20479891 CCCAGGGTCTGGGGGCCTGGTGG - Intergenic
903137149 1:21317058-21317080 CTGGGGGTGTGGGGGTATGGGGG + Intronic
903655989 1:24949073-24949095 TTGAGGGGATGGGGGTCTGCAGG + Intronic
903736077 1:25530594-25530616 CTGCGGGGCTGCGGGGCTGCGGG + Intergenic
903738285 1:25543928-25543950 CTGCGGGGCAGGGGGTCGGCCGG + Intronic
903749965 1:25615771-25615793 CTGAGTGTCTGTGGGTATGCGGG + Intergenic
903862050 1:26370524-26370546 GTGAGGGTCTTAGGGTCTGAGGG - Intronic
904277909 1:29396205-29396227 CTCAGGGTCATGGGGTCTTCAGG + Intergenic
904311589 1:29632797-29632819 CTGGGGGACTGGGGGGCTGGAGG - Intergenic
904311603 1:29632828-29632850 CTGAGGGGCTGAGGGGCTGGGGG - Intergenic
904448726 1:30597433-30597455 TTGTGGGTCTGGGACTCTGCAGG - Intergenic
904459263 1:30665917-30665939 AAGAGGGTCTGGGGTACTGCAGG - Intergenic
904528877 1:31155195-31155217 TTGGGGGTGTGGGGGTCTGGCGG + Intergenic
904688851 1:32278963-32278985 GAGGGGGTCTGGGGGTCTGAGGG - Intronic
904882746 1:33713136-33713158 CTGAGGTTAAGGGGGTTTGCTGG + Intronic
905284217 1:36868820-36868842 CTGAGGGTCTGGTGGAAGGCGGG - Intronic
905291624 1:36925611-36925633 CCCAGGGCCTGGGGCTCTGCTGG + Intronic
905336015 1:37245019-37245041 CTGAGTCTATGGGGGTCTGTGGG + Intergenic
905820782 1:40989134-40989156 CTGAGCTTTTGGGGTTCTGCAGG - Intronic
905851298 1:41277121-41277143 CTCTGGGTCTGGGGGGTTGCTGG + Intergenic
906588452 1:47001470-47001492 CTGAGGATCTGGGTGCCTGTCGG - Intergenic
906655951 1:47548412-47548434 CTGATGGTCTGGGGATCTTTTGG + Intergenic
910206248 1:84751621-84751643 CTGAGGATTTGGATGTCTGCAGG - Intergenic
913416234 1:118611730-118611752 CTGTTGGTCTGCTGGTCTGCTGG + Intergenic
915110469 1:153561643-153561665 GTGAGGGTCTGGGTGTTTGGTGG - Intronic
916824576 1:168431221-168431243 CTTAGGGTCTGGGCCTTTGCAGG + Intergenic
918106907 1:181423399-181423421 CTGAGAGCCTGGGTGACTGCTGG + Intronic
918269595 1:182884757-182884779 CTGAGGGTCTAGAGATCTGACGG - Exonic
919733317 1:200928486-200928508 CTGAGAGTCTGTGGTTCTGCAGG + Intergenic
919806589 1:201384407-201384429 TTGGGGGGCTGTGGGTCTGCAGG - Intronic
919976141 1:202614197-202614219 CTGAGGTTCAGGGAATCTGCAGG + Intronic
919991303 1:202710000-202710022 CTGAGGGACTGGGGCTGGGCTGG - Intronic
920444280 1:206003607-206003629 CTATGGGTCAGGGGGCCTGCAGG + Intergenic
922291166 1:224210088-224210110 CTGTGGGTCTTGGGGTCTGTGGG - Intergenic
922531707 1:226350015-226350037 CTGAGGGTGTGGGGTTGTGCTGG + Intergenic
922536631 1:226385894-226385916 CTGAGGGTTGGGGGCGCTGCAGG - Intronic
922618273 1:226976124-226976146 CTGTGGGGCTGCGGGACTGCGGG + Intronic
922618285 1:226976172-226976194 CTGCGGGGCTGCGGGACTGCGGG + Intronic
922618297 1:226976220-226976242 CTGCGGGGCTGTGGGACTGCGGG + Intronic
922618324 1:226976324-226976346 CTGCGGGGCTGCGGGACTGCGGG + Intronic
922618336 1:226976372-226976394 CTGCGGGGCTGTGGGACTGCGGG + Intronic
923093916 1:230760087-230760109 CTGAGGGTCTGCGGGTCACACGG - Intronic
923511854 1:234659845-234659867 TTGAGGGTCTCTGGGCCTGCCGG - Intergenic
924873519 1:248075017-248075039 CTCAGGGGCTGGGGGTCTGGGGG - Intronic
924954562 1:248914233-248914255 TTGAGAGTCTGGGGGTGAGCTGG + Intronic
1062898491 10:1123423-1123445 CAGAGGTTCTCGGGGTCTGGGGG - Intronic
1063188504 10:3671225-3671247 CTGGGGGTCTGGGGGACTCAGGG + Intergenic
1063264654 10:4434435-4434457 CTGAGAGCCTGGGGGTATGCAGG - Intergenic
1063722469 10:8598197-8598219 CTCTGAGCCTGGGGGTCTGCTGG + Intergenic
1064004498 10:11689251-11689273 CTGAGAGCCTGGGGGTATGTCGG + Intergenic
1064075350 10:12264393-12264415 CTGAGGGCCTGGGGGAGGGCGGG - Intergenic
1064297330 10:14090197-14090219 CTGAGGTCCTGGAGGGCTGCAGG + Intronic
1064374768 10:14785433-14785455 CTGGAGGTCTGGGGGTGTGGGGG + Intergenic
1064730703 10:18327858-18327880 CTGAGGGTTGGGGGGTGTCCTGG + Intronic
1064969647 10:21051888-21051910 ATGAGGGTGTGGTGGTGTGCTGG + Intronic
1065138257 10:22694090-22694112 CTGAGGATTTTGGTGTCTGCAGG + Intronic
1067380806 10:45771453-45771475 CTGAGGGTGTTGGGGTATGAAGG - Intronic
1067888505 10:50112104-50112126 CTGAGGGTGTTGGGGTATGAAGG - Intronic
1070802815 10:79253570-79253592 CTGAGGGTCAGGGAGTGTGGGGG + Intronic
1071407413 10:85351489-85351511 CTGAGTGTCTGGAGGCCTGGAGG + Intergenic
1072317972 10:94222110-94222132 CTGGAGGTCTAAGGGTCTGCTGG + Intronic
1072450007 10:95532293-95532315 CTGAGGTGCAGGGGGTGTGCAGG - Intronic
1072611220 10:97018738-97018760 CTGAGGGTCTGGCTGGCTGTTGG - Intronic
1072881369 10:99232745-99232767 ATCAGGATCTGGGTGTCTGCGGG - Intronic
1075762304 10:124865997-124866019 CTGACGGTCTGAGTGTCTGGTGG + Intergenic
1075797685 10:125132588-125132610 TTGAGAGTTTGGGGGTGTGCTGG - Intronic
1075885306 10:125895408-125895430 TTAAGGGTGTGGGGGGCTGCAGG - Intronic
1076015518 10:127024424-127024446 TTGAGGGTCTGGGGAACTGGAGG + Intronic
1076853171 10:133103010-133103032 CTGAGGGTAGGGTGGTGTGCTGG + Intronic
1076916849 10:133427278-133427300 CTGAGGGTGTCGGGGGCTCCTGG + Intergenic
1076936952 10:133572078-133572100 CTGAGGGTGTCGGGGGCTCCTGG + Intergenic
1077094513 11:793620-793642 CTGTGGGGCAGGGGGTCAGCTGG + Intronic
1077300682 11:1845723-1845745 CAGAGGGTGTGGGGGACTTCGGG + Intergenic
