ID: 900191880

View in Genome Browser
Species Human (GRCh38)
Location 1:1355546-1355568
Sequence GCGCCTGCTGGACTTGTACT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 94}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900191880_900191897 28 Left 900191880 1:1355546-1355568 CCGAGTACAAGTCCAGCAGGCGC 0: 1
1: 0
2: 0
3: 9
4: 94
Right 900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 112
900191880_900191895 16 Left 900191880 1:1355546-1355568 CCGAGTACAAGTCCAGCAGGCGC 0: 1
1: 0
2: 0
3: 9
4: 94
Right 900191895 1:1355585-1355607 CGGGGCCGCGCAGGTCCCAGTGG 0: 1
1: 0
2: 0
3: 18
4: 154
900191880_900191886 -3 Left 900191880 1:1355546-1355568 CCGAGTACAAGTCCAGCAGGCGC 0: 1
1: 0
2: 0
3: 9
4: 94
Right 900191886 1:1355566-1355588 CGCCGCGCGGGGCCACCCCCGGG 0: 1
1: 0
2: 0
3: 29
4: 188
900191880_900191889 7 Left 900191880 1:1355546-1355568 CCGAGTACAAGTCCAGCAGGCGC 0: 1
1: 0
2: 0
3: 9
4: 94
Right 900191889 1:1355576-1355598 GGCCACCCCCGGGGCCGCGCAGG 0: 1
1: 0
2: 4
3: 28
4: 287
900191880_900191885 -4 Left 900191880 1:1355546-1355568 CCGAGTACAAGTCCAGCAGGCGC 0: 1
1: 0
2: 0
3: 9
4: 94
Right 900191885 1:1355565-1355587 GCGCCGCGCGGGGCCACCCCCGG 0: 1
1: 0
2: 8
3: 35
4: 181
900191880_900191887 -2 Left 900191880 1:1355546-1355568 CCGAGTACAAGTCCAGCAGGCGC 0: 1
1: 0
2: 0
3: 9
4: 94
Right 900191887 1:1355567-1355589 GCCGCGCGGGGCCACCCCCGGGG 0: 1
1: 0
2: 2
3: 17
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900191880 Original CRISPR GCGCCTGCTGGACTTGTACT CGG (reversed) Exonic
900191880 1:1355546-1355568 GCGCCTGCTGGACTTGTACTCGG - Exonic
906678729 1:47710725-47710747 GGTCCTGCTGGACTTGGACGCGG + Intergenic
906689233 1:47781729-47781751 GCGCCTCCTGGAGTTGTGCAAGG - Intronic
915902166 1:159854987-159855009 GCGCCCGCTGGCCTTGCACCCGG + Exonic
918361528 1:183763954-183763976 GTGCCTGCAGAATTTGTACTGGG + Intronic
923161385 1:231317565-231317587 GCGCCTGCTGGGCTTGACTTGGG + Intergenic
924310633 1:242739154-242739176 GCGGCTGCTGGTCTTTTCCTGGG + Intergenic
1063759455 10:9056797-9056819 GCGCCTGCTGGGCTTGATCTGGG + Intergenic
1066501872 10:36002744-36002766 GCTCCTGCTGGACTTGAAGGAGG + Intergenic
1068840912 10:61612947-61612969 TCACCTGCTGTACTTGAACTAGG + Intergenic
1073808739 10:107129091-107129113 GCTCCAGCAAGACTTGTACTTGG - Intronic
1074107313 10:110398293-110398315 GGCCCTGCTGGACTTATAGTAGG + Intergenic
1077289620 11:1782887-1782909 GCCACTGCTGGACTTGAAGTCGG + Intergenic
1087318853 11:96635912-96635934 GCGCCTGCTGGGCTTGATCGGGG + Intergenic
1089443374 11:118533464-118533486 GTGGCTGCTGGGCTTGCACTGGG + Exonic
1097710822 12:62915185-62915207 GTGCCTTCTGGACTCTTACTTGG + Intronic
1101662278 12:106776151-106776173 GCGCTCGCTGGACTTGGAGTTGG - Intronic
1103007366 12:117432080-117432102 GCGCCTGGGGGATTTTTACTTGG + Intronic
1103038160 12:117673096-117673118 GCTCCTGCTAAACTTGTGCTGGG - Intronic
1105899148 13:24741531-24741553 GCGCCTCGTGGCCTTGGACTGGG + Intergenic
