ID: 900187696

View in Genome Browser
Species Human (GRCh38)
Location 1:1339998-1340020
Sequence GCGGGGTGACATGTAGCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 81}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900187696_900187706 15 Left 900187696 1:1339998-1340020 CCCGCAGCTACATGTCACCCCGC 0: 1
1: 0
2: 0
3: 5
4: 81
Right 900187706 1:1340036-1340058 ACCTGCAGCAACATGTCGCCGGG 0: 1
1: 0
2: 0
3: 4
4: 102
900187696_900187705 14 Left 900187696 1:1339998-1340020 CCCGCAGCTACATGTCACCCCGC 0: 1
1: 0
2: 0
3: 5
4: 81
Right 900187705 1:1340035-1340057 CACCTGCAGCAACATGTCGCCGG 0: 1
1: 0
2: 1
3: 7
4: 117
900187696_900187708 25 Left 900187696 1:1339998-1340020 CCCGCAGCTACATGTCACCCCGC 0: 1
1: 0
2: 0
3: 5
4: 81
Right 900187708 1:1340046-1340068 ACATGTCGCCGGGCTCGATGCGG 0: 1
1: 0
2: 0
3: 0
4: 12

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900187696 Original CRISPR GCGGGGTGACATGTAGCTGC GGG (reversed) Intronic
900187672 1:1339920-1339942 GCTGGGGGACATGCGGCTGCGGG - Intronic
900187696 1:1339998-1340020 GCGGGGTGACATGTAGCTGCGGG - Intronic
900187707 1:1340037-1340059 GCCCGGCGACATGTTGCTGCAGG - Exonic
900998027 1:6133380-6133402 GCAGGGTGACCTGGGGCTGCAGG + Intronic
902280599 1:15371536-15371558 GAGGGGTCACATGGAGCTCCTGG + Intronic
904944022 1:34185919-34185941 GCAAGGTGACATGCACCTGCTGG - Intronic
905004947 1:34702174-34702196 TCGGGGTGACTTGTAGATGGTGG + Intergenic
915490059 1:156245837-156245859 GCGGGGCGACATGGAGCTGAAGG + Exonic
917876753 1:179293463-179293485 GCGTGGTAGCATGGAGCTGCAGG - Intergenic
924948634 1:248863188-248863210 GCGGAGCGACATGTTGCTCCTGG + Intergenic
1062860107 10:804322-804344 CCGGGGTCACACGGAGCTGCAGG + Intergenic
1063895040 10:10671026-10671048 GCACGGTGGCATGTACCTGCAGG + Intergenic
1065821893 10:29533237-29533259 GCGGTGTGACCGGTATCTGCGGG + Exonic
1066454860 10:35564358-35564380 CTGGGGAGACATGAAGCTGCTGG - Intronic
1075724845 10:124605950-124605972 GCTGGGAGGCATGTGGCTGCAGG - Intronic
1080895544 11:36446368-36446390 GCTGGGTGACCTGCTGCTGCTGG + Exonic
1084750183 11:71199438-71199460 GAGTGGTCACGTGTAGCTGCAGG - Intronic
1087268302 11:96084563-96084585 GGGTGGGGACATGTAGCCGCTGG - Intronic
1092203984 12:6604578-6604600 GGGTGGTGAGATGTAGCTGATGG - Intronic
1094190070 12:27689146-27689168 GCGAGATGCCATGGAGCTGCCGG + Exonic
1095577932 12:43760447-43760469 TCTGGGTGAGATGTAGATGCTGG - Intronic
1096797339 12:54086094-54086116 GCTGGGTGATGTTTAGCTGCTGG - Intergenic
1097648440 12:62264121-62264143 GCGTGGTGGCATGTGCCTGCAGG - Intronic
1100577245 12:95904590-95904612 GCGTTGTCACATGTAGATGCAGG - Intronic
1100873685 12:98940104-98940126 GAGGAGTGAGATGTAACTGCAGG - Intronic
1103901300 12:124304829-124304851 AGGGGGTGACATGTAGCCACAGG - Intronic
1106449592 13:29868076-29868098 GCGTGGTGGCATGCACCTGCAGG + Intergenic
1114912610 14:27219721-27219743 GCGGGGTGAGCTGTTTCTGCAGG - Intergenic
1115537723 14:34389047-34389069 GCGGGCTGACATTTAGGTGCTGG - Intronic
1118280916 14:64427693-64427715 GATGGGTGATATGTAGCTGGAGG + Intronic
1121781136 14:96623396-96623418 CCGGGGTGTCATGTAGAAGCTGG - Intergenic
1122019369 14:98824093-98824115 TGGGTGTGACATGTTGCTGCGGG + Intergenic
1136654352 16:31700942-31700964 GCGGGGAGACACGGGGCTGCGGG - Intergenic
1141567194 16:84910741-84910763 GCGGGGTGACCTGTCACAGCTGG + Intronic
1142359314 16:89619171-89619193 GCGGGGGGGCAGGGAGCTGCAGG - Intronic
1142359355 16:89619262-89619284 GCGGGGGGGCAGGGAGCTGCAGG - Intronic