1077308127 11:1876908-1876930 GTGAGGGTGCGGGGGTGTGCTGG + Intronic
1077350488 11:2090969-2090991 CTGAGAGTTTTGGGGTCTGGAGG - Intergenic
1077369872 11:2176896-2176918 GTGGGGGTCTGGGAGGCTGCAGG - Intergenic
1077896686 11:6458111-6458133 CTGAGGGGGTGGGGGTCCTCCGG + Exonic
1080786251 11:35477988-35478010 CTGAGGGACGGGGGCTGTGCAGG - Intronic
1081498711 11:43644291-43644313 CGGAGGGTTTGGGGGGCTGTCGG + Intronic
1081574166 11:44309155-44309177 CTGCGGGGCTGCGGGGCTGCGGG - Intronic
1081574176 11:44309187-44309209 CTGCGGGGCTGCGGGGCTGCGGG - Intronic
1081574179 11:44309195-44309217 CTGCGGGGCTGCGGGGCTGCGGG - Intronic
1081574182 11:44309203-44309225 CTGCGGGGCTGCGGGGCTGCGGG - Intronic
1081660098 11:44882820-44882842 CCTTGGGTCTGGGGGTCTGGGGG - Intronic
1082684014 11:56216312-56216334 TTCAGGGTCTGGGGGTCTAGGGG - Intergenic
1083545325 11:63545167-63545189 CTGAAGTTCTGGGGGTCATCAGG + Intronic
1083636685 11:64124645-64124667 CTGTGGCTTTGGGGGTCTCCAGG - Intronic
1083709464 11:64539186-64539208 GTGGGGGTCTGGGCGTCTGGGGG + Intergenic
1083746607 11:64740572-64740594 CTGAGGGTTCGGGGCTCTTCCGG - Intronic
1083761091 11:64818179-64818201 CTGAGGGTCTCGAGGTTGGCTGG + Intergenic
1083829607 11:65223216-65223238 CTGAGGTTCTGCGGTTCTGGAGG - Intergenic
1084515632 11:69636881-69636903 CTCAGGGTCTGAGGGACTGATGG - Intergenic
1084519382 11:69654329-69654351 CTGAGGGTCTGGGCGGCGGGCGG + Exonic
1084601297 11:70147391-70147413 CTGAGGGTCAGGGGCCCTGGGGG + Intronic
1084857356 11:71997679-71997701 CTGAGGGTCTGGGGGTGGTTGGG + Intergenic
1084971973 11:72776998-72777020 CTGAGAGCCTGAGGCTCTGCTGG - Intronic
1085390016 11:76177530-76177552 CCGAGGGGCTGGGGGGCTGTGGG - Intergenic
1085395191 11:76203552-76203574 TTGAGGGGCTGGGAGTCTTCTGG + Intronic
1089400529 11:118161719-118161741 GTGAGGGTCTCTGGGTCTCCAGG + Intergenic
1089638524 11:119832063-119832085 CAGAGGCCCTCGGGGTCTGCTGG + Intergenic
1089671807 11:120062089-120062111 CTAGGGGTGAGGGGGTCTGCTGG + Intergenic
1090093170 11:123717554-123717576 CTGATGGTCTGTGGGTCAGCTGG - Intergenic
1090583793 11:128188118-128188140 CTGATGCTCTGGGAGACTGCAGG + Intergenic
1090804850 11:130196503-130196525 CCGGGGGGCTGGGGGTCTGGTGG - Intronic
1090879455 11:130820873-130820895 CTGAGGGTGAGGAGGTCAGCTGG - Intergenic
1091413118 12:257350-257372 CTGAGGGACTGGGGAGCTGCAGG - Intronic
1095691691 12:45096471-45096493 CTCAGGGCCTGGGTGTCTGGGGG - Intergenic
1095976565 12:47944094-47944116 CTGCGGGTTTGGGGGTCTCCCGG - Intergenic
1096271045 12:50166871-50166893 GTGAGGGTCTAGGGGAATGCTGG - Intronic
1096276673 12:50215344-50215366 CTGAAGGGCTGGGAGTCTACGGG + Intronic
1096476985 12:51914317-51914339 CTAAGGGTCTGGGGTTCTGTGGG + Intronic
1096516252 12:52157148-52157170 CTGAGGGTCTGTGAGTCTGTTGG - Intergenic
1096618651 12:52848744-52848766 CTGGGGGTCAGGGGGTAGGCTGG - Exonic
1096634215 12:52948460-52948482 TTGGGGGTCTGGTGGTGTGCGGG - Intronic
1097166323 12:57088401-57088423 CTGAGAGCGTGGGGCTCTGCAGG - Intergenic
1100614626 12:96221454-96221476 CGGTGGGTTTGGAGGTCTGCAGG - Intronic
1101315106 12:103621836-103621858 CTAAGGGTCTGAAGCTCTGCAGG - Intronic
1102580486 12:113883365-113883387 ATGTGGGTCAGGGTGTCTGCTGG + Intronic
1103004803 12:117412704-117412726 GTGAGGGTCACGGGATCTGCCGG - Intronic
1103758740 12:123232808-123232830 CTGAGGGGCGGGGGGTTTGTGGG - Intronic
1103764443 12:123271035-123271057 CTGCGGGGCTGCGGGGCTGCCGG - Intronic
1103764445 12:123271043-123271065 CTGCGGGGCTGCGGGGCTGCGGG - Intronic
1103765238 12:123275050-123275072 CTGAGGGGCTGGGGTGCTGAGGG + Intergenic
1103765248 12:123275082-123275104 CTGAGGGGCTGGGGTGCTGAGGG + Intergenic
1103765254 12:123275098-123275120 CTGAGGGGCTGGGGTGCTGAGGG + Intergenic
1103765264 12:123275130-123275152 CTGAGGGGCTGGGGTGCTGAGGG + Intergenic
1103765274 12:123275162-123275184 CTGAGGGGCTGGGGTGCTGAGGG + Intergenic
1103765289 12:123275218-123275240 CTGAGGGGCTGAGGGGCTGAGGG + Intergenic
1103765292 12:123275226-123275248 CTGAGGGGCTGAGGGGCTGAGGG + Intergenic
1104148630 12:126060123-126060145 ATGAGGGTATGGGGGCCTGGGGG + Intergenic
1104595332 12:130116718-130116740 CTGGGGGTCTGGGAGTTTGACGG + Intergenic
1104729084 12:131095112-131095134 CTGAGAGTCGGGGGGACTGAAGG - Intronic
1104936341 12:132366391-132366413 GGGAGGGTCTGAGGGGCTGCAGG - Intergenic
1104970276 12:132527800-132527822 CTTCGGGTCTGTGGATCTGCGGG + Intronic
1105651081 13:22378788-22378810 CTGAAGGTCTGTGAGTTTGCAGG + Intergenic
1105848845 13:24316728-24316750 CCCAGGGTCTGGGGATCTGGGGG + Intronic
1108455472 13:50609404-50609426 CTGAGGGTTTGGGGAACTGGAGG + Intronic
1108754880 13:53487599-53487621 CTGAGAAACTGAGGGTCTGCTGG - Intergenic
1111433869 13:88180830-88180852 CTGAGGGTGTGGGGGTGTGATGG - Intergenic
1113334850 13:109367866-109367888 CCCAGCCTCTGGGGGTCTGCCGG - Intergenic
1113429613 13:110238179-110238201 CTGAGGATCTGGGTATCAGCAGG + Intronic
1113760132 13:112840948-112840970 CTCAGTGTCTGGGGGTCTCAGGG + Intronic
1113871828 13:113564606-113564628 GGGAGGGTCTGCGGGTCTGAGGG - Intergenic
1113871935 13:113564982-113565004 CTGAGGGTGTGAGGATCTGATGG - Intergenic
