ID: 900191888

View in Genome Browser
Species Human (GRCh38)
Location 1:1355568-1355590
Sequence GCCCCGGGGGTGGCCCCGCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 5, 3: 24, 4: 262}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900191888_900191895 -6 Left 900191888 1:1355568-1355590 CCGCGCGGGGCCACCCCCGGGGC 0: 1
1: 0
2: 5
3: 24
4: 262
Right 900191895 1:1355585-1355607 CGGGGCCGCGCAGGTCCCAGTGG 0: 1
1: 0
2: 0
3: 18
4: 154
900191888_900191899 9 Left 900191888 1:1355568-1355590 CCGCGCGGGGCCACCCCCGGGGC 0: 1
1: 0
2: 5
3: 24
4: 262
Right 900191899 1:1355600-1355622 CCCAGTGGAGCACGCGCTGGCGG 0: 1
1: 0
2: 0
3: 14
4: 149
900191888_900191897 6 Left 900191888 1:1355568-1355590 CCGCGCGGGGCCACCCCCGGGGC 0: 1
1: 0
2: 5
3: 24
4: 262
Right 900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 112
900191888_900191903 28 Left 900191888 1:1355568-1355590 CCGCGCGGGGCCACCCCCGGGGC 0: 1
1: 0
2: 5
3: 24
4: 262
Right 900191903 1:1355619-1355641 GCGGTCGTGCAGCCGGTCCTGGG 0: 1
1: 0
2: 0
3: 1
4: 47
900191888_900191902 27 Left 900191888 1:1355568-1355590 CCGCGCGGGGCCACCCCCGGGGC 0: 1
1: 0
2: 5
3: 24
4: 262
Right 900191902 1:1355618-1355640 GGCGGTCGTGCAGCCGGTCCTGG 0: 1
1: 0
2: 0
3: 1
4: 124
900191888_900191901 21 Left 900191888 1:1355568-1355590 CCGCGCGGGGCCACCCCCGGGGC 0: 1
1: 0
2: 5
3: 24
4: 262
Right 900191901 1:1355612-1355634 CGCGCTGGCGGTCGTGCAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900191888 Original CRISPR GCCCCGGGGGTGGCCCCGCG CGG (reversed) Exonic
900191888 1:1355568-1355590 GCCCCGGGGGTGGCCCCGCGCGG - Exonic
900582210 1:3414854-3414876 GTCCCTGGGGTGGCCCTGTGAGG - Intronic
900586670 1:3435922-3435944 GGCCATGGGGTGGCCCCGCCGGG + Exonic
901361323 1:8703278-8703300 GCCGCGGGCGGGGCCCCGCGCGG - Intronic
901525943 1:9823629-9823651 GCCCCGGGGCTTACCTCGCGCGG + Exonic
901795926 1:11679815-11679837 ACCCCGGGGGTGGCCGGGCATGG - Intronic
904276000 1:29384662-29384684 GCCCCTGTGGTGGCCCCCCCTGG - Intergenic
905223405 1:36464289-36464311 GCCGCGGCGCGGGCCCCGCGGGG - Exonic
905422801 1:37859778-37859800 GCGCCCGGGGTGGCCACGCGGGG + Intergenic
906650297 1:47508211-47508233 GCCGCGGCGGGCGCCCCGCGGGG - Intergenic
909475218 1:76074632-76074654 GACCCGGGGGCGGGGCCGCGCGG + Intergenic
911114918 1:94237290-94237312 GCCCGCGGGGCGGCCCCGAGTGG - Intronic
912361644 1:109100504-109100526 GTCCCGGAGCTGGCCCTGCGGGG + Intergenic
913963021 1:143353908-143353930 GCCCCGGGCGTTGCCCAGTGAGG + Intergenic
914057376 1:144179493-144179515 GCCCCGGGCGTTGCCCAGTGAGG + Intergenic
914121770 1:144786873-144786895 GCCCCGGGCGTTGCCCAGTGAGG - Intergenic
914490084 1:148146360-148146382 GCCCCGGTGGAGGCCCGGCCCGG + Intronic
921189992 1:212700147-212700169 CCCCCGGGCGTCGCCTCGCGTGG - Intergenic
922315050 1:224434606-224434628 GGCCCGGGGGTCGCGCCGGGGGG + Intronic
922739372 1:228006883-228006905 GCCCCGGCGGGCGCCCCCCGCGG + Intergenic
922775395 1:228212175-228212197 GCCGCGTGGGTGGCTCCCCGAGG + Exonic
