ID: 900191258

View in Genome Browser
Species Human (GRCh38)
Location 1:1353258-1353280
Sequence TGGGGCTGCCAGGTTCTGAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 200}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900191244_900191258 20 Left 900191244 1:1353215-1353237 CCCTGGAGGAGTGGGACTCCTGC 0: 1
1: 1
2: 0
3: 14
4: 209
Right 900191258 1:1353258-1353280 TGGGGCTGCCAGGTTCTGATGGG 0: 1
1: 0
2: 2
3: 16
4: 200
900191248_900191258 -2 Left 900191248 1:1353237-1353259 CCCTGAGGCTGACCCCAGTTTTG 0: 1
1: 0
2: 0
3: 15
4: 134
Right 900191258 1:1353258-1353280 TGGGGCTGCCAGGTTCTGATGGG 0: 1
1: 0
2: 2
3: 16
4: 200
900191249_900191258 -3 Left 900191249 1:1353238-1353260 CCTGAGGCTGACCCCAGTTTTGG 0: 1
1: 0
2: 0
3: 12
4: 139
Right 900191258 1:1353258-1353280 TGGGGCTGCCAGGTTCTGATGGG 0: 1
1: 0
2: 2
3: 16
4: 200
900191247_900191258 2 Left 900191247 1:1353233-1353255 CCTGCCCTGAGGCTGACCCCAGT 0: 1
1: 0
2: 2
3: 42
4: 321
Right 900191258 1:1353258-1353280 TGGGGCTGCCAGGTTCTGATGGG 0: 1
1: 0
2: 2
3: 16
4: 200
900191245_900191258 19 Left 900191245 1:1353216-1353238 CCTGGAGGAGTGGGACTCCTGCC 0: 2
1: 0
2: 2
3: 34
4: 345
Right 900191258 1:1353258-1353280 TGGGGCTGCCAGGTTCTGATGGG 0: 1
1: 0
2: 2
3: 16
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900191258 Original CRISPR TGGGGCTGCCAGGTTCTGAT GGG Exonic
900191228 1:1353148-1353170 CAAGGCTGCCAAGTTCTGATGGG + Exonic
900191258 1:1353258-1353280 TGGGGCTGCCAGGTTCTGATGGG + Exonic
900399763 1:2468086-2468108 TGGGGGTGCCAGGGGCTGGTAGG + Intronic
900892514 1:5459712-5459734 TGGTGCAGCCAGGGTCTGATAGG + Intergenic
900915957 1:5638801-5638823 TGGGGAAGCCATCTTCTGATTGG - Intergenic
901866976 1:12112772-12112794 TGGCGCTGGGAGGTTGTGATGGG - Intronic
902334956 1:15749375-15749397 TGAGGATTCCAGGCTCTGATGGG + Intergenic
902922473 1:19674935-19674957 AGGGGCTGCGAGGTGCTTATGGG + Intronic
903366914 1:22810877-22810899 TGGGGCTGCCAGGGCCTCTTGGG - Intronic
904266104 1:29319336-29319358 TGGGGCTCCCTGGCCCTGATGGG + Intronic
904294857 1:29513586-29513608 TGGGGAAGCAAGGCTCTGATTGG + Intergenic
905478996 1:38248383-38248405 TGGGGCTGCCCAGTTCTAGTTGG + Intergenic
905862890 1:41362385-41362407 TGGGGCTTCCAGGGGCTGCTAGG + Intronic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
907554455 1:55332623-55332645 TTGGGCAGCCAGGTCCTGAGCGG + Intergenic
912961029 1:114196187-114196209 TGGAGCTGTCAGGACCTGATGGG + Intergenic
913544871 1:119858310-119858332 TGGGGCTGCCCTGCTCTGAGTGG + Intergenic
915275483 1:154785212-154785234 TGGGGCTGCTGGGCCCTGATTGG + Intronic
916352210 1:163863698-163863720 AGGGGCTGCCAGGTGATGAATGG + Intergenic
916686583 1:167152619-167152641 TCTGGCTGCCAGGCTGTGATGGG + Intergenic
916762751 1:167832066-167832088 TGGGGAAGGCAGTTTCTGATGGG + Intronic