1113871993 13:113565262-113565284 GGGAGGGTCTGTGGGTCTGAGGG - Intergenic
1113872085 13:113565638-113565660 CTCAGGGTCTGAGGGTCTGAGGG - Intergenic
1116828342 14:49693407-49693429 CGGAGGGGCTGGGGGGCTGCAGG - Intronic
1117547816 14:56807968-56807990 CTGCGGGGCTGCGGGGCTGCCGG - Intronic
1117547818 14:56807976-56807998 CTGCGGGGCTGCGGGGCTGCGGG - Intronic
1117547821 14:56807984-56808006 CTGCGGGGCTGCGGGGCTGCGGG - Intronic
1117547824 14:56807992-56808014 CTGCGGGGCTGCGGGGCTGCGGG - Intronic
1118312573 14:64704561-64704583 CTGAGGGGCTGGCGGTGGGCGGG + Exonic
1118375581 14:65174088-65174110 CTGAGTGTGTGGGGGTGTGATGG + Intergenic
1118473437 14:66095253-66095275 CTGGGGGTGTGGGGGTGTGGTGG + Intergenic
1119110616 14:71970605-71970627 TTGAGAGTCTGGGGACCTGCAGG + Intronic
1119385452 14:74255451-74255473 CTGAGGGTCTGGATGACTTCTGG + Intronic
1120987745 14:90348841-90348863 CGAAGGGTCTGGTGGTCTGGTGG - Intergenic
1121016523 14:90552525-90552547 CTGAGAGCCTGGGGGTGGGCAGG - Intronic
1122214192 14:100192692-100192714 CTGAGGGTCTGGGCTTCTGCAGG - Intergenic
1122470161 14:101960977-101960999 CAGAGGTTTTGAGGGTCTGCAGG + Intergenic
1122792510 14:104190245-104190267 CTGTGGGTTTGGGGATCTGGGGG + Intergenic
1122798761 14:104219551-104219573 GTGAGGGGCTGGGGGCCTGGGGG - Intergenic
1122967443 14:105137957-105137979 CCCTGGGTCTGGGGGTCTGATGG + Intergenic
1123034274 14:105465518-105465540 CTGAGGGTCTGGGGTTTAGGTGG + Intronic
1202872750 14_GL000225v1_random:178519-178541 TTAAGGGTGTGGGGGGCTGCAGG + Intergenic
1126498177 15:49315817-49315839 GTGAGGTTCTGGTAGTCTGCAGG + Intronic
1128360770 15:66960023-66960045 CAGAGGGTCTTTGGCTCTGCTGG + Intergenic
1128730234 15:70015811-70015833 CTGGGGGTCAGGAGGGCTGCGGG - Intergenic
1128748117 15:70129281-70129303 CTGAGGGTCTCTGTGTATGCTGG - Intergenic
1129328822 15:74816405-74816427 CTGAGGGGCTGGGGACCTGCAGG + Exonic
1129459656 15:75694141-75694163 GGGAGGGGCTGAGGGTCTGCTGG + Intronic
1129660366 15:77549749-77549771 CTCAGGGTCTGGAGGCCTTCAGG - Intergenic
1130755353 15:86756999-86757021 CTGGGGATCTGGGGATCTGTAGG - Intronic
1130990083 15:88870991-88871013 CTGTGGCTCTGGGGGGCTCCAGG - Intronic
1132115720 15:99134643-99134665 CTGGGGGTCTGAGGGCCTCCAGG - Exonic
1132145997 15:99430320-99430342 GTGAGTGGCTGGGGGGCTGCGGG - Intergenic
1132375685 15:101326913-101326935 CTGAGTGTCAGGGGAGCTGCTGG + Intronic
1132595253 16:746208-746230 CTGCGGGTCTGCAGGGCTGCAGG + Intronic
1132595298 16:746383-746405 CTGCGGGTCTGCAGGGCTGCAGG + Intronic
1132615355 16:838849-838871 CTGAGCGTCTGAGGGGCAGCTGG + Intergenic
1132864468 16:2086625-2086647 CAGGGGCTCTGGGGGCCTGCGGG - Intronic
1133232176 16:4372002-4372024 CTGTGGGGCTGGGGGGCTGCGGG + Intronic
1133284417 16:4683933-4683955 GTAAGGGGCTGGGGGTCTGGGGG + Intronic
1133732669 16:8590093-8590115 GTGAGAGTGAGGGGGTCTGCAGG - Intergenic
1135521739 16:23183043-23183065 CTCAGAGTCCGGGGGTCTGGGGG + Intronic
1135685910 16:24498292-24498314 CTCAGCCTCTGGTGGTCTGCTGG - Intergenic
1136476482 16:30516905-30516927 CACAGGGTCTGGGGGGCAGCTGG + Intronic
1136552139 16:30987507-30987529 CTGAGAGGCTTGGGGACTGCAGG - Intronic
1137731434 16:50693467-50693489 CTGCGGGGCTGCGGGGCTGCGGG + Intergenic
1137731437 16:50693475-50693497 CTGCGGGGCTGCGGGGCTGCGGG + Intergenic
1138584802 16:57962781-57962803 CTGAGGGGCTGAGGGGCTGCTGG - Intronic
1138660633 16:58515181-58515203 CCGAGGGTCTGGTGGCCGGCCGG - Intergenic
1139327205 16:66161717-66161739 CTGAAGCTCTGAGGGGCTGCAGG - Intergenic
1140046653 16:71443936-71443958 CTGTGGATGTGGGGGTCTGTGGG + Intergenic
1140046687 16:71444209-71444231 CTGTGGATGTGGGGGTCCGCAGG + Intergenic
1140891304 16:79287507-79287529 CTCAGGGTTTGGGGGTTTGGGGG - Intergenic
1141136712 16:81470361-81470383 CTGGGGTTCTGGGCATCTGCAGG + Intronic
1142324925 16:89408580-89408602 CTGAGGGTCTGAGTGTGTGTGGG - Intronic
1142736768 17:1905884-1905906 CTGTGTGTATGGGGGTGTGCTGG + Intergenic
1143023833 17:3929769-3929791 ATTAGGGTCTGGGGGTCAGTGGG - Intronic
1143351111 17:6288941-6288963 CTGAGGGTTTGGGGAGCTGGAGG + Intergenic
1143789933 17:9286790-9286812 CTGAGTCTCTGGGGTTTTGCAGG - Intronic
1144137709 17:12314378-12314400 CTGAGGCACTCTGGGTCTGCTGG + Intergenic
1144496670 17:15750016-15750038 CTGAGGGGCTGAGGGGCTGAGGG + Intergenic
1144496689 17:15750074-15750096 CTGAGGGGCTGAGGGGCTGAGGG + Intergenic
1144812260 17:18008040-18008062 CCGAGGGTCTGGGGGACTATGGG - Intronic
1144824495 17:18098188-18098210 CCCAGGGGCTGGGGGCCTGCAGG - Intronic
1144834636 17:18150517-18150539 CTTTGGCTCTGGGGGTCTCCTGG - Exonic
1144904943 17:18634791-18634813 CTGAGGGGCTGAGGGGCTGAGGG - Intergenic
1145127665 17:20315356-20315378 CTGAGGGACTGGGGCACCGCTGG - Intronic
1145259079 17:21344000-21344022 CTTGGGGAATGGGGGTCTGCAGG + Intergenic
1145317539 17:21744003-21744025 CTTGGGGAATGGGGGTCTGCAGG - Intergenic
1145763667 17:27443271-27443293 CTGAGGGTCTCTGGGCCTTCAGG - Intergenic
1147157055 17:38549220-38549242 CCAAGGGGCTGGGGGTCAGCAGG + Intronic
1147438331 17:40431535-40431557 AGGAGGGTCTGGGGGTCCCCTGG + Intergenic
