ID: 900191884

View in Genome Browser
Species Human (GRCh38)
Location 1:1355558-1355580
Sequence TGGCCCCGCGCGGCGCCTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 316}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900191884_900191889 -5 Left 900191884 1:1355558-1355580 CCAGCAGGCGCCGCGCGGGGCCA 0: 1
1: 0
2: 0
3: 24
4: 316
Right 900191889 1:1355576-1355598 GGCCACCCCCGGGGCCGCGCAGG 0: 1
1: 0
2: 4
3: 28
4: 287
900191884_900191897 16 Left 900191884 1:1355558-1355580 CCAGCAGGCGCCGCGCGGGGCCA 0: 1
1: 0
2: 0
3: 24
4: 316
Right 900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 112
900191884_900191895 4 Left 900191884 1:1355558-1355580 CCAGCAGGCGCCGCGCGGGGCCA 0: 1
1: 0
2: 0
3: 24
4: 316
Right 900191895 1:1355585-1355607 CGGGGCCGCGCAGGTCCCAGTGG 0: 1
1: 0
2: 0
3: 18
4: 154
900191884_900191899 19 Left 900191884 1:1355558-1355580 CCAGCAGGCGCCGCGCGGGGCCA 0: 1
1: 0
2: 0
3: 24
4: 316
Right 900191899 1:1355600-1355622 CCCAGTGGAGCACGCGCTGGCGG 0: 1
1: 0
2: 0
3: 14
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900191884 Original CRISPR TGGCCCCGCGCGGCGCCTGC TGG (reversed) Exonic
900122332 1:1054179-1054201 CGGCCCTGCCCGGAGCCTGCCGG + Intronic
900191884 1:1355558-1355580 TGGCCCCGCGCGGCGCCTGCTGG - Exonic
900497880 1:2984568-2984590 AGGCCCTGCGCTTCGCCTGCTGG + Intergenic
901057468 1:6455364-6455386 CTGCCCCGCGTGGCGGCTGCCGG + Intronic
901601507 1:10426698-10426720 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
902256388 1:15191505-15191527 TGGCCCCCAGAGGCCCCTGCTGG + Intronic
902782825 1:18715823-18715845 TGGCCCCTGGTGGCACCTGCTGG - Intronic
902920707 1:19664901-19664923 GGGCCCCTCGCGGCGCCTCCCGG + Intergenic
905259218 1:36705821-36705843 TGGACCCGGGTGCCGCCTGCTGG - Intergenic
905414137 1:37793533-37793555 AGGCCCCGGACGGCGTCTGCAGG + Intergenic
906087375 1:43147761-43147783 TCGCCCCGCCCCGCGCCCGCCGG - Intronic
907397288 1:54200178-54200200 TTGCCGCGCGCAGGGCCTGCTGG - Exonic
912166119 1:107044777-107044799 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
912819405 1:112854852-112854874 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
914702967 1:150150423-150150445 CGGCCCCGCCAGGCGCCCGCGGG + Intronic
915104096 1:153521808-153521830 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
918708912 1:187703642-187703664 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
918720803 1:187850223-187850245 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
918732329 1:188013639-188013661 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
919101806 1:193105354-193105376 TGGCGCCGCGCGGCGCTGGCGGG - Intronic
919237008 1:194859088-194859110 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
921096260 1:211889570-211889592 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
922315059 1:224434626-224434648 GGGCGCCGCGGGGCGGCTGCGGG + Intronic
922485394 1:225969791-225969813 GGGCTACGCGCGGCGCTTGCGGG + Intergenic
922766245 1:228158096-228158118 TGGCCCCGGGCGGCGGCGGAGGG - Exonic
924117489 1:240762512-240762534 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
1063452992 10:6163828-6163850 TGGGGCCGCGCGGCGCACGCCGG - Intronic
1064552968 10:16521113-16521135 TCGCCCCGCGCTGAGCCGGCTGG - Exonic
1065099848 10:22321737-22321759 GAGCCCCGCGCGGCCCCCGCCGG - Intronic