920301485 1:204991734-204991756 TGGGGCTGCCATCTCCTGAAAGG + Intronic
920415613 1:205797443-205797465 TGGGGCTGCAATCCTCTGATTGG - Intronic
920548326 1:206837246-206837268 TGGGGGTGCCAGGTGCTCAGAGG + Intronic
921599335 1:217089941-217089963 AGAGGCTGCCAGGTTCTCCTCGG + Intronic
923148823 1:231216415-231216437 TTGGGCTGCCAGTTTCAGAAAGG - Exonic
924312873 1:242763968-242763990 TGGGGCTGCATGGTCCTGCTTGG - Intergenic
924621259 1:245663120-245663142 TGTGGCTGCCTGGCTCTGCTTGG + Intronic
1063542545 10:6948889-6948911 GGTGGCTGCCAGGGGCTGATGGG + Intergenic
1065622877 10:27601111-27601133 TGTGGCTGCCAGGCCCTGATAGG + Intergenic
1065819427 10:29511365-29511387 TGGGACTCCCAGTTCCTGATGGG + Intronic
1065896101 10:30164361-30164383 GTGGGCTGCCAGCTTCTCATAGG - Intergenic
1065953420 10:30673049-30673071 TGGGACTCCCAGTTCCTGATGGG - Intergenic
1067692643 10:48511773-48511795 TGGGGTTGCCTGGTCCTGAATGG + Intronic
1069742007 10:70690820-70690842 TGTGGCTGCCAGGCCCTGAGCGG - Intronic
1072047454 10:91671166-91671188 TGAGGCTGGGAGCTTCTGATTGG - Intergenic
1072551828 10:96484198-96484220 TGGGTCTTACAGGTTCTGCTTGG - Intronic
1072956096 10:99889383-99889405 TGGGAGTGCCAGGGTCGGATGGG - Intronic
1073187598 10:101625991-101626013 TTGGCCTGCCAGTTGCTGATGGG + Intronic
1076636008 10:131882367-131882389 TGGGGCTGCCAGGGGCTGGCGGG - Intergenic
1076785240 10:132746294-132746316 TTGGGCTGACAGGGTCTGAGAGG + Intronic
1077100103 11:818908-818930 TGGGGCTGCCTGCGTCTGACTGG - Exonic
1078397966 11:10998789-10998811 TGGGACTGGCAGGATCAGATGGG - Intergenic
1078874973 11:15384286-15384308 TGGTGCTTCCAGGCTCTCATCGG + Intergenic
1079722564 11:23836738-23836760 TGGGCCTGCCATGCTCTTATGGG + Intergenic
1081872380 11:46389379-46389401 GGGAGCTGCCAGGTGCTGACAGG + Intergenic
1084376726 11:68782999-68783021 TGGGGATTCCAGGCTCTGAGAGG + Intronic
1084901741 11:72315033-72315055 AGGAGCTGCCTGGTTCAGATAGG + Intronic
1088399443 11:109407227-109407249 TGGGCCTGCCACTTTCAGATGGG + Intergenic
1088624886 11:111722936-111722958 TGGGGCTGCCAGTGCCTGACAGG - Intronic
1090964311 11:131584896-131584918 TGGTGCTGCCAGGATCCGCTTGG + Intronic
1091449437 12:563205-563227 TGGGGCTGCCAGTTTCTTTCTGG + Exonic
1092582050 12:9852411-9852433 AGGAGCTGGCAAGTTCTGATTGG + Intergenic
1096908721 12:54961203-54961225 TGGGGGTGCCTGGGTCTGCTGGG + Exonic
1096938905 12:55319552-55319574 GGGAGCTGCCAAGTTTTGATTGG + Intergenic
1101064284 12:101003137-101003159 TGTGTCAGCCAGGTTCTGCTGGG + Intronic
1102212597 12:111138190-111138212 TGTATCTGCCAGTTTCTGATAGG + Intronic
1103720500 12:122972441-122972463 GGGGGCTGGAATGTTCTGATTGG + Intronic
1103927985 12:124434199-124434221 TGGGGGTCCCAGGGTCTGAGGGG + Intronic
1103989029 12:124786027-124786049 CGGGGATGCCAGGTTCTGTTAGG - Intronic