1148031240 17:44622628-44622650 GTGAGGGCCTGTGGGCCTGCTGG - Intergenic
1148165046 17:45477687-45477709 CTGAGGGTCTCAAGATCTGCTGG + Intronic
1148241821 17:46004202-46004224 CTGTGGGGCTGTGGGGCTGCAGG + Intronic
1149777412 17:59369050-59369072 ATGGAGGTCTGGGGGTTTGCAGG + Intronic
1149919309 17:60641848-60641870 CTGAGTGTCTTGTGGACTGCTGG + Intronic
1150239790 17:63622465-63622487 CTGCGGGTCTGAGGGACTGGCGG + Exonic
1150396276 17:64824412-64824434 CTGAGGGTCTCAAGATCTGCTGG + Intergenic
1150770409 17:68036000-68036022 CTGAGTTTCGCGGGGTCTGCGGG + Exonic
1151816114 17:76472171-76472193 CTGAGGGGCAGGGGGTCGGCTGG + Intronic
1152097002 17:78278318-78278340 CTGAGGCCCTGGGGGTGGGCAGG - Intergenic
1152290535 17:79437490-79437512 CTGAGGTCCTGGAGGGCTGCTGG + Intronic
1152391298 17:80005567-80005589 CTCAGGGTCTTGGGGTCTCAGGG + Intronic
1152556266 17:81054695-81054717 CAGAGGGTGTGGGGGACTGGTGG + Intronic
1152687405 17:81701417-81701439 TTGTGGGTCTGTGGCTCTGCTGG + Intronic
1152775222 17:82197096-82197118 ATGAGGGGCTGTGTGTCTGCAGG - Intronic
1152796605 17:82310671-82310693 CTGAGGGTCAGGGTGTGGGCAGG + Intergenic
1154193809 18:12251779-12251801 CTGAGGGTGTGGGTGTCAGGTGG + Intergenic
1154299234 18:13178436-13178458 CTGAGGGGGTGAGGGCCTGCTGG - Intergenic
1154355316 18:13619971-13619993 CCTAGGGTGTGGGGGTCTGAGGG + Intronic
1155429253 18:25738270-25738292 CTGAGGCTCTGCAGCTCTGCTGG + Intergenic
1155809993 18:30220238-30220260 GTCAGGGGCTGGGGGTCTGGGGG + Intergenic
1156088674 18:33440291-33440313 CTGGGGGACTGGGGGACTGGGGG + Intronic
1156088678 18:33440299-33440321 CTGGGGGACTGGGGGACTGGGGG + Intronic
1156088682 18:33440307-33440329 CTGGGGGACTGGGGGACTGGGGG + Intronic
1156088686 18:33440315-33440337 CTGGGGGACTGGGGGACTGGGGG + Intronic
1156291844 18:35754592-35754614 CTGAGGGGCATGGGGCCTGCTGG + Intergenic
1156468360 18:37362135-37362157 CTGGGGGTCAGGGTGACTGCAGG - Intronic
1156622718 18:38872283-38872305 CAGGGGGTCTGGGGGTCAGGGGG - Intergenic
1156622722 18:38872291-38872313 CAGGGGGTCAGGGGGTCTGGGGG - Intergenic
1156737737 18:40281715-40281737 CTTAGGATCTGAGTGTCTGCTGG - Intergenic
1157901476 18:51522528-51522550 CTGAGGGTCTGGGGAAGGGCTGG - Intergenic
1158219169 18:55132532-55132554 CTGAGGGTCACGGGGCCTGAAGG - Intergenic
1158754766 18:60308762-60308784 GTGGTGGTCTGGGGGTCTGGGGG + Intergenic
1159743205 18:72199341-72199363 CTGAGATTCTGGTGGTTTGCTGG - Intergenic
1160153967 18:76418890-76418912 CTGAAGGGCAGAGGGTCTGCAGG + Intronic
1160338039 18:78060159-78060181 CTGAGGGTCTGGGGCTGAGTGGG - Intergenic
1160721494 19:599017-599039 CTGAGGTTCTCAGGGGCTGCAGG + Intronic
1160757188 19:763984-764006 TTGAGGGGCTGCGGGTCTGAGGG + Exonic
1160768161 19:817867-817889 CTGAGGCACAGGGGGTCTGCTGG - Intronic
1160827916 19:1089310-1089332 CTGGGGGTCTGGGGGTGTCCTGG + Intronic
1161157408 19:2739875-2739897 CTGAGCGGCCGGGGGTCTGTTGG - Intronic
1161473595 19:4473011-4473033 CTGGGAGTCTGGGGGTATCCTGG + Intronic
1161586716 19:5109666-5109688 CTGAGGGTCTGGGAGGCTCAGGG - Intronic
1161592865 19:5136624-5136646 CTGGGGGTGGGGGCGTCTGCTGG - Intronic
1161716524 19:5879269-5879291 CTGAGGGACTGAGTGGCTGCAGG - Intronic
1161770514 19:6228467-6228489 CTGAGGGTCTGTGTTTCCGCCGG - Intronic
1162039528 19:7961597-7961619 CTGAGGATCTGGGATTCTGTGGG + Exonic
1162127872 19:8508999-8509021 TTCAGGGTCTGGGGGTCTTCAGG + Intergenic
1162339033 19:10080380-10080402 CTGAGTGTCAGGCTGTCTGCAGG - Intergenic
1162955063 19:14092844-14092866 CTGAGGGGCTGGGGGGCTGTGGG + Exonic
1163580464 19:18135775-18135797 ATGAGGTCCTGGGCGTCTGCTGG - Exonic
1163628106 19:18402334-18402356 CTGAGAGTCTTGGGGTCTGGGGG + Intergenic
1163628111 19:18402350-18402372 CTGGGGGTCCAGGGGTCTGGTGG + Intergenic
1163628365 19:18403711-18403733 CTGGGGGTCTTGGGGTCTGGGGG + Intergenic
1163757135 19:19112717-19112739 CTGAGGGCCTGGCTGTGTGCAGG - Exonic
1164986987 19:32655424-32655446 CTGAGGGTCTGGGGTTCTGTGGG + Intronic
1165061572 19:33207487-33207509 CAGAGCCACTGGGGGTCTGCAGG + Exonic
1165317457 19:35065524-35065546 CTGTTGGCCTGGGGGTGTGCAGG - Exonic
1165463258 19:35957389-35957411 CTGAGGCTCCGGCGGACTGCTGG - Intergenic
1165833503 19:38741216-38741238 ATGAGTGACTGGGGGTCTCCAGG + Intronic
1166781759 19:45346822-45346844 AGGAGGGTCTGGGGGACTGTGGG - Intronic
1166781775 19:45346880-45346902 AGGAGGGTCTGGGGGACTGTGGG - Intronic
1167096669 19:47378163-47378185 CTGAGGCTCTAGGAGCCTGCAGG - Intronic
1167356959 19:49010284-49010306 CTGAGGGTCACGGGGGCTCCCGG - Intronic
1168132449 19:54330192-54330214 CTGAGGGTCTTGGGGCCCACAGG + Intergenic
925146399 2:1585871-1585893 CTGAGGGGGTGGGCGGCTGCGGG + Intergenic
925922142 2:8645309-8645331 CGGAGGGGCTGGGGGTCAGAGGG - Intergenic
925945166 2:8855300-8855322 CTGAGGAACTTGGGGTCTACAGG + Exonic
926394038 2:12423378-12423400 CTGCGGGTCTGTTGGCCTGCTGG - Intergenic
926683090 2:15678661-15678683 CTGGGGGGCTGGGGGGCTGGAGG + Intergenic
926740402 2:16105813-16105835 CTCAGGGTGTGGGCCTCTGCCGG - Intergenic
927515314 2:23668765-23668787 CTGAGGGTCTGGGTGAGTGGGGG - Intronic
928392006 2:30917417-30917439 CTGAAGGGCTTGGGCTCTGCAGG + Intronic