1142359383 16:89619322-89619344 GCGGGGGGGCAGGGAGCTGCAGG - Intronic
1147162799 17:38577911-38577933 GCTGGGTGACTTGGAGCTGGAGG - Intronic
1148327401 17:46791171-46791193 TTGGGGGGAAATGTAGCTGCAGG - Intronic
1149302708 17:55319370-55319392 TCTGGGTGGCATGTAACTGCAGG + Intronic
1149595530 17:57862550-57862572 GCTGGGTGACCGGGAGCTGCTGG + Exonic
1157922882 18:51731844-51731866 ACTGGGTGACATGTAACAGCGGG - Intergenic
1160095236 18:75865890-75865912 GCGGGGAGGGAGGTAGCTGCAGG - Intergenic
1160586895 18:79918036-79918058 AGGGGGTGAGATGTAGGTGCAGG - Intronic
1165567730 19:36745877-36745899 GCTGGGTGTCATGGTGCTGCTGG + Exonic
1165854596 19:38871782-38871804 GATGGGTGACCTGTACCTGCTGG + Exonic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
1167359098 19:49020414-49020436 GCGGTGGGAAAAGTAGCTGCTGG + Intergenic
925155094 2:1642842-1642864 GCGGGGGGCCCTGTAGCTGAGGG - Intronic
934762498 2:96864363-96864385 CAGGGGTGACATGTACCTGTCGG - Exonic
935275943 2:101475065-101475087 GCTGTGTGACATGGAGCTGCTGG + Intergenic
936560986 2:113539723-113539745 GCGTGGTGGCATGTACCTGTAGG + Intergenic
937910770 2:127074466-127074488 GCGGGCTGCCAGGTGGCTGCTGG - Intronic
938754702 2:134368937-134368959 GAGGGGTGACATCTGGCTGAGGG - Intronic
946016114 2:216605480-216605502 GCAGGCTGAAATGAAGCTGCAGG - Intergenic
948982039 2:241499370-241499392 GCAGGGTGACGTGAAGCTGGCGG - Exonic
1171849183 20:30295952-30295974 GCTGGGTGATGTTTAGCTGCTGG - Intergenic
1172622982 20:36331785-36331807 GCAGGGTGACAGGTGTCTGCTGG + Intronic
1173870323 20:46337757-46337779 GAGGGGTGACCTGTGGCTCCTGG + Intergenic
1178672055 21:34600154-34600176 GCTGGGTGGCATGCTGCTGCAGG + Intronic
1180665322 22:17506263-17506285 GCGTGGTGGCATGTGCCTGCAGG - Intronic
1183440181 22:37818555-37818577 GCGGGGTGACGTGTGGCAGTCGG + Intergenic
952925406 3:38316242-38316264 GTGGGTTTTCATGTAGCTGCTGG + Intronic
953792862 3:45961759-45961781 GCTGGGTGACAGGTACCTGGAGG + Intronic
954031564 3:47823737-47823759 GCTGGGTGACAGGTACTTGCAGG - Intronic
954745324 3:52784465-52784487 GAGGGGAGACCTGCAGCTGCTGG - Exonic
965495911 3:169398839-169398861 GCAGGGTGAAATGTATGTGCGGG + Intronic
968699257 4:2047027-2047049 GCGGGGTGGAACGGAGCTGCGGG - Intergenic
972686981 4:41361052-41361074 GGGGGGTGACCTGGAGCAGCTGG - Intronic
972719824 4:41684874-41684896 GCCGGGTGAGATGTGGGTGCTGG + Intronic
975996443 4:80321497-80321519 GCGGGGGGACATGTGGCCACAGG - Intronic
977087988 4:92628947-92628969 GTGGGGTGGCAGGTGGCTGCTGG + Intronic
985073491 4:186191224-186191246 GCGGGGTCACATGGAGCAGCGGG - Intergenic
999456292 5:151719158-151719180 GCGTGGTGACATGTGCCTGTAGG - Intergenic
1002199421 5:177519268-177519290 GGGGTGGGACATGTAGCTGAGGG - Intergenic
1005989113 6:30892339-30892361 GCGGGGTGGAATGTCGCTTCCGG + Exonic
1018227630 6:161644508-161644530 GCAGGGAAAGATGTAGCTGCCGG - Intronic
1019687847 7:2391635-2391657 GCGGGCTGACAGGGACCTGCTGG + Intergenic
1021159228 7:17251019-17251041 ACTGGGTTACAAGTAGCTGCAGG - Intergenic
1028414867 7:90569036-90569058 CCAGGGAGACCTGTAGCTGCAGG - Intronic
1036454103 8:8893099-8893121 GCGGCGCGGCATGTAGCTGCGGG - Exonic
1037832364 8:22197019-22197041 GCGGGGGGACATGTAGCAAGTGG + Intronic
1049891694 9:75603-75625 GCGTGGTGGCATGTACCTGTAGG - Intergenic
1053733121 9:41076694-41076716 GCGTGGTGGCATGTACCTGTAGG - Intergenic
1053786904 9:41658671-41658693 GCTGGGTGATGTTTAGCTGCTGG - Intergenic
1054695302 9:68354869-68354891 GCGTGGTGGCATGTACCTGTAGG + Intronic
1190752501 X:53374446-53374468 GCCGGGAGCCATGAAGCTGCAGG - Exonic