1104153144 12:126104542-126104564 TGGGTCTGCTAGGATCTGAGTGG + Intergenic
1104950672 12:132438527-132438549 TGGGGCTCCCGGGGTCTGAAGGG + Intergenic
1113071365 13:106424635-106424657 TGAGGATTCCAGTTTCTGATAGG - Intergenic
1114055999 14:18967351-18967373 TGGGGTTGGCAGGTTTTGGTCGG + Intergenic
1114106550 14:19434402-19434424 TGGGGTTGGCAGGTTTTGGTCGG - Intergenic
1117454266 14:55881994-55882016 TGGAACTGCCAGGCTCTGGTCGG + Intergenic
1120801260 14:88691241-88691263 TGGGTCTGGCAGGTTTTGGTTGG - Intronic
1121413311 14:93762498-93762520 TGAGTCAGCCTGGTTCTGATGGG - Intronic
1122413438 14:101537526-101537548 CAGGGCAGCCAGGTTCTGAGAGG + Intergenic
1122725938 14:103752342-103752364 TGTGGCTGCCAGGCTCTGGAGGG + Intronic
1122960801 14:105092942-105092964 TGGGATTGCCAGGGTCTGGTGGG + Intergenic
1126139347 15:45424585-45424607 GGGGGCTGCCAGGGTCTGAAGGG + Intergenic
1127997178 15:64160031-64160053 TGGGAGGGCCAGGTTCTGCTGGG - Intronic
1128326106 15:66725292-66725314 AGGGGGTGCCAGGTCCTGACTGG - Intronic
1128765063 15:70246360-70246382 AGGGGCTGCAGGGTTGTGATGGG - Intergenic
1128978280 15:72168743-72168765 TGGTGCTGCTAGGTCCTGACAGG + Intronic
1129827000 15:78640868-78640890 TGGGTCTGCCAGGTTTGGAGTGG - Intronic
1130050510 15:80480120-80480142 TGGAGGTGCCAGGATCAGATGGG + Intronic
1131263868 15:90904237-90904259 TGGGGCTGCCATCTTCTGTGTGG + Exonic
1132018358 15:98338987-98339009 TGGGGCTGGAGAGTTCTGATTGG + Intergenic
1132654265 16:1035321-1035343 TGGGGCTGCCTGGTTCCAAGCGG + Intergenic
1133564425 16:6979919-6979941 TGGAACTGCCAGTTTCTGAGAGG + Intronic
1134035300 16:11025444-11025466 TGGGGTTGACAGGTTTTGTTGGG + Intronic
1135724590 16:24844903-24844925 TGGGCCTGCCAGGCTCTGGGGGG - Intergenic
1137696740 16:50466687-50466709 TGGGGCTGCCAGTTTGTGGGGGG + Intergenic
1138299010 16:55910887-55910909 TGGAGGTACCAGGGTCTGATGGG + Intronic
1140195116 16:72848927-72848949 CCGGGCTGCCAGGTTATGCTTGG + Intronic
1141020206 16:80488372-80488394 AGGAGCTGGCAGGTTCTGACTGG - Intergenic
1141035772 16:80624085-80624107 TGTTGCTGCAAGGTTGTGATTGG - Intronic
1141920121 16:87130039-87130061 TGGGGGGTGCAGGTTCTGATGGG - Intronic
1143720676 17:8806913-8806935 TGGACCTGCCTGGTTCTGAGAGG + Intronic
1146470673 17:33121868-33121890 TGAGGCTGACAGGTTCTCTTGGG - Intronic
1147573758 17:41587137-41587159 TGGGACTCCCAGGGTCCGATGGG - Intergenic
1147770707 17:42866247-42866269 TTGGGCAGCCAGGTCCTGAGGGG - Intergenic
1148209859 17:45801578-45801600 TGGGGCTGCCAGGCTGTGCACGG + Intronic
1148547765 17:48530379-48530401 TGGGGGTGTTAGGTTCTGAAGGG + Exonic
1151849330 17:76681104-76681126 GTGGGCTGCCAGGTTCTGTGCGG - Intronic
1152433819 17:80263330-80263352 TGGGGCAGCCACGTGCTGTTCGG - Intronic
1153805794 18:8707046-8707068 TGAGGCTGGCACGTTCTGAGCGG - Intronic
1155026804 18:21948069-21948091 TGGTGTTGCCAGGGGCTGATGGG + Intergenic