1119024110 14:71139126-71139148 GCCCCTGCTGTCCTTGTCCTAGG - Intergenic
1121342461 14:93113872-93113894 GCGCCTGCGGGGCTTGCACGGGG + Intronic
1122234936 14:100326095-100326117 GGGCCTGCTGGCCTTGCCCTAGG + Intronic
1122244852 14:100395133-100395155 GCGCTTCCTGTACTTGTGCTGGG + Intronic
1128476243 15:67999303-67999325 GCCCATGCTGGCCTTGAACTGGG + Intergenic
1129629811 15:77246304-77246326 GCCCCTGCTGGACTTTTGATAGG + Intronic
1130162363 15:81414144-81414166 GCGCATGCTGGGCTTGATCTGGG + Intergenic
1135338959 16:21630231-21630253 GCGCCTGCTGGGCTTGATCGGGG - Intronic
1143205555 17:5137671-5137693 GCGCCTGTGGGACGTGTATTTGG + Exonic
1143480743 17:7226219-7226241 GCCACTGCCGGACTTGGACTCGG + Exonic
1147837238 17:43342738-43342760 AAGCCTGTTGGACTTGTAATCGG + Intergenic
1148161673 17:45453769-45453791 GTCCCTGCTGTACTTGTACATGG - Exonic
1148850457 17:50552017-50552039 GGGCCTGCTGGACCTGTATGAGG + Exonic
1150392911 17:64800414-64800436 GTCCCTGCTGTACTTGTACATGG - Intergenic
1161554753 19:4934706-4934728 GTGCTTGCTGTACCTGTACTTGG - Intronic
1165996608 19:39848424-39848446 GTGCCTGTTGGTCTTGTGCTGGG + Intergenic
1167587386 19:50382741-50382763 GAGCCTCCTGGACCTGGACTGGG - Exonic
927454896 2:23240948-23240970 GCCCCTTCTGGACTTGTACATGG + Intergenic
930909967 2:56619459-56619481 GAGACTGCTGGCCTTTTACTAGG + Intergenic
936071363 2:109373928-109373950 GAGCCTGCTGGACTGGGTCTCGG - Intronic
937362382 2:121238149-121238171 ACCCCTGCTGGTCTTGAACTTGG + Intronic
938177189 2:129144498-129144520 GCGCCTGCTGGGCTTGATCCGGG - Intergenic
949031754 2:241800402-241800424 TCACCTGCTGAACGTGTACTTGG - Intronic
1169329997 20:4708916-4708938 GTGCCTCCTGGACTTGTGCAGGG + Intergenic
1172951893 20:38727601-38727623 GCGCGTGCGGGACTCGTACGTGG + Exonic
1179196589 21:39169698-39169720 GAGGCTTCTGGACTTGCACTGGG + Intergenic
1183811521 22:40261699-40261721 GCCCATGCTGGTCTTGAACTCGG - Intronic
1184610827 22:45602127-45602149 GCTCCAGCAGGCCTTGTACTTGG - Intergenic
1184913082 22:47549104-47549126 GGGCCTGCTGGGCTTGCAGTGGG + Intergenic
949133607 3:536028-536050 GCGCCTGCTGGGCTTGATCGGGG - Intergenic
950182069 3:10920662-10920684 GTGCCTGCTGGAGTTGTGCAGGG - Intronic
950952761 3:17018182-17018204 GCACCTGCTGAACTTGTGCCTGG + Intronic
950966671 3:17151581-17151603 GGGCCTGCTGGAGTCGAACTGGG - Intergenic
958677948 3:97291898-97291920 GTGCCTGCTGGACTTGTGCCTGG + Intronic
964516007 3:157508397-157508419 GCCCCTGCTGCTCCTGTACTAGG - Intronic
969224158 4:5783746-5783768 GCACCTGCTGGTCTTGCTCTAGG - Exonic
969496795 4:7530873-7530895 GCATCTGCTGGACTCGTGCTGGG - Intronic
972784631 4:42315315-42315337 GCGCCTGCTGGGCTTGATCTGGG - Intergenic
972790855 4:42369746-42369768 GCGCCTGCTGGGCTTGATCAGGG + Intergenic
974540307 4:63225460-63225482 GCAGCAGCTGGAGTTGTACTTGG - Intergenic
975378227 4:73669828-73669850 AAGCCTGTTGGACTTGTAATCGG + Intergenic
980809238 4:137853711-137853733 ACGCCTGCTGGACTTGATCAGGG + Intergenic