1065186314 10:23173749-23173771 CGGCCCCGCGCGCCCCCTCCCGG - Intergenic
1067363159 10:45600765-45600787 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
1068978105 10:63033610-63033632 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
1069992939 10:72325977-72325999 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
1072591428 10:96832096-96832118 CCGCCCCGCGCGCCGCCCGCCGG - Intergenic
1074722236 10:116272994-116273016 TGGCGCCGGGCTGCACCTGCCGG - Intronic
1074815083 10:117137004-117137026 TCGCCCCGCCCGGGTCCTGCGGG + Intronic
1075255588 10:120923846-120923868 AGGCTGCGCGCGGCGCTTGCGGG + Intergenic
1075430255 10:122374601-122374623 GGGACCCGCGCGGGGCCTGCCGG + Intergenic
1076417364 10:130301154-130301176 TGGCCCCGGGGACCGCCTGCCGG + Intergenic
1076417522 10:130301735-130301757 TGGCCCCGGGGACCGCCTGCCGG + Intergenic
1076722107 10:132397228-132397250 TGGAGCCGCGCGCCGGCTGCCGG + Exonic
1077185865 11:1235072-1235094 TGGCCCCTTGCAGCACCTGCAGG + Exonic
1079555446 11:21753437-21753459 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
1084186621 11:67476114-67476136 GGGCCGCGCGCGGTGCTTGCGGG + Intergenic
1085350978 11:75797737-75797759 TGGCCCAGGGCTGAGCCTGCAGG - Intronic
1086807982 11:91268778-91268800 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
1089466436 11:118689312-118689334 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
1090776755 11:129972159-129972181 GGGCTGCGCGCGGCGCTTGCGGG - Intronic
1091402274 12:188413-188435 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
1092336642 12:7639862-7639884 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
1092350554 12:7752412-7752434 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
1092572453 12:9739915-9739937 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
1093189366 12:16057404-16057426 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
1094338643 12:29386579-29386601 AGGCTGCGCGCGGCGCTTGCGGG - Intergenic
1094832363 12:34306206-34306228 TGTCCCCGCGCAGGGGCTGCTGG - Intergenic
1094832457 12:34306625-34306647 GGGCCCCGCGCAGGGGCTGCTGG - Intergenic
1102025838 12:109714013-109714035 TGGCCCCGGGCGGCGCGCGGGGG - Intergenic
1105323413 13:19348045-19348067 TGGCCCCGTGCTGGCCCTGCTGG + Intergenic
1105425609 13:20292437-20292459 AGGCTGCGCGCGGCGCTTGCCGG + Intergenic
1105745746 13:23375583-23375605 TCCCCGCGGGCGGCGCCTGCAGG - Intronic
1105873975 13:24537792-24537814 TGGCCCCGTGCTGGCCCTGCTGG - Intergenic
1106568396 13:30906273-30906295 TTTCTCCGCGCGGTGCCTGCAGG + Exonic
1107590498 13:41898918-41898940 GGGCTGCGCGCGGCGCTTGCGGG - Intronic
1108435307 13:50396616-50396638 GGGCTGCGCGCGGCGCTTGCGGG + Intronic
1109858797 13:68171001-68171023 CGGCTGCGCGCGGCGCTTGCGGG + Intergenic
1110874400 13:80490900-80490922 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
1111006611 13:82257981-82258003 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
1111138813 13:84086715-84086737 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
1111556203 13:89884165-89884187 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
1113546227 13:111153471-111153493 TGGCCGCGCGCGGGGCCAACCGG + Intronic
1113951657 13:114075126-114075148 TGGCCCTGAGTGGCGCCAGCAGG - Intronic
1114554838 14:23556047-23556069 TGGCCCCGCACGGCTCCCGGGGG - Exonic