1157322796 18:46647164-46647186 TGGGGCAGCCAGCTTCTCCTGGG - Intronic
1160371775 18:78378066-78378088 TGGGGCTGCCTGGGTCTAACAGG - Intergenic
1160757296 19:764421-764443 TGGGGCTGTCAGGTTCCCATGGG + Intergenic
1161486548 19:4538824-4538846 TGGAGCTGCCATGGTCTGAGCGG + Exonic
1162320751 19:9969662-9969684 AGGGGGAGCCAGGTCCTGATGGG - Exonic
1162337708 19:10071727-10071749 TGGGGCTGCCAGGTTGTGGGGGG + Intergenic
1163511745 19:17739558-17739580 TGGGGGTGCCAGGTCCTGGTGGG + Intergenic
1165285216 19:34836191-34836213 GGGAGCTGGCAAGTTCTGATTGG - Intergenic
1165370633 19:35403542-35403564 GGGGGCTGTCAGTTTCTGACTGG + Intergenic
1165889310 19:39100953-39100975 CCGGGCTGCCCGGTTCTTATTGG - Exonic
1166301469 19:41914030-41914052 GTGGGCTGCCAGGGTCTGAGGGG - Intronic
1166704495 19:44901127-44901149 TGGTGCTGCCAGGGGCTGCTGGG + Intronic
1166773307 19:45297711-45297733 TGGGGGTGCCAGGCTGTGACTGG - Exonic
1167994372 19:53390445-53390467 TGGGTCCTCCGGGTTCTGATTGG + Intronic
1168002958 19:53463619-53463641 TGGGTCCTCCGGGTTCTGATTGG + Intergenic
1168444262 19:56398233-56398255 TGGGGCAGCCAGCTTCTGATTGG - Intronic
927926086 2:27014724-27014746 TGGGGCTGAGGGGTTCTGAGGGG - Intronic
930109860 2:47669193-47669215 TTGGGTTGGCAGGGTCTGATTGG + Intergenic
930988472 2:57619962-57619984 TGGTGCTGCCAGCCACTGATGGG + Intergenic
932094199 2:68832333-68832355 TGGGGCTCACAGCTTCTGAGAGG + Intergenic
932657910 2:73626356-73626378 TGGGGTTGCCAGGGTTTGAGGGG - Intergenic
932664590 2:73686695-73686717 TGGGGTTGCCAGGGTTTGAGGGG - Intergenic
933264715 2:80169383-80169405 TGGGAAGGCCAGATTCTGATTGG - Intronic
936026640 2:109035673-109035695 TGGGGCTAGAAGGTTCTGTTAGG - Intergenic
937855848 2:126671571-126671593 TGGAGCTACCAGGTTATGACTGG - Intronic
947525668 2:230875336-230875358 TGGGTCTGCCAGGTTCTAGGTGG - Intronic
948523146 2:238554299-238554321 TGGAGCTGCCAGGCTTTGAGTGG - Intergenic
948844018 2:240674648-240674670 TGGGGCTGCCAGATCCTGCCAGG - Intergenic
1169836006 20:9879969-9879991 TGGGTCAGCCAGCCTCTGATAGG + Intergenic
1169878319 20:10321560-10321582 TGGGGCTGCCATCTTCAGAAGGG - Intergenic
1169926989 20:10793869-10793891 TGAGGCTGCCAGGGCCTGAGCGG - Intergenic
1170722587 20:18897032-18897054 AGGAGCTGGCAAGTTCTGATAGG + Intergenic
1171176167 20:23051826-23051848 TAGGGCTGGCAGGTTCAGAAGGG - Intergenic
1172212699 20:33212236-33212258 TTGGGCTGCCTGGCTCTGATAGG - Intergenic
1174223053 20:48972731-48972753 TGGTGCTGCCAATTTTTGATTGG + Intronic
1177941759 21:27420684-27420706 TGGGGCTGACAGGCTCAAATAGG - Intergenic
1180474478 22:15689943-15689965 TGGGGTTGGCAGGTTTTGGTCGG + Intergenic
1180975365 22:19845057-19845079 TGGGGCTGACACTTTCTGACAGG + Intronic
1182044805 22:27265971-27265993 TGGCGATGCCAGGCTCTGTTTGG - Intergenic