922987875 1:229880448-229880470 GGCCCTGGGGTGGCCCCACACGG + Intergenic
923630948 1:235649430-235649452 GCCCCGGGGAAGCCCGCGCGCGG - Intronic
924415216 1:243850466-243850488 GCCCCGGGGCGCGCCCGGCGCGG + Intronic
1064003849 10:11684782-11684804 GACCCGGGAGTGGCCCTGCCTGG + Intergenic
1070162625 10:73874833-73874855 GTCCCGGGGCGGACCCCGCGCGG + Intergenic
1071573773 10:86711657-86711679 GGCCCGGAGGAGGCCCCGGGGGG - Intronic
1073136751 10:101224559-101224581 GCCCTGGGCCTGGCCCCGCTGGG - Intergenic
1073294785 10:102432423-102432445 GCCCCGGGGGGGGTACCGTGGGG + Intronic
1074377386 10:112951300-112951322 GCCCGGGGGGCGGCTCCGGGCGG - Intronic
1074430104 10:113387069-113387091 GCCCTGTGGGAGGCCCTGCGAGG - Intergenic
1074502997 10:114043543-114043565 GCCCCGGGGGGAGCCAGGCGCGG + Intergenic
1074923657 10:118046317-118046339 GCCCCTGGGCTGCCCCCGCGAGG - Exonic
1076047048 10:127302371-127302393 GCCCCAGGAGTGGCCCCCCAGGG - Intronic
1076127679 10:127988213-127988235 CCCCTGGGGGTGGCCCCCTGTGG + Intronic
1076750001 10:132537760-132537782 GCCCCGGGCTCGGCTCCGCGGGG + Intergenic
1076846288 10:133071071-133071093 GCCCCGGGTGTGGCCCCCAGCGG - Intronic
1076864616 10:133160627-133160649 GCCCGGGGGGAGGACCCGGGAGG + Intronic
1077178399 11:1200907-1200929 GCCCCGGGGCTGGTCCTGAGAGG - Intronic
1077188872 11:1247463-1247485 GCCCCTGGTGTGGCCCGGGGTGG - Exonic
1077468840 11:2747384-2747406 GGCCTGGGGGTGGCCCCGGGAGG + Intronic
1079361921 11:19777039-19777061 GGCCCGCGGGCCGCCCCGCGTGG - Intronic
1080012343 11:27472051-27472073 GCCCAGCGGGGGGCGCCGCGGGG - Intronic
1083672188 11:64305760-64305782 GCCGCGGGGGTGGGCGGGCGGGG + Intronic
1084105012 11:66975428-66975450 GCCCTGGGGGAGGCCCCAGGAGG + Exonic
1084195855 11:67523353-67523375 ACCCCGGGGGTGGCCCGGGTGGG + Exonic
1089346949 11:117796893-117796915 GCCCCGGGTGGGGCGCAGCGGGG - Intronic
1089527636 11:119107626-119107648 CCCCCGGGGCTGGGCGCGCGGGG - Exonic
1089564588 11:119364047-119364069 GCGCGGGGGGAGTCCCCGCGCGG + Intronic
1090788624 11:130070472-130070494 TCTCCAGGGGCGGCCCCGCGCGG + Intronic
1095465395 12:42483641-42483663 GTCCCGGTGCTGGCCCCGCCTGG + Intronic
1097925436 12:65121610-65121632 CCCCCGGGGGCGGGGCCGCGAGG + Intergenic
1098255431 12:68611077-68611099 GCCGCGGCGGCGGCCGCGCGGGG + Intronic
1100385548 12:94101999-94102021 GTCCCGGGGGCTGCACCGCGAGG - Intergenic
1102256429 12:111418197-111418219 TCCCCGGCGGCGGCCCCGCGGGG + Exonic
1103786453 12:123436539-123436561 GGCCCGGGGGTGGGCCCGGGGGG + Exonic
1103993462 12:124814522-124814544 GCCCCTGGAGTGGCCACGTGGGG + Intronic
1104927436 12:132321108-132321130 ACCCAGGGGGCGGCCCCGCCAGG + Intronic
1104944366 12:132409133-132409155 GCCCTGGGGGTGGCCGGGCCAGG + Intergenic
1104981375 12:132574393-132574415 GCCCCCGGGGCGGCCTCGGGGGG + Exonic
1108371645 13:49775387-49775409 GCCCTAGGGGTGGCCACCCGGGG - Intronic
1108687074 13:52829115-52829137 GCTCCGTGGGTGGCCGGGCGCGG + Intergenic
1112656132 13:101453963-101453985 GCCCCGGCCGTGGCACAGCGCGG - Exonic