1114659566 14:24335638-24335660 TGGCCCCGCACGGTGCCCCCAGG - Intronic
1116114529 14:40629977-40629999 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
1116849447 14:49893428-49893450 GGCGCTCGCGCGGCGCCTGCGGG + Exonic
1119038807 14:71254317-71254339 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
1119325834 14:73759286-73759308 TAGCCCCTCGCCGCGCCTTCCGG + Intronic
1120190462 14:81435884-81435906 TGGCGCCGCGCCCCGCCTTCGGG - Intronic
1120330950 14:83092406-83092428 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
1121595192 14:95157110-95157132 TGGCCCCGAGCCGCGCGTCCGGG - Intronic
1122115707 14:99526308-99526330 AGGCCCCGTGCAGCTCCTGCAGG + Intronic
1122905622 14:104800381-104800403 GGGCCCCGCGCGCAGCCAGCAGG - Intergenic
1123134122 14:106011815-106011837 GGGCCCCGCGCGCCCCCTGCTGG + Intergenic
1123168508 14:106349176-106349198 GGGCCCCGCGCGCCCCCTGCTGG + Intergenic
1123171085 14:106373554-106373576 GGGCGCCGCGCGCCACCTGCTGG + Intergenic
1123194767 14:106606009-106606031 TGGCCTCGCGCGCCCCCTGTTGG + Intergenic
1123197051 14:106627142-106627164 GGGCCCCGCGCGCCCCCTGCTGG + Intergenic
1123198393 14:106639012-106639034 GGGCCCCGCGCGCCACCTGCTGG + Intergenic
1123222825 14:106872723-106872745 GGGCCCCGCGCGCCCCCTGCTGG + Intergenic
1124114892 15:26831518-26831540 GGGCTGCGCGCGGCGCTTGCGGG - Intronic
1124244744 15:28059207-28059229 TTGCCCTGCGTGGCTCCTGCAGG - Intronic
1125885574 15:43226887-43226909 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
1129854037 15:78811539-78811561 TGGCCCCGCCCCGCCCCGGCCGG + Intronic
1130564618 15:84982411-84982433 GGACCCCGCCCGGCCCCTGCGGG - Intronic
1131250228 15:90825531-90825553 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
1131829637 15:96345832-96345854 TGGCCACGCGGGCCGGCTGCAGG - Intergenic
1132365279 15:101252154-101252176 GGCCCCCGCCCGGCGCCCGCGGG + Intergenic
1132500953 16:284490-284512 TGGGCCCGCGCAGCGCGAGCTGG + Exonic
1132669107 16:1095438-1095460 TGGCCTCCCGAGGCCCCTGCAGG - Intronic
1133346107 16:5071702-5071724 TGGCCCCGAGGGGCTCCTGGGGG + Intronic
1134243362 16:12522051-12522073 TGGCCCCGAGGGGCCCCTGCTGG + Intronic
1135262157 16:20989979-20990001 GGGCTGCGCGCGGCGCTTGCAGG - Intronic
1136163265 16:28435391-28435413 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
1136199701 16:28679596-28679618 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
1136216048 16:28793769-28793791 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
1136349366 16:29696989-29697011 TGGCCGCCCGCACCGCCTGCTGG - Exonic
1138247671 16:55479445-55479467 TGGCCCCGCGCGTCGCCCGGGGG - Exonic
1139018989 16:62724889-62724911 GGGCTGCGCGCGGCGCTTGCTGG + Intergenic
1139937169 16:70579824-70579846 TGGCCCTGCCCCGCCCCTGCTGG + Intergenic
1141828887 16:86498604-86498626 AGGCCCCGCGCGTCTCCCGCCGG - Intergenic
1142228569 16:88888915-88888937 GGGCCGCGGGCGGCACCTGCTGG + Intronic
1142293084 16:89201601-89201623 TGGCCGGGCCCGGCGCCTGCTGG - Exonic
1142848189 17:2692101-2692123 TCGCCCCGCGCCGCGCCTCCCGG - Intronic
1143283330 17:5771266-5771288 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
1143446837 17:7014836-7014858 TGGCCCCGCGCGCCTCCTCACGG - Exonic
1143664309 17:8347458-8347480 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
1144512205 17:15886881-15886903 TGGCCCTGCACAGCGCCTGAAGG - Intergenic