982722502 4:158873420-158873442 GCCCAGGCTGGACTTGAACTGGG + Intronic
982773693 4:159421006-159421028 GCACCTGCTGGACTTGATCGGGG + Intergenic
983660651 4:170127856-170127878 GCGCCTGCTGGGCTTGATCTGGG - Intergenic
983957811 4:173717717-173717739 GCGCCTGCTGGACTTGATGGGGG - Intergenic
984095496 4:175428056-175428078 GCGCCTGCTGGGCTTGATCGGGG + Intergenic
984233177 4:177124496-177124518 GCTCCTGCTCTGCTTGTACTGGG - Intergenic
985224309 4:187743909-187743931 GGGCCTGCTAGACTTTCACTTGG + Intergenic
985702198 5:1380418-1380440 ACGCCTGCTGGGCTTGATCTGGG - Intergenic
992859110 5:80893618-80893640 GTGCCTGCTGAAATTGTCCTAGG + Intergenic
993794581 5:92250154-92250176 GCCCTTGCTGCACTTGGACTGGG + Intergenic
994411345 5:99410535-99410557 GCGCCTGCTGGACTTGATCAGGG - Intergenic
994482484 5:100354712-100354734 GCGCCTGCGGGACTTGATCAGGG + Intergenic
1002132552 5:177090518-177090540 GCACCTGCTGGCCGTGTACGGGG + Exonic
1003790760 6:9544741-9544763 CAGCCTGCTGCTCTTGTACTTGG - Intergenic
1004811817 6:19270882-19270904 GCGCCTGCTGGGCTTGATCAGGG + Intergenic
1009690925 6:67031159-67031181 GCACCTGCTGGGCTTGATCTGGG + Intergenic
1009902728 6:69828651-69828673 GCCCAGGCTGGACTTGAACTGGG + Intergenic
1015446886 6:133316629-133316651 GGCCCTGCTGTACTTGTACATGG + Intronic
1016182815 6:141168230-141168252 GCGCCTGCTGGGCTTGATCAGGG + Intergenic
1017017786 6:150115885-150115907 GCGCCTGCTGGGCTTGATCCGGG - Intergenic
1018123456 6:160659330-160659352 GCCCTTGCTGTACTTGGACTAGG - Intronic
1021006168 7:15397259-15397281 GCGCCTGCTGGGCTTGATCAGGG - Intronic
1021576328 7:22109127-22109149 GCGCCAGCTGCACTTGGTCTAGG - Intergenic
1023775218 7:43599333-43599355 ACACCTGCTGCACTTGTATTTGG + Intronic
1026569749 7:71519098-71519120 GAGCCAGCTGGACTTGTACCTGG - Intronic
1032611874 7:133423851-133423873 GCGCCTGCTGGACTTGATAGGGG + Intronic
1033951295 7:146788137-146788159 GCGCCTGCTGGGCTTGTTTGGGG - Intronic
1037109561 8:15149419-15149441 GCCACTGCTGAACTGGTACTAGG - Intronic
1043002085 8:74771848-74771870 GCGCCTGCTGGGCTTGATCCGGG - Intronic
1043074136 8:75674376-75674398 GAGGCTTCTGGACTTGAACTGGG + Intergenic
1044456014 8:92393814-92393836 GCGCCTGCTAGACTTGATCGAGG - Intergenic
1046055210 8:109071052-109071074 GCGCCTGCTGGGCTTGATCGGGG - Intergenic
1047310831 8:123690429-123690451 GCGCCTCCTGGAGTTGTGCAAGG - Intronic
1047362500 8:124182091-124182113 GCTCCTGCTGGACTAGGACTAGG + Intergenic
1048703035 8:137115857-137115879 GCGCCTGCTGGGCTTGATCAGGG - Intergenic
1049742908 8:144249585-144249607 GCTGCTGCTGGACTTGTGGTGGG + Intronic
1049827181 8:144676695-144676717 GCGCCTGCTGGGCTTGATCTGGG - Intergenic
1055373352 9:75624142-75624164 GCCCCTGCTGCCCTTGGACTGGG - Intergenic
1055462076 9:76528787-76528809 GCGCCTGCTGGGCTTGATCCAGG - Intergenic
1056100960 9:83300355-83300377 GCGCCTGCTGGCCCTCTGCTGGG - Intronic
1057689515 9:97271331-97271353 GCGCCTGCTGGGCTTGATCGGGG - Intergenic
1187736207 X:22306382-22306404 GTGGCAGCTGGACTTCTACTGGG - Intergenic