1182424859 22:30266577-30266599 TGGAGATGCCAGGTTCTCAGTGG + Intronic
1183950611 22:41350634-41350656 TGGGGCTACCATGTTCTAAGAGG + Intronic
1184292015 22:43502439-43502461 TGAGGCTGCAAGGTCCTGAATGG + Intronic
1184306607 22:43607156-43607178 TGGGGCTCCCAGGGTCAGAAAGG - Intronic
949215368 3:1560959-1560981 TGAGGTTTCCAGGCTCTGATTGG + Intergenic
950531834 3:13556699-13556721 TGGGGTTCCCAGGGTCTGGTTGG + Intronic
953503370 3:43459586-43459608 TGGAGCTGCCAGTTTCTCAGTGG + Intronic
959747865 3:109798425-109798447 TGTCGCTGCCAGGTTTTGGTAGG - Intergenic
962374080 3:134846047-134846069 TGGGGCTGCCAGCCTGTGCTTGG + Intronic
964580925 3:158236896-158236918 GGGAGCTGCCAGTCTCTGATTGG + Intronic
964590858 3:158360949-158360971 TGGGGGTTCCAGGTTCTCACTGG + Intronic
966160825 3:176966520-176966542 TGTGGCTGTCGGGGTCTGATAGG - Intergenic
968397583 4:256992-257014 TGGACTTTCCAGGTTCTGATAGG + Intergenic
968737029 4:2303066-2303088 TGAGGCTCCCAGGGCCTGATGGG + Intronic
968802933 4:2755497-2755519 TGAGGGTGCAAGGTTCTGAAGGG - Intronic
969263115 4:6046183-6046205 TGGTCCTGCCAGGTTCTCAGGGG + Intronic
969595691 4:8148225-8148247 TGGGCCAGGCAGGTTCTGAAGGG + Intronic
970923927 4:21428108-21428130 TGGGGCTGGCAGTATCTGAGTGG + Intronic
972994458 4:44863326-44863348 TGCTGCTGCCAGGTTCTGACAGG + Intergenic
976005910 4:80430734-80430756 TGGGGATGCCATGTACTGAATGG - Intronic
981326494 4:143454528-143454550 TGGAGCTGGCAAGATCTGATTGG + Intronic
983385056 4:167050872-167050894 TGGGGTTGCCAAGTGCTGAGGGG + Intronic
983946044 4:173586362-173586384 AGGTGCTGGGAGGTTCTGATCGG + Intergenic
992748640 5:79842368-79842390 TGAGGCTGCCAGGGACTGCTGGG - Intergenic
994066096 5:95544363-95544385 GGGAGCTGGCAGGCTCTGATTGG - Intronic
994320447 5:98388439-98388461 TGGGGCTGCTGGGTTCTGTTAGG - Intergenic
994764492 5:103899908-103899930 TTAGGCTTCCAGGTTTTGATGGG - Intergenic
995146183 5:108788638-108788660 TTGGACTGCCAGGTTCTCATGGG + Intronic
997650020 5:135510068-135510090 TGGGGCTGATAGGATCTGATGGG + Intergenic
998057112 5:139087696-139087718 TGAGGCTGACAGGTTATGAGAGG + Intronic
998079012 5:139259357-139259379 AGGGATTTCCAGGTTCTGATGGG + Intronic
998348743 5:141486993-141487015 TGGGGCCTCCAGGAGCTGATAGG - Exonic
998618632 5:143770179-143770201 GGGGGCTGGCAAGTTCTGATTGG + Intergenic
999322047 5:150621522-150621544 TGGGGCTGCCAGGTTATTAGCGG + Intronic
999328869 5:150659650-150659672 TGGGGCTGCCTGGCTCAGACGGG - Intergenic
1001264562 5:170264119-170264141 GGGGGCTGGCAAGTTTTGATTGG - Intronic
1001513309 5:172338424-172338446 TGGTTCTGCCAGGTCCTGAGCGG - Exonic
1001976212 5:176001513-176001535 GGGAGCTGGCAAGTTCTGATTGG - Intronic
1002241210 5:177842258-177842280 GGGAGCTGGCAAGTTCTGATTGG + Intergenic
1003488147 6:6597276-6597298 TGGTGCTGTCAGGTTCTGCCAGG - Intronic
1006296285 6:33171500-33171522 TGGGGCTTCCTGGTCCTGCTGGG - Exonic