1146255866 17:31391454-31391476 TGGCAGCTCGCTGCGCCTGCCGG + Intergenic
1147373590 17:40010955-40010977 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
1147614674 17:41820965-41820987 TGGCCCCGAGAGTCGCCTCCTGG - Exonic
1147705268 17:42421717-42421739 TGGCCCCGGGCGGAGCCGGGGGG + Intronic
1147811245 17:43171272-43171294 CGCCCCCGGGGGGCGCCTGCCGG - Intronic
1148593027 17:48830932-48830954 CGCCCCCGCGCGGCGCTTGCTGG - Intergenic
1150764721 17:67993871-67993893 CGGCCGCGCGCGGCCGCTGCGGG + Intergenic
1151782710 17:76257987-76258009 GGGCTGCGCGCGGCGCTTGCAGG - Intergenic
1151933386 17:77247145-77247167 CCGCCCCGGGCGCCGCCTGCGGG + Intergenic
1152382697 17:79950366-79950388 TGGCCCCGCGGAGAGCCGGCCGG - Intronic
1152586397 17:81191368-81191390 TGGCCCCGCGGGCCGGCTCCGGG - Intronic
1152748328 17:82051399-82051421 CCGCCCCGCGCGGAGCCTCCGGG + Intronic
1152861435 17:82698664-82698686 GGGGCCCGCGCGGCGCCTCTCGG - Exonic
1153015640 18:580326-580348 TGGTCCCGCGCCGCGCCGGCGGG + Intergenic
1153765145 18:8367559-8367581 CGCCCCCGCGCGTCGGCTGCAGG - Intronic
1153934958 18:9913579-9913601 CGGCCCTGCGCGGTGCTTGCTGG - Intergenic
1155152794 18:23135877-23135899 TGGGCCGGCGCGGCGGCCGCGGG - Exonic
1157867145 18:51197082-51197104 TGGCCCTGCGCCGCCGCTGCCGG + Exonic
1159167985 18:64725968-64725990 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
1159578273 18:70206003-70206025 GGGCCCGCCGCGGCGCCCGCTGG + Intergenic
1159911148 18:74147719-74147741 TGGGCCCGCGCAGCGTCTGGAGG + Exonic
1160131459 18:76228928-76228950 TGACCCCGCGTGGCTCCTGAGGG + Intergenic
1160682806 19:419544-419566 AGGCCCCTCCCGGCGCCCGCTGG - Intronic
1160810789 19:1012173-1012195 TGGTCCCGCGTGGGGTCTGCGGG + Exonic
1160862909 19:1245211-1245233 TGGCCCCGCCCTGTGCCAGCCGG + Intergenic
1161013081 19:1969456-1969478 TGGCCCCGCGGGGGCCTTGCCGG + Intronic
1161028729 19:2048371-2048393 TGGCCCAGCGCAGGGACTGCCGG + Intronic
1161233202 19:3185910-3185932 CTGCCCCGCGCGGCGCCCGCAGG + Exonic
1161479708 19:4504427-4504449 CGACCCCGCGCCGGGCCTGCAGG + Exonic
1162230110 19:9259536-9259558 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
1162233149 19:9283793-9283815 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
1162412387 19:10514330-10514352 CGCCAACGCGCGGCGCCTGCCGG - Exonic
1162632734 19:11941633-11941655 GGGCTGCGCGCGGCGCTTGCGGG - Intronic
1163013495 19:14440179-14440201 TGGCCCCGCGCGAGGGGTGCTGG + Intronic
1163480931 19:17555857-17555879 TGAGCACGCGCGGCGCCTGCAGG - Exonic
1163532627 19:17859609-17859631 CGGCGGCGCGCGCCGCCTGCAGG - Intergenic
1165080260 19:33302617-33302639 TGCGGCGGCGCGGCGCCTGCTGG + Intergenic
1165395189 19:35560058-35560080 AGGCCCTGCACGGTGCCTGCAGG + Exonic
1165469264 19:35994101-35994123 TGTCCCCGCGGGCCGCCTGGAGG - Intergenic
1165742273 19:38211327-38211349 GGCCCCCGCCCAGCGCCTGCTGG - Intronic
1166036257 19:40170479-40170501 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
1166215375 19:41331210-41331232 TGACCCCGCCCGCCGCCCGCAGG - Exonic
1167250987 19:48398383-48398405 CGGCGCCGCGCATCGCCTGCGGG - Exonic
1167433930 19:49468395-49468417 AGGCCCTGTGCTGCGCCTGCGGG + Exonic
1168689648 19:58368917-58368939 TGGCATCGCGGGGCGCCCGCTGG - Exonic
925362889 2:3291950-3291972 TGGCCCAGCGGGGCCCCTGACGG - Intronic