928877736 2:36060455-36060477 CTGAGGTTCTTGTGTTCTGCAGG - Intergenic
929957360 2:46468614-46468636 CTGAGGGGTTGGGGGTCAGAAGG - Intronic
932104002 2:68926495-68926517 CTGAGGGGCTGGGGTTCAGAAGG + Intergenic
932270235 2:70403067-70403089 CAGAGGGTCTGTGGGTCCTCTGG - Intergenic
933168195 2:79097282-79097304 CTGCGGCCCTGGGGGCCTGCAGG + Intergenic
933854482 2:86400027-86400049 CTGAGGGTGTGGGGGGCAGCAGG + Intergenic
933884372 2:86704427-86704449 ATGAGGCTCTGGGGGACTTCAGG + Intronic
934502261 2:94870432-94870454 CGGAGGGGCTGGGGGTCCCCAGG + Intergenic
934851846 2:97706882-97706904 CTCAGGGTGTGGGGGTGTGGAGG + Intergenic
935057317 2:99578885-99578907 CTGAGAGTCTGGGATTCAGCAGG + Intronic
935233194 2:101117122-101117144 CTGGGGTTCTGGGGGTTGGCTGG - Intronic
937224163 2:120358649-120358671 CTGAGGCTGAGGGGGTCAGCAGG + Intergenic
937248729 2:120510407-120510429 CTCAGGGGCTGGGGTGCTGCAGG + Intergenic
937272486 2:120661920-120661942 CTGAGGGCCAGGGCGCCTGCTGG - Intergenic
937339161 2:121079960-121079982 CTAGGGGTCTGAGGGTCTGGAGG + Intergenic
937360990 2:121230079-121230101 CAGAAGGGCTCGGGGTCTGCTGG + Intronic
937708761 2:124952916-124952938 CTGAGGTTCTGAGGTTCTGATGG + Intergenic
938259139 2:129882803-129882825 CTGCGGGTCTGAGGGACTGTGGG - Intergenic
941388182 2:164878756-164878778 CTGAGGGTTTGCAAGTCTGCTGG + Intergenic
944034239 2:195274197-195274219 CTGAGAACCTGGGGGACTGCTGG - Intergenic
944441047 2:199743692-199743714 CTTAGTGTCTCGGGGTCTGCAGG + Intergenic
944515724 2:200510010-200510032 CCGAGGGTCTGGCGGGCCGCAGG - Exonic
945447983 2:209960744-209960766 GTGAGGCTCTGGGGTTCTCCAGG - Intronic
946370583 2:219279310-219279332 CTGGGGGGGTGGGGGCCTGCAGG - Exonic
947614735 2:231548541-231548563 CGGAGGGTGTGGGTGTCTCCAGG + Intergenic
947635133 2:231676612-231676634 CTGCGTGTCTGTGGGACTGCAGG - Intergenic
948052733 2:234990866-234990888 CTTAGCATCTGGGGGTTTGCAGG + Intronic
948123229 2:235546258-235546280 CCGAGGGCCTGCGGGCCTGCTGG - Intronic
948187639 2:236034366-236034388 GTGGGGGTCAGGGTGTCTGCAGG - Intronic
948580965 2:238986893-238986915 TGGAGGGTCTGGGGGTGTGCAGG - Intergenic
948684928 2:239664412-239664434 GTGGGGGTCTGGGGGCCTGGGGG + Intergenic
1170033553 20:11967206-11967228 CTGAGAGTCTGAGAGTCTCCAGG + Intergenic
1170770483 20:19328270-19328292 CTTAGGGTCTTGGGGGCTGGTGG + Intronic
1171212520 20:23327794-23327816 CTGCGTGTCTGGGGCTCTCCCGG - Intergenic
1171291197 20:23984100-23984122 CTGTGTCTCTGGGGCTCTGCAGG - Intergenic
1171351724 20:24507644-24507666 CTGAAGGTCTGTGGGTGTGGGGG + Intronic
1171876356 20:30580507-30580529 CTCAGGGACTGGGGATCTCCTGG + Intergenic
1172093739 20:32450753-32450775 ATGGGGGTCTGGGGCTCAGCAGG - Intronic
1172773521 20:37394802-37394824 CTGTGGGCCTGGGGCTCAGCGGG + Intronic
1173595702 20:44257518-44257540 CTGTGGCTCTGGGGCTCTGGGGG - Intronic
1174317177 20:49712776-49712798 CTGAAAGTCTGGGGGGCTGGGGG + Intronic
1174394008 20:50234746-50234768 CTGTGGGTCCTGGGGTCTGGAGG + Intergenic
1175385380 20:58591655-58591677 CTGGGGGTCTGGAGGGCTGCAGG - Intergenic
1175385382 20:58591663-58591685 AGCAGGGTCTGGGGGTCTGGAGG - Intergenic
1175798664 20:61788328-61788350 CTGAGGGGCTGGGGGAGGGCTGG + Intronic
1175819326 20:61900148-61900170 TTGAGGGGCTGGGGATCTGTGGG - Intronic
1175926062 20:62472217-62472239 CCTAGGGCCTGGGGCTCTGCAGG - Intronic
1175949755 20:62577045-62577067 CTGAGGGTCTGGGAGTCAGCTGG - Intergenic
1176733627 21:10522345-10522367 GCGGGGGTCCGGGGGTCTGCGGG + Intronic
1179902273 21:44400391-44400413 CTGCGGGACTGTGGGGCTGCGGG + Intronic
1179902276 21:44400399-44400421 CTGTGGGGCTGCGGGGCTGCGGG + Intronic
1179986533 21:44924892-44924914 CTAGGGGTGTGTGGGTCTGCAGG - Intronic
1180044953 21:45301074-45301096 CTGCGGGTGTGGGGGGCTTCTGG - Intergenic
1180070105 21:45431681-45431703 TTGGGGGCCTTGGGGTCTGCTGG - Intronic
1180177058 21:46095991-46096013 CTGAGGGGACAGGGGTCTGCAGG + Intergenic
1180622197 22:17169600-17169622 CTGAGAACCTGGGGGGCTGCTGG - Intergenic
1180790694 22:18574063-18574085 CCGAGGGACTGAGGGACTGCAGG - Intergenic
1180802130 22:18636864-18636886 CTCAGGGGCGGGGGGTTTGCTGG - Intergenic
1180853368 22:19032416-19032438 CTCAGGGGCGGGGGGTTTGCTGG - Intergenic
1181219592 22:21358395-21358417 CTCAGGGGCGGGGGGTTTGCTGG + Intergenic
1181231043 22:21421251-21421273 CCGAGGGACTGAGGGACTGCAGG + Intronic
1181247605 22:21513617-21513639 CCGAGGGACTGAGGGACTGCAGG - Intergenic
1181400761 22:22648835-22648857 CTGTGTCTCTGGGGCTCTGCAGG + Intergenic
1181406380 22:22687675-22687697 CTCAGGCTCTGTGGGTCTGGAGG - Intergenic
1181523072 22:23460346-23460368 CCGAGGGCCTGGTGGCCTGCGGG - Intergenic
1181695920 22:24592802-24592824 GGGAGGGTCTGGGGGTCTGGGGG - Intronic
1181702743 22:24629933-24629955 CTGTGTCTCTGGGGCTCTGCAGG + Intergenic
1182304090 22:29356096-29356118 CTGGGTGTCTGGGGCTCTGCCGG - Intronic
1182687579 22:32132814-32132836 CTGGGTGTCTGGGGCTCTGCCGG + Intergenic
1183034677 22:35132469-35132491 CCGAGAGACTGGGGGTCTGTGGG + Intergenic
1183277798 22:36912220-36912242 CTGTGGGACTGGGAGGCTGCGGG - Intergenic
1183379705 22:37484773-37484795 CTGAGGTGCTGGGGGCCAGCTGG + Intronic