1006942777 6:37763816-37763838 TGGGGCTGTCCGCTTTTGATGGG + Intergenic
1007591013 6:43021004-43021026 AGGGCCAGCCAGGTTCTGCTGGG + Exonic
1008958716 6:57244168-57244190 TGGTGCAGCTAAGTTCTGATCGG - Intergenic
1010874173 6:81080764-81080786 AGGGGCTGCCAGGCTATCATAGG - Intergenic
1012281013 6:97328438-97328460 TAGGTCTCCCAGGTTGTGATGGG - Intergenic
1017022318 6:150150489-150150511 AGGGGCTGCCAGGTTGTTTTAGG - Intronic
1022619976 7:31972971-31972993 TTGGGCTGCCCAGTGCTGATGGG - Intronic
1023515456 7:40997071-40997093 TTGGGATGCCAGGTTTTCATGGG - Intergenic
1024683609 7:51720061-51720083 GGTGGTTGCCAGGTTCTGAGGGG - Intergenic
1025020756 7:55477389-55477411 TGGCGCTGCCAGATTGTGCTGGG + Intronic
1025635549 7:63316972-63316994 TGGGGCAGCCAGCTTCAGACAGG - Intergenic
1026226618 7:68447642-68447664 TGGGGCAACCAGGAACTGATTGG - Intergenic
1026427107 7:70306219-70306241 GGGAGCTGCCCGGGTCTGATTGG + Intronic
1035072246 7:156154077-156154099 TGTGGGTGCCAGGTTCCGAGGGG + Intergenic
1037259256 8:16988837-16988859 GGGAGCTGGCAAGTTCTGATTGG - Intergenic
1037666492 8:20974182-20974204 TGGGGCTGTCAGGGACTCATGGG + Intergenic
1040104475 8:43533844-43533866 TGGGGCTGCCAGATACTGGGAGG - Intergenic
1040860614 8:51994982-51995004 AGGAGCTGGCAAGTTCTGATTGG + Intergenic
1041214045 8:55582294-55582316 TAGGGCTGCTTGATTCTGATAGG - Intergenic
1044530272 8:93299682-93299704 TTGGTCTGCCAGGTGCTGATTGG - Intergenic
1045191279 8:99886822-99886844 AGTGGCTGCCAGGGTCTGAGTGG + Intronic
1045898739 8:107248768-107248790 TGGGGCTTCTTTGTTCTGATTGG + Intergenic
1046088665 8:109470734-109470756 TGGGACAGCCAGTTTCTGAGTGG + Intronic
1049030356 8:140031968-140031990 TGGGGGTCCCAGGTTCTGTCTGG - Intronic
1049359370 8:142204681-142204703 GGAGGCTGCCAGGTGCTGAGGGG + Intergenic
1049456987 8:142698118-142698140 GGGAGCTGGCAGGCTCTGATGGG - Intergenic
1056044190 9:82699891-82699913 CGGGCCTTCCAGGTTCTAATTGG - Intergenic
1056257370 9:84813794-84813816 AGGTGCTGCCAGGTTTAGATAGG + Intronic
1057258017 9:93566846-93566868 TCGGGCTCCCAGGGTCTGCTCGG - Intergenic
1057869535 9:98708037-98708059 TGGGGCTGCGAGGTACCGAGTGG - Intronic
1058049182 9:100389370-100389392 AGGAGCTGACAGGTTCTGATTGG - Intergenic
1059070765 9:111133597-111133619 TGAGGCTGCTATGTTCTGCTTGG - Intergenic
1061218294 9:129234745-129234767 TGGCTCTGCCAGGTTCAGAGAGG - Intergenic
1061518419 9:131103061-131103083 AGGGGCTGCCAGCTTCTGATGGG + Intronic
1062018093 9:134301823-134301845 GGGGGATGCCTGGTTATGATCGG + Intergenic
1187651458 X:21413071-21413093 TGGGGCTGCCAGAGGCTGAGGGG - Intronic
1188267832 X:28099401-28099423 TGGGGCAGGCAGTTTGTGATTGG + Intergenic
1192166949 X:68832441-68832463 GGGGGTTGCCAGCTTCTGACAGG - Intronic
1197136505 X:123066405-123066427 TGGGGCTGCCAGAATATGAAGGG + Intergenic