927125961 2:20012598-20012620 GGCCCCCGCGCGCCGCCTCCCGG - Exonic
927640534 2:24842720-24842742 TGACCCCGCAGGGCTCCTGCCGG - Intronic
927653459 2:24926671-24926693 AGGCAGCGCGCGGTGCCTGCAGG - Intergenic
927692239 2:25216249-25216271 AGGCCCAGCGCGCCGCCAGCCGG + Intergenic
927942219 2:27111805-27111827 GGGCTGCGCGCGGCGCTTGCCGG - Intronic
928936861 2:36688283-36688305 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
928987636 2:37196729-37196751 TGCCCGCGCGTGTCGCCTGCAGG + Intronic
929174075 2:38959756-38959778 CGGCCCCGAGGGGCGCCGGCAGG + Intronic
935896890 2:107747677-107747699 GGGCTGCGCGCGGCGCTTGCTGG - Intergenic
936412874 2:112275905-112275927 AGACCCCCCGCGCCGCCTGCGGG - Exonic
936572300 2:113627146-113627168 CTGCCCAGCGCGGCGCCTGGCGG - Intergenic
940112678 2:150171365-150171387 TGGCTGCACGCGGCGCTTGCGGG - Intergenic
940666742 2:156618396-156618418 CGGCTGCGCGCGGCGCTTGCGGG - Intergenic
941240048 2:163026297-163026319 GGGCTGCGCGCGGCGCTTGCAGG + Intergenic
942965779 2:181891672-181891694 GCGCCCCGCGCGGCCCCGGCCGG + Intergenic
943680385 2:190761302-190761324 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
946023204 2:216656070-216656092 TGGCCCTGCCTGGCGCCTTCAGG + Intronic
946982204 2:225229787-225229809 GGGCTGCGCGCGGCGCTTGCAGG - Intergenic
947026593 2:225744151-225744173 GGGCTGCGCGCGGCGCTTGCTGG + Intergenic
947605708 2:231483922-231483944 TGGCTCCTCGGGGCGTCTGCAGG + Intergenic
948569255 2:238907150-238907172 GGGCCCCGCGCCGCGCCTCAGGG - Intronic
948873450 2:240815393-240815415 TGGCCCCGGACTGCTCCTGCAGG - Intronic
1170246434 20:14226530-14226552 GGGCTGCGCGCGGCGCTTGCGGG + Intronic
1170889892 20:20368163-20368185 TGCCCGGGCGCGGCGGCTGCGGG - Exonic
1171782359 20:29430724-29430746 CGGCCCCGCGCAGCCCCTCCGGG + Intergenic
1173601562 20:44299155-44299177 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
1173831477 20:46091873-46091895 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
1175210031 20:57348418-57348440 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
1175902956 20:62367173-62367195 GGGCCCCGCGCCGCTGCTGCTGG - Exonic
1176008904 20:62881254-62881276 TGGCCAGGCGCCTCGCCTGCCGG + Exonic
1176086012 20:63295879-63295901 TGGGCCAACGCGGCGCCTCCCGG + Intronic
1176144743 20:63560538-63560560 GGGCCACGAGCGGAGCCTGCTGG - Exonic
1176173694 20:63707931-63707953 TAACCCCGCGCGGCGCCTGACGG + Exonic
1176217586 20:63955675-63955697 GGGCCCTGCGCGGCGCCTTTGGG - Intronic
1177715997 21:24840421-24840443 TGGCTGCGCGAGGCGCTTGCAGG - Intergenic
1178983386 21:37283524-37283546 GGGCTGCGTGCGGCGCCTGCGGG - Intergenic
1179912094 21:44455809-44455831 GGGCCGCGCGCGGAGCCGGCCGG - Intronic
1180096033 21:45555574-45555596 TGGCCCCGCGCGGGGGCTAAGGG + Intergenic
1180235733 21:46458560-46458582 TGGCCCCGCGCGCGGCCCTCCGG - Intergenic
1181595876 22:23914054-23914076 CGCCCCCGCGCGGAGCATGCTGG - Intergenic
1182338054 22:29598360-29598382 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
1182511302 22:30822345-30822367 TCGTCCCGCGCGTCGCCTGCTGG - Intronic
1183535486 22:38398461-38398483 TTTCCTCGCGCGGCGGCTGCCGG + Intronic
1183586346 22:38755451-38755473 CGGCCCCGGGCAGCGCCTACGGG - Intronic
1183932061 22:41240905-41240927 TGTCCCTGCGCTGCGCCTCCAGG - Exonic
1184975591 22:48059161-48059183 TGGCCCCGGGCGGAGTCAGCTGG + Intergenic