1113378165 13:109783054-109783076 GCCCACGGGGTGGCCGCTCGGGG + Exonic
1114474281 14:22982679-22982701 GCGCCGGGGGTGTCCGCGCAGGG + Intergenic
1114736702 14:25049944-25049966 CCCCGGGGGGCTGCCCCGCGCGG + Exonic
1117315283 14:54566579-54566601 GCCAGCGGGGCGGCCCCGCGGGG - Intergenic
1118749430 14:68795450-68795472 GCCCAGGGCCTGTCCCCGCGGGG + Intronic
1121127606 14:91417960-91417982 GCTCCCGGGCTGGCACCGCGAGG - Intergenic
1122059089 14:99124683-99124705 GCCCAGGGGCTGGCCCAGCGAGG - Intergenic
1122208339 14:100159476-100159498 CCACCGGGGTGGGCCCCGCGCGG + Intronic
1122428784 14:101627056-101627078 GGCCAGGGGGTGGCCCTGAGTGG + Intergenic
1122697346 14:103562532-103562554 GCCCAGCGGGGAGCCCCGCGCGG + Intronic
1122722055 14:103727674-103727696 GCCCCGGGTGTGGCCCCGGCTGG - Intronic
1123028034 14:105437819-105437841 GCCCCTGCGGTGGCCCCAGGAGG + Intronic
1123036649 14:105474514-105474536 GCCCCGGGGACGGCCCGGCCAGG + Intronic
1202918027 14_KI270723v1_random:3140-3162 GCCCCGGCGCTGGCCCGGTGAGG + Intergenic
1127763601 15:62164518-62164540 GCCGCGGGGGTGGCCGGGCCCGG + Exonic
1128770222 15:70276550-70276572 GCCCCTGGGGTGCCCCAGCCAGG + Intergenic
1129460764 15:75699049-75699071 GCCGCGGGGATGGCCCTGGGTGG - Intronic
1129933572 15:79431763-79431785 ACCCCGCGGGTGGCTCCGGGTGG + Intergenic
1130348054 15:83067067-83067089 GCGGCGGCGGCGGCCCCGCGGGG + Exonic
1131108702 15:89751061-89751083 GCCCCGTGGCGAGCCCCGCGCGG - Exonic
1131269016 15:90935355-90935377 ACCCCGGGGGTGGCCGGCCGGGG - Exonic
1132567522 16:630279-630301 GCCCTGGACGTGGCTCCGCGTGG - Intronic
1134216692 16:12321884-12321906 GCCAGGGAGGTGGCCCAGCGTGG + Intronic
1134441543 16:14302154-14302176 GGCCCGGGGTTGGCCGCGCTGGG - Intergenic
1134482198 16:14629851-14629873 GCCCCGGGGGGTGCCCGGCCCGG + Intronic
1135480073 16:22814631-22814653 GCGGCTGAGGTGGCCCCGCGCGG - Exonic
1137000099 16:35222006-35222028 GCCCCGGGGGTGGGCAAGAGGGG - Intergenic
1137033141 16:35543718-35543740 GCCCCGTGGGTGGGCGCGGGGGG - Intergenic
1138651440 16:58463635-58463657 GCCGCGGGGGCGTGCCCGCGTGG - Intronic
1139473798 16:67192426-67192448 ACCCCGGGGGCGGCCCAGCTGGG + Intronic
1139476224 16:67203799-67203821 GCACAGGGGGTGGCCGCTCGGGG - Exonic
1141168881 16:81678640-81678662 GCCCCGGGGGCGGGCACGCGGGG - Intronic
1141628738 16:85275592-85275614 ACCCTGGGGGTGGCCCAGAGAGG - Intergenic
1141934368 16:87227590-87227612 GCCCTGGGGGTGGCCGAGAGGGG - Intronic
1142074615 16:88110241-88110263 GCCCAGGAGGCGGCCCCCCGGGG - Intronic
1142130283 16:88428987-88429009 TCCCCGCGGGGGGCCCCGAGTGG + Exonic
1142293232 16:89202030-89202052 GTCCCGGGGTGGTCCCCGCGTGG + Intergenic
1142299424 16:89247760-89247782 GTCCCGGGGTGGTCCCCGCGTGG + Intergenic
1142471825 17:168973-168995 GCCCCGGGGGAGGCCCTGGCTGG + Intronic
1142474607 17:181497-181519 GCCCCGGGCGCGGCCCGGCCCGG + Exonic
1142493493 17:293476-293498 GCTCCGGGGGTGGGGCAGCGGGG + Intronic
1142764081 17:2056124-2056146 GCCCGGGCGGCGGCCGCGCGGGG - Intronic
1143007454 17:3846157-3846179 GCCCCAGGGCCGGCCCCGCCGGG + Exonic