1183433857 22:37782121-37782143 CTGAGTCTTAGGGGGTCTGCCGG - Intergenic
1183535377 22:38398115-38398137 GCGGGGGTCCGGGGGTCTGCGGG - Intronic
1183536049 22:38402004-38402026 CTGAGGGGCTCGGGCTCTCCGGG + Intergenic
1183538350 22:38415907-38415929 CTGAGGGGCTGAGGGGCTGGGGG + Intergenic
1184555350 22:45229720-45229742 CTGGGGCTCAGGGGGTCAGCTGG + Intronic
1184568967 22:45310226-45310248 CTGAGGATCTCGGGGTCCCCAGG - Intronic
1184735352 22:46394718-46394740 CTGAGCATCTGTGGGTCTGGGGG - Intronic
1184832209 22:46996063-46996085 CTGAGGGGGCAGGGGTCTGCAGG - Intronic
1184889469 22:47370993-47371015 CTGAGTGTCTGGGGAGCTCCAGG - Intergenic
1184913078 22:47549092-47549114 CTGAGCTCCTGGGGGCCTGCTGG + Intergenic
1185002388 22:48253773-48253795 GGAAGGGTCTGGGGGGCTGCTGG + Intergenic
1185228209 22:49665178-49665200 CAGCGGGGCTGGGGGTCAGCAGG - Intergenic
1185310074 22:50149464-50149486 CTGGGGGTCTGGGTGTCACCCGG - Intronic
949416405 3:3819485-3819507 CTTAGCTTCTGGGGGTTTGCTGG + Intronic
950167305 3:10811190-10811212 AGGAGGGTCTGGGGTTCTGGAGG - Intergenic
950276095 3:11662238-11662260 CTGAAGGTCTGGTGGGCTTCGGG - Intronic
951775982 3:26310833-26310855 CTGAGAGACTGTGGGACTGCGGG - Intergenic
953118270 3:40014403-40014425 CTGAATGTCTGGATGTCTGCAGG - Intronic
953405404 3:42657345-42657367 CCTGGGGTCTGGGGGTCTACCGG + Intronic
953412092 3:42696414-42696436 CTGAGGGTCTGGGTTTCTGAGGG - Intronic
954150212 3:48653586-48653608 CTGAGGGTATAGGGGTGAGCAGG + Intronic
955333927 3:58069626-58069648 CTGAGGGTCTTGGGCCATGCTGG - Intronic
956181172 3:66519326-66519348 CTGTTGGTCTGCTGGTCTGCAGG + Intergenic
956567850 3:70659566-70659588 CCTAGGATGTGGGGGTCTGCGGG + Intergenic
957587045 3:82146122-82146144 CTGAGGGGCTGGGGTACAGCTGG - Intergenic
961491262 3:127258075-127258097 CTCAGGGCCTGGGGGTGGGCTGG - Intergenic
961669401 3:128517966-128517988 CTGATGGGCCGGGGGTTTGCAGG + Intergenic
962066131 3:131981964-131981986 CAGAGGGTCTGTGGGTCCTCTGG + Intronic
964305317 3:155333434-155333456 CTGAGGGTCTGGAGCTGGGCCGG + Intergenic
964623990 3:158741369-158741391 CTGAGAGTCTGGTGGGCTGTGGG - Intronic
967099110 3:186201304-186201326 CTGATGGCCTGGGGGCCAGCAGG + Intronic
968156876 3:196388297-196388319 CTGGGGGGCTGGGGGGCTGGGGG + Intronic
968231181 3:197005621-197005643 CTGAGGACCTGGGCATCTGCAGG + Intronic
968515273 4:1013029-1013051 CTGGGGGACTGGGGGTCTGGGGG - Intronic
968603775 4:1522023-1522045 CTGGGGGTCTTGGGGACAGCTGG - Intergenic
968645428 4:1738207-1738229 CAAAGGGGCTGGGTGTCTGCAGG + Intronic
968876526 4:3270552-3270574 CTGAGGGCCTGGGGCTCCCCCGG - Intronic
969454647 4:7294441-7294463 CTGATGATCTGAAGGTCTGCAGG - Intronic
970579230 4:17458846-17458868 CTGCTGGTCTGCTGGTCTGCTGG + Intergenic
970579233 4:17458878-17458900 CTGCTGGTCTGCTGGTCTGCTGG + Intergenic
971480976 4:27114696-27114718 CTGAGGGCCTGGAGCTCTGGGGG + Intergenic
973179736 4:47252406-47252428 CAGAGGGTCTGTGGGTCCTCAGG + Intronic
976035985 4:80821646-80821668 TTTAGGGTCTGGGGTTTTGCTGG - Intronic
976674937 4:87693098-87693120 TTGAGCCTCTGGGGGACTGCTGG + Intergenic
976890424 4:90039813-90039835 CTGCTGGTCTGCTGGTCTGCTGG + Intergenic
976890425 4:90039821-90039843 CTGCTGGTCTGCTGGTCTGCTGG + Intergenic
980451590 4:132980510-132980532 CTTAGGGTCTTGTGGTTTGCCGG - Intergenic
983649829 4:170026657-170026679 CTGCGGGTGTGGGGCTCTGGGGG - Intronic
984590484 4:181612119-181612141 CTGAGAGGCTGGGGCTCTGGGGG - Intergenic
985531727 5:437609-437631 CTAAAGGTCTGGGAGGCTGCAGG - Exonic
985606508 5:861042-861064 GTGCGGGTGTGGGGGTGTGCAGG - Intronic
985606534 5:861137-861159 CTGCAGGTGTGGGGGTGTGCAGG - Intronic
985640792 5:1062673-1062695 CTGGGGGGCTGGGGGGCTGGGGG + Intronic
985640794 5:1062681-1062703 CTGGGGGGCTGGGGGACTGAGGG + Intronic
985640802 5:1062697-1062719 CTGAGGGACTGGGGGACTGGGGG + Intronic
985640805 5:1062705-1062727 CTGGGGGACTGGGGGGCTGCGGG + Intronic
985846562 5:2354028-2354050 CTGCGGGTCTGGGGATGTGCAGG - Intergenic
985923425 5:2997074-2997096 GTGAGGGGCTGGCCGTCTGCAGG - Intergenic
985961348 5:3305605-3305627 GTGAGGGGCTGGGGGTGGGCAGG + Intergenic
986064517 5:4222802-4222824 CTCAGGGTCGGGGAGTCCGCAGG + Intergenic
988038331 5:25857219-25857241 CTGCTGGTCTGCTGGTCTGCTGG - Intergenic
990730144 5:58799642-58799664 CTGAGAGTGTGGGGGTGTGGAGG - Intronic
995531026 5:113091951-113091973 CTCAGGTTCTGTGGGTCTGTGGG + Intronic
996373351 5:122775650-122775672 CTGAGGGGCCGAGGGTCTGTGGG + Intronic
997201301 5:132011597-132011619 CTGCGGGGCTGCGGGGCTGCGGG - Exonic
997590455 5:135068980-135069002 CCGAGGGGCTGGGGGTCTAGGGG + Intronic
998401993 5:141852993-141853015 CTGAGGCTGTGGGGGGCAGCTGG - Intergenic
998820577 5:146054091-146054113 CTGCAGGTCTGGGGGTGTCCTGG + Intronic
1001545031 5:172565729-172565751 CTGAGCTTCTGGCGGTTTGCAGG + Intergenic
1001568082 5:172713385-172713407 CTGAGAGGCAGGGTGTCTGCTGG - Intergenic
1001809186 5:174614152-174614174 CTCAGGGTCTGGGTGGCAGCAGG - Intergenic
1002193718 5:177491525-177491547 CTGAGTGTCTGGGGCTCAGCTGG + Intronic
1003362668 6:5443667-5443689 CTGCGGGGCTGGGGCTCAGCTGG - Intronic