1185038021 22:48489768-48489790 GAGGCCCGCGGGGCGCCTGCCGG - Intronic
1185087744 22:48749784-48749806 TGGCCCTGGGCAGCGTCTGCAGG + Intronic
1185153926 22:49182082-49182104 TGGGCCCGTGCGCCGGCTGCTGG - Intergenic
1185259512 22:49853811-49853833 GGGCCCCGCGCGGCGCGGGGCGG - Intergenic
1185418334 22:50721620-50721642 TGGCCTGGCCCGGCGTCTGCCGG - Intergenic
1185427888 22:50783734-50783756 CTGCCCAGCGCGGCGCCTGGCGG + Intergenic
952058125 3:29473840-29473862 GGGCTGCGCGCGGCGCTTGCGGG - Intronic
954256598 3:49411781-49411803 TGGGGCCCCGCGGCGCCTGGAGG + Intronic
957386420 3:79502279-79502301 GGGCTGCGCGCGGCGCTTGCGGG + Intronic
957630915 3:82715352-82715374 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
957804941 3:85134199-85134221 GGGCTGCGCGCGGCGCTTGCGGG - Intronic
960959826 3:123062433-123062455 TGGCCCCGCGGGGCTGCTGCTGG + Intergenic
963440376 3:145333416-145333438 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
963862132 3:150322990-150323012 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
963904629 3:150763259-150763281 TGGCTCCGCCCGGCTCCAGCTGG + Exonic
964032289 3:152152438-152152460 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
965040260 3:163499046-163499068 AGGCTGCGCGCTGCGCCTGCGGG + Intergenic
965200378 3:165649655-165649677 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
966191052 3:177272065-177272087 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
966548988 3:181183325-181183347 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
966725469 3:183104084-183104106 GGGCTGCGCGCGGCGCTTGCGGG - Intronic
967499187 3:190177387-190177409 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
967527673 3:190513885-190513907 GGGCCCGGCGCCGCGCCTCCTGG + Intergenic
968479397 4:826654-826676 CGGCCCCGCGCGGACCCTGTAGG - Intergenic
968764847 4:2462896-2462918 CGGGCCCGCGCGCCGCCTGGAGG + Exonic
970108291 4:12609656-12609678 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
970673201 4:18418676-18418698 TGGCTGCGCGCGGCGCTTGCGGG - Intergenic
970803492 4:20004034-20004056 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
971564223 4:28117479-28117501 GGGCTGCGCGCGGCGCTTGCTGG - Intergenic
971639792 4:29117375-29117397 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
971812025 4:31439069-31439091 TGGACCCGCACGGGGGCTGCAGG - Intergenic
974590626 4:63943212-63943234 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
976184233 4:82429519-82429541 GGGCCCGGCGCGCCCCCTGCCGG + Exonic
976184400 4:82430209-82430231 GGGCCCCGCGCGGCCTCTGGCGG + Exonic
976520661 4:86021946-86021968 GGGCCGCGTGCGGCGCTTGCGGG - Intronic
979278197 4:118836202-118836224 TGGCCCCGCCCCGCGGCGGCCGG - Intronic
980799731 4:137733759-137733781 GGGCTGCGCGCGGCGCTTGCCGG + Intergenic
982380657 4:154744262-154744284 TTGCCCAGCCCGGCCCCTGCCGG + Intronic
982921233 4:161277265-161277287 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
983026064 4:162739563-162739585 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
983060306 4:163152868-163152890 GGGCTGCGCGCGGCGCTTGCGGG + Intronic
983752811 4:171298297-171298319 CGGCTGCGCGCGGCGCTTGCGGG + Intergenic
985203218 4:187505653-187505675 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
985629741 5:1008395-1008417 TGGCCCCCCCCGGCCCCGGCTGG - Intergenic
985696728 5:1345057-1345079 CGGCCCCGCGCGCCGCTTCCGGG + Exonic
987146284 5:14994143-14994165 GGGCTGCGCGCGGCGCTTGCAGG - Intergenic
987532819 5:19143108-19143130 GGGCTGCGCGCGGCGCTTGCCGG - Intergenic
988073455 5:26324444-26324466 GGGCCGCGCGCGGCGCTTGCGGG + Intergenic
988369209 5:30345751-30345773 TGGCTGCGCGCGGTGCTTGCCGG + Intergenic
991567603 5:68020741-68020763 GGACCGCGCGCGGCGCTTGCGGG - Intergenic
994935258 5:106246276-106246298 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
996435659 5:123430570-123430592 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
997568143 5:134905100-134905122 CTGCCCCGCGCGCTGCCTGCCGG - Exonic
998167311 5:139851662-139851684 TGGCCCTGCGCCGCTCCTCCAGG + Exonic
999188436 5:149730157-149730179 CGGGGCCGCGCGGCGCCCGCGGG - Intergenic
999406147 5:151309210-151309232 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
1000305112 5:159987535-159987557 TGGACCCGCGCGCCACCCGCTGG + Intergenic
1002055784 5:176597287-176597309 TGGGCGCGCGCGGCGCCGCCTGG + Exonic
1002789409 6:426538-426560 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
1002793178 6:450009-450031 GGGCTACGCGCGGCGCTTGCAGG + Intergenic
1003489250 6:6606763-6606785 GGGCTGCGCGCGGCGCTTGCGGG - Intronic
1003490056 6:6613585-6613607 GGGCGGCGCGCGGCGCTTGCGGG - Intronic
1003506704 6:6746011-6746033 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
1003770190 6:9290773-9290795 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
1003836242 6:10075015-10075037 GGGCTGCGCGCGGCGCTTGCGGG - Intronic
1004233737 6:13855054-13855076 GGGCCGCGCGCAGCGCTTGCGGG - Intergenic
1004235571 6:13872259-13872281 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
1004647916 6:17580769-17580791 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
1004690397 6:17987862-17987884 CGGCCACGCGCGGCGCCCCCTGG + Intergenic
1004694364 6:18020050-18020072 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
1004883676 6:20032369-20032391 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
1005749094 6:28866778-28866800 AGGCTGCGCGCGGCGCTTGCGGG - Intergenic
1005992845 6:30914239-30914261 TGGAGCCGCGCGGCGCATGGGGG - Intronic
1006434154 6:34017492-34017514 TGGCTCCGCGCGGCGCTCGCGGG - Intergenic
1007363255 6:41373308-41373330 AGGCCCAGCGCGCCGACTGCGGG - Intergenic
1012733564 6:102910977-102910999 GGGCTGCGCGCGGCGCTTGCTGG - Intergenic
1014055855 6:117014784-117014806 GGGCTACGCGCGGCGCTTGCGGG + Intergenic
1014507731 6:122280604-122280626 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
1015994890 6:138987751-138987773 GGGCCACGCGCAGCCCCTGCCGG - Exonic
1016678771 6:146803840-146803862 CGGCCGCGCGCGCGGCCTGCCGG + Intronic
1017325054 6:153133645-153133667 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
1017581255 6:155867092-155867114 GGGCCGTGCGCGGCGCTTGCGGG - Intergenic
1019361385 7:605916-605938 TGCCCCCGGGCTGCGACTGCTGG - Intronic
1021998332 7:26201613-26201635 GGGCCGCGCGCCGCGCCCGCTGG - Intronic
1022103869 7:27184844-27184866 CGGCCGCGCTGGGCGCCTGCAGG + Exonic
1026596592 7:71738416-71738438 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
1029360993 7:100088765-100088787 TGTCCCCGCCTGTCGCCTGCGGG - Intergenic
1029407060 7:100381751-100381773 GGGCTGCGCGCGGCGCTTGCGGG + Intronic