1004471034 6:15929231-15929253 CTGAGGCCATGGGGGTCTGTGGG + Intergenic
1005996925 6:30937137-30937159 GTGGGGGTCTGGGGGGCTGGAGG + Intergenic
1006934553 6:37708265-37708287 CTGAGGCCCTGAGGGTCTTCGGG + Intergenic
1007691882 6:43707738-43707760 CAGAGGGTCTGCCTGTCTGCAGG - Intergenic
1008544945 6:52576417-52576439 CTGCGGGTCTGGGAGTCTCTGGG + Intronic
1009386304 6:63086742-63086764 CTCAGCATCTGGTGGTCTGCTGG + Intergenic
1009453027 6:63824498-63824520 CAGAGGGTCTGTGGGTCCTCTGG - Intronic
1010843388 6:80675701-80675723 CTGAAGGTCTGTGGGTCAGCTGG + Intergenic
1011025908 6:82868843-82868865 CAGAGGATTTGGGGGTCTGAAGG - Intergenic
1011663834 6:89616729-89616751 CGCTGGGCCTGGGGGTCTGCAGG - Intronic
1013000561 6:106017863-106017885 CTGAGGGTCAGGGGGAGTGTGGG + Intergenic
1013039653 6:106421042-106421064 CTGAGGGTATGGGTCTGTGCTGG + Intergenic
1013666993 6:112359284-112359306 AATAGGCTCTGGGGGTCTGCTGG + Intergenic
1013667058 6:112359686-112359708 CTGAGAGCCCAGGGGTCTGCTGG - Intergenic
1013975550 6:116074316-116074338 CTGAGGGTCTCCAGCTCTGCTGG + Intergenic
1014304951 6:119728200-119728222 CAGAGGGTCTGTGGGTCCTCTGG + Intergenic
1014641345 6:123914616-123914638 CTGAGGGTTTGGTGATTTGCTGG + Intronic
1015935530 6:138403781-138403803 CAGAGGGTCTGGGGTCCTGTCGG + Intronic
1016102606 6:140120733-140120755 CTCAGGGAGTGGGGGTCTGGGGG + Intergenic
1016713969 6:147203639-147203661 CTGGGGGGCTGGGGGCCTGCTGG + Intergenic
1017067664 6:150544458-150544480 CAGGGAGTCTAGGGGTCTGCAGG - Intergenic
1018384179 6:163287845-163287867 CTGAGGGTTTTGTGGTCTGGAGG + Intronic
1018840697 6:167514335-167514357 CTGGGGGCCTGGGGGCCTGGAGG + Intergenic
1018840717 6:167514375-167514397 CTGGGGGACTGGGGGCCTGGGGG + Intergenic
1018840741 6:167514438-167514460 CTGGGGGACTGGGGGCCTGGAGG + Intergenic
1018840760 6:167514478-167514500 CTGGGGGACTGGGGGTCTGGGGG + Intergenic
1019020879 6:168916707-168916729 CTGAGGAGCTGGGGGACTCCTGG + Intergenic
1019127275 6:169849202-169849224 CTGTGGGTTTGGGGTGCTGCCGG - Intergenic
1019215224 6:170438932-170438954 CTGAGGGCCTAGGGGTCAGCAGG + Intergenic
1019492182 7:1320558-1320580 CTGAGGCTCTGGGGGGGTGGGGG + Intergenic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1019588260 7:1816213-1816235 CCGAGGGGCTGGTGGCCTGCGGG + Exonic
1020213459 7:6171828-6171850 CTGAGGGTGGGAGTGTCTGCTGG - Intronic
1020263173 7:6542869-6542891 CTGAGGGTCTGGTTGTCTCTGGG + Intronic
1020634787 7:10684336-10684358 CAGAGGGTCTCTGGGTCTGTGGG - Intergenic
1022110170 7:27225340-27225362 CCCAGGGGCTGGGTGTCTGCAGG + Intergenic
1022412140 7:30147470-30147492 CTGAGGGTGTGGGCCTCTGGGGG + Intronic
1022532744 7:31076990-31077012 CTGTGGGGCTGCGGGTCTTCGGG + Intronic
1023255882 7:38311640-38311662 CAGCGCGTGTGGGGGTCTGCTGG - Intergenic
1023844147 7:44111750-44111772 CCGAGGGTCTGGGGGACAGCTGG - Intronic
1023913248 7:44569952-44569974 CTGAGGGACTTGGGGTGTGCTGG - Intronic
1023965293 7:44960915-44960937 CTGAGGGGCTGAGGGGCTGAGGG + Intergenic
1023965462 7:44961418-44961440 CTGAGGGGCTGAGGGTTTGAGGG + Intergenic
1023965535 7:44961619-44961641 CTGAGGGGCTGAGGGCCTGAGGG + Intergenic
1023965537 7:44961627-44961649 CTGAGGGCCTGAGGGACTGAGGG + Intergenic
1024001723 7:45194399-45194421 CTGAGGGCCTGAGGGTCTAAGGG - Intergenic
1024255921 7:47539928-47539950 CTGAGGGTCTGGGGATGCGAAGG + Intronic
1026178972 7:68022137-68022159 CTGTGGGTCTGTGGGTGTCCAGG - Intergenic
1026403144 7:70036684-70036706 CTGTGGGTCTGTGGCTCTGGAGG + Intronic
1026906057 7:74063397-74063419 CTGGGGGCCTGGGGGCCTGGCGG - Intronic
1028234792 7:88347604-88347626 CTGAGGGTCTGGTGGTAAGTTGG + Intergenic
1028469130 7:91185906-91185928 CTGAGGCTGTGGGGGTTTGGGGG - Intronic
1031147803 7:118016590-118016612 CAGAGGGTCTGGGGTTCTCTTGG - Intergenic
1032192109 7:129771292-129771314 CAAAGGGTCTGGGTGTGTGCAGG - Intergenic
1033259577 7:139831196-139831218 CAGAGGTTCTGGGGGTGAGCTGG + Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034978884 7:155463336-155463358 CTGCGGGCCTGGGCGGCTGCTGG - Exonic
1035257901 7:157643697-157643719 CTGTGGGTGCGGGTGTCTGCAGG - Intronic
1035262699 7:157671830-157671852 GCCAGGGTCTGGGGGCCTGCTGG + Intronic
1035755614 8:2028965-2028987 CTCAGGGTTTGGGGTTCTCCTGG + Intergenic
1035833739 8:2727081-2727103 CAGAGGGTCTGTGGGTCCTCTGG - Intergenic
1036049017 8:5174857-5174879 CTGAGGTTCTGTGGGTCACCTGG - Intergenic
1036562013 8:9906087-9906109 CAGAGGGGGTGGGGGTCTGCGGG - Intergenic
1039751124 8:40479725-40479747 CTGAGGGACTGGAGGCCTACTGG + Intergenic
1040077161 8:43247460-43247482 CTGCGGGGCTGCGGGGCTGCGGG - Intergenic
1040077164 8:43247468-43247490 CTGCGGGGCTGCGGGGCTGCGGG - Intergenic
1040750839 8:50704753-50704775 GTGAGAGTCTGTGGGACTGCAGG + Intronic
1042066808 8:64886289-64886311 CTGAGATGCTGGGGGACTGCTGG + Intergenic
1042221527 8:66479085-66479107 CTGAGTATCTGGGGGCATGCAGG - Intronic
1043395220 8:79828876-79828898 TTGAGTGTCTGGGAGTCTGAGGG - Intergenic
1044242441 8:89902683-89902705 CTCGGGGTCGCGGGGTCTGCCGG - Exonic
1048074578 8:131055494-131055516 CTGAGGGTCAGAGGGACTACAGG + Intergenic