1030780380 7:113593343-113593365 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
1030819347 7:114077179-114077201 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
1030819826 7:114082978-114083000 TGACCCTGCGCGGCGACTACAGG + Intergenic
1031378764 7:121059993-121060015 GGGCTGCGCGCGGCGCTTGCGGG + Intronic
1033899441 7:146116884-146116906 CGGCTCCGCGCGCCGGCTGCGGG + Exonic
1034988599 7:155533503-155533525 TGGCCCCGCTCTGCGCGGGCCGG - Intronic
1035717252 8:1763831-1763853 TGGCGCCGCCCCGCCCCTGCAGG - Exonic
1036441068 8:8781729-8781751 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
1036801339 8:11794828-11794850 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
1038542437 8:28401292-28401314 GGGCCCCGAGCGGCGCGTCCGGG - Intronic
1040106785 8:43546147-43546169 GGGCCCGGCGCAGGGCCTGCCGG + Intergenic
1042236012 8:66613527-66613549 GCGCACCGCGCGGGGCCTGCTGG + Intronic
1042546221 8:69953967-69953989 GGGCCCCGCGGGGGTCCTGCTGG - Intergenic
1043073382 8:75665802-75665824 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
1043515736 8:80993203-80993225 GGGGCCCGCGGGGAGCCTGCTGG - Exonic
1043581575 8:81721329-81721351 TGAGCGCGCGCGGCGCCTGACGG + Intronic
1044788649 8:95823661-95823683 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
1047124705 8:121948059-121948081 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
1047631740 8:126714974-126714996 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
1048676995 8:136794127-136794149 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
1050249926 9:3733835-3733857 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
1050387937 9:5110786-5110808 GGGCCACGCGCGACGCCTGGGGG + Intronic
1053471180 9:38347009-38347031 AGGCCCAGCGCGGGGCCTTCTGG - Intergenic
1056577389 9:87866937-87866959 TGGACCTGGGCGGAGCCTGCTGG - Intergenic
1056992050 9:91421655-91421677 TGGCGCCACGCGGCCCCTACAGG + Intronic
1057550559 9:96048767-96048789 TGGCCCCGCACGGGGACAGCAGG - Intergenic
1059891476 9:118809553-118809575 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
1060526999 9:124326450-124326472 TGGCTCCGGGCGGCTCCTGGCGG - Intronic
1060594265 9:124839059-124839081 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
1060952397 9:127612490-127612512 GAGCCCCGCGCGGCCCCTGCCGG + Intronic
1061765399 9:132878343-132878365 GGGCCCGGCGCGGAGCCTGCAGG - Exonic
1062235044 9:135503791-135503813 TGGCCCCACGGTCCGCCTGCCGG + Exonic
1062269499 9:135702091-135702113 TGTCCGCGCGCGCCCCCTGCCGG - Intergenic
1062457197 9:136645370-136645392 TGGGCCCGGTCGGCGACTGCAGG + Intergenic
1062467403 9:136687357-136687379 TGGCCCGGCCCGGCGCCCGACGG + Exonic
1194890515 X:99372374-99372396 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
1196319570 X:114270898-114270920 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
1197533806 X:127663308-127663330 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic
1199736933 X:150693719-150693741 TGGCCTCGCGCGGGGCCCTCGGG - Intronic
1200066779 X:153507762-153507784 TGGGCAGGCGAGGCGCCTGCTGG - Intronic
1200228485 X:154432343-154432365 TGGCCCCGAGCTTCTCCTGCAGG - Exonic
1201901139 Y:19046900-19046922 GGGCTGCGCGCGGCGCTTGCCGG - Intergenic
1202109806 Y:21407223-21407245 GGGCTGCGCGCGGCGCTTGCGGG + Intergenic
1202137133 Y:21677001-21677023 GGGCTGCGCGCGGCGCTTGCGGG - Intergenic