1049017975 8:139934836-139934858 CTGAGAGTCTGAGTGGCTGCAGG - Intronic
1049184980 8:141245533-141245555 CTGATGCTCTGGGATTCTGCTGG - Intronic
1049312010 8:141938319-141938341 CTGAGGGTCAGGGGTCCTGGTGG - Intergenic
1049468502 8:142764572-142764594 CTGAGCGTCCGGGGGCCTGGAGG + Exonic
1049476431 8:142799177-142799199 CTGAGGGTCTGGGGGCAAACGGG - Intergenic
1049586676 8:143435642-143435664 GAGAGTGTCTGGGGGTCCGCCGG - Intergenic
1049687998 8:143946676-143946698 CTGCTGGGCGGGGGGTCTGCTGG - Intronic
1049773447 8:144394187-144394209 CTGAGGCTCTGGGGGTGGCCGGG - Intronic
1049782490 8:144435313-144435335 CAGAGGGGCTGGTGGTGTGCTGG - Intronic
1049850078 8:144826328-144826350 CTGGGGGTCTGGAGGGCGGCTGG + Intergenic
1050726914 9:8660567-8660589 CTGAGGGGCTGGGAGCCAGCTGG - Intronic
1053886821 9:42649981-42650003 GTAAGGGTGTGGGGGTGTGCAGG - Intergenic
1054225840 9:62457431-62457453 GTAAGGGTGTGGGGGTGTGCAGG - Intergenic
1056797981 9:89671999-89672021 CTAAGCGTCTGGTGGTTTGCTGG - Intergenic
1057208519 9:93186962-93186984 CTGGGGGTCCTGGGGTGTGCTGG + Intronic
1059375120 9:113875860-113875882 CCGAGGGGCTGGGGGACTGGGGG + Intergenic
1060222783 9:121773354-121773376 TTGAGGGTCTTGGGTACTGCAGG - Exonic
1060770017 9:126326335-126326357 CTGAGGGCCTGGGGGCTTCCAGG + Intergenic
1061246862 9:129405008-129405030 CTGAGTGAGTGGGGGGCTGCTGG + Intergenic
1061954935 9:133956379-133956401 CAGCGGGTCTGGGGGCCTGGTGG + Intronic
1062050941 9:134446717-134446739 CTGGGGGGCTGGGGGGCTGCTGG + Intergenic
1062086922 9:134653808-134653830 CTGTAGGGCTGGGGGTGTGCAGG + Intronic
1062186891 9:135223092-135223114 GGGAGGGTCTGGGTGGCTGCTGG + Intergenic
1062309117 9:135926482-135926504 CAGAGGGTGTGAGGATCTGCGGG + Intergenic
1203731711 Un_GL000216v2:98034-98056 TTAAGGGTGTGGGGGGCTGCAGG - Intergenic
1187669875 X:21657432-21657454 CTGAGGCCCTGGGGCTCTGTGGG - Exonic
1187954245 X:24500372-24500394 CTGAGGATTTGGGTATCTGCGGG + Intronic
1188918886 X:35947337-35947359 CTGCAGGTCTGTGGGTCAGCTGG + Intronic
1188918923 X:35947614-35947636 CTGCAGGTCTGTGGGTCAGCTGG - Intronic
1189714743 X:43853773-43853795 CTTAGTGTCTGGTGGTTTGCTGG - Intronic
1192155488 X:68743474-68743496 CTGAGGCTGTGGGGGTCTGGGGG - Intergenic
1192189996 X:68985279-68985301 CTGTGCCTCTGTGGGTCTGCTGG - Intergenic
1192656912 X:73002747-73002769 CTGCGGGGCTGCGGGGCTGCCGG - Intergenic
1192656914 X:73002755-73002777 CTGCGGGGCTGCGGGGCTGCGGG - Intergenic
1192656917 X:73002763-73002785 CTGCGGGGCTGCGGGGCTGCGGG - Intergenic
1192656920 X:73002771-73002793 CTGCGGGGCTGCGGGGCTGCGGG - Intergenic
1192656923 X:73002779-73002801 CTGCGGGGCTGCGGGGCTGCGGG - Intergenic
1192656926 X:73002787-73002809 CTGCGGGGCTGCGGGGCTGCGGG - Intergenic
1192656929 X:73002795-73002817 CTGCGGGGCTGCGGGGCTGCGGG - Intergenic
1192656932 X:73002803-73002825 CTGCGGGGCTGCGGGGCTGCGGG - Intergenic
1192656935 X:73002811-73002833 CTGCGGGGCTGCGGGGCTGCGGG - Intergenic
1192665185 X:73080190-73080212 CTGCGGGGCTGCGGGGCTGCGGG + Intergenic
1192665188 X:73080198-73080220 CTGCGGGGCTGCGGGGCTGCGGG + Intergenic
1192665191 X:73080206-73080228 CTGCGGGGCTGCGGGGCTGCGGG + Intergenic
1192665194 X:73080214-73080236 CTGCGGGGCTGCGGGGCTGCGGG + Intergenic
1192665197 X:73080222-73080244 CTGCGGGGCTGCGGGGCTGCGGG + Intergenic
1192665200 X:73080230-73080252 CTGCGGGGCTGCGGGGCTGCGGG + Intergenic
1192665203 X:73080238-73080260 CTGCGGGGCTGCGGGGCTGCGGG + Intergenic
1192665206 X:73080246-73080268 CTGCGGGGCTGCGGGGCTGCGGG + Intergenic
1192665208 X:73080254-73080276 CTGCGGGGCTGCGGGGCTGCCGG + Intergenic
1192994838 X:76502164-76502186 GTCAGGGTGTGGGGGTCTTCAGG + Intergenic
1195338468 X:103879921-103879943 CTGTGGGTCAGGGGCTCTCCAGG + Intergenic
1195772016 X:108361453-108361475 CTGAGGCTCTGGGATTCTTCAGG - Intronic
1196898183 X:120358616-120358638 CTGGGAGGCTGGGGCTCTGCCGG + Intergenic
1197719537 X:129735756-129735778 CTGAGGTTCTGCAGTTCTGCAGG - Intergenic
1200045857 X:153400832-153400854 CTGTGGGGCTGGGGGTCGGGAGG - Intergenic
1200055221 X:153456701-153456723 CTGTGGGGCTGAGGGCCTGCTGG - Intronic
1200696501 Y:6365780-6365802 CTGAGGCTCTGAGGTTCTGTAGG + Intergenic
1200702817 Y:6416711-6416733 CTGAGGTTGTGTGGTTCTGCAGG + Intergenic
1200923041 Y:8629970-8629992 CTGAGGCTGTGTGGTTCTGCAGG - Intergenic
1200980264 Y:9257737-9257759 CTGAGGCTGTGTGGTTCTGCAGG - Intergenic
1200981898 Y:9270209-9270231 CTGAGGCTGTGTGGTTCTGCAGG + Intergenic
1201031293 Y:9747986-9748008 CTGAGGTTGTGTGGTTCTGCAGG - Intergenic
1201037612 Y:9798919-9798941 CTGAGGCTCTGAGGTTCTGTAGG - Intergenic
1202128516 Y:21589521-21589543 CTGAGGCTGTGTGGTTCTGCAGG - Intergenic
1202129373 Y:21596140-21596162 GTGAGTTTCTGGGGGTCTTCGGG - Intergenic
1202149643 Y:21833110-21833132 CTGAGGCTGTGTGGTTCTGCAGG - Intergenic
1202150768 Y:21841930-21841952 CTGAGGCTGTGTGGTTCTGCAGG + Intergenic
1202177499 Y:22111371-22111393 CTGAGGCTGTGTGGTTCTGCAGG + Intergenic
1202213862 Y:22475013-22475035 CTGAGGCTGTGTGGTTCTGCAGG - Intergenic
1202370541 Y:24192778-24192800 AGGAGGGGCTGAGGGTCTGCTGG + Intergenic
1202500243 Y:25477339-25477361 AGGAGGGGCTGAGGGTCTGCTGG - Intergenic