1143223729 17:5282622-5282644 GCCCCGGGGGTGACCCCGCCGGG + Intronic
1145267803 17:21388855-21388877 CCCTCGGGGGGGGCCCAGCGGGG - Intronic
1146256074 17:31392080-31392102 GCCACGCGGGTGACCCGGCGGGG - Intronic
1147900269 17:43779021-43779043 GCCCCTGGGGCGGGCCCGCCGGG + Intergenic
1147934177 17:44002044-44002066 GCCCTGGAGGTGGCCCCACCAGG + Intronic
1149599703 17:57885508-57885530 GCGGCGGGGGTGGCACCGCCGGG - Exonic
1150137656 17:62704344-62704366 GGGTCGGGGGTGGCCGCGCGAGG + Intronic
1150249939 17:63699794-63699816 GCCCCCGACCTGGCCCCGCGAGG + Intronic
1150802360 17:68291886-68291908 GCGCCGGGGCTGATCCCGCGCGG + Intronic
1152111711 17:78360528-78360550 GGCGAGGGGGTGTCCCCGCGGGG - Intergenic
1152214711 17:79025271-79025293 GCCCGGGTATTGGCCCCGCGAGG - Intronic
1152259765 17:79260614-79260636 GCCCCAGGGGTGGCCCAGAGAGG + Intronic
1152627723 17:81395999-81396021 GCCGCGCGGGTGGCACCGGGCGG + Intronic
1152689656 17:81712253-81712275 GCCCCGGGGGCGGGACCGCTAGG - Intronic
1152695480 17:81741754-81741776 GACCCGGGTGTGGCCGCGCCTGG - Intergenic
1152697417 17:81804071-81804093 GGCTCGGGGGCGGCCCCGCGGGG - Intergenic
1155053242 18:22165758-22165780 ACCCCGGCGCTGGCTCCGCGCGG + Intergenic
1158441474 18:57478292-57478314 GCCCCGGGTGGGGCCACGTGGGG + Exonic
1160745323 19:708769-708791 GCCCCGGGGCGGGGCGCGCGGGG + Intergenic
1160995820 19:1881579-1881601 GCCCCGGTGGAGGCCCGGCCTGG - Exonic
1161197340 19:2994119-2994141 GACCCGGGGGTGGCCCCAAAGGG + Intronic
1161222086 19:3122474-3122496 GCCCCGGGGGCCGCCTCCCGGGG + Exonic
1161494999 19:4581682-4581704 GCTCCGGGGGGGGCGCTGCGCGG + Intergenic
1161968402 19:7561605-7561627 GGGCTGGGGGTGGCCCCGTGGGG + Exonic
1162032949 19:7925218-7925240 GCCCGGCGGGGGGCGCCGCGGGG - Exonic
1162416540 19:10541589-10541611 GCCCCGGGGCTGGCCACTAGAGG + Intergenic
1162572408 19:11480871-11480893 GCCCCCTGCGCGGCCCCGCGGGG + Exonic
1162948543 19:14057558-14057580 CCGGCGGGGGTGGCCCAGCGCGG + Intronic
1163163637 19:15480450-15480472 GCCCCAGGGGTGGCCCCCAGGGG - Intronic
1163478171 19:17539273-17539295 GTCCCGGGTGCGGCCTCGCGGGG - Intronic
1163666556 19:18606468-18606490 GCCCCGGGGGCAGCCGCGGGGGG - Intronic
1165420044 19:35718047-35718069 GCCCCGGGCCTGGCTCCGCGCGG + Exonic
1165420053 19:35718062-35718084 GCCCGGGAAGCGGCCCCGCGCGG - Exonic
1165454031 19:35900515-35900537 GACCCGGCGGCGGCTCCGCGGGG - Exonic
1165775728 19:38403348-38403370 GTCCCGGGGGCGGCGTCGCGGGG + Exonic
1166304069 19:41927950-41927972 GGCGCGGGGGTGGTCCCGGGAGG - Intronic
1166375317 19:42324308-42324330 GCGGCGGCGGTGGCCCCGAGGGG + Intronic
1166682567 19:44777935-44777957 GCTCTGGCGGTGGCCCCGTGGGG + Exonic
1202696860 1_KI270712v1_random:132166-132188 GCCCCGGGCGTTGCCCAGTGAGG + Intergenic
929308945 2:40399904-40399926 GCCCAGGGTGTGGCGCCGGGCGG - Intronic
929460931 2:42101621-42101643 GGGCCGGGGGCGGCCACGCGGGG - Intergenic
934278018 2:91589180-91589202 GCCCCGGGCGTTGCCCAGTGAGG + Intergenic
934754559 2:96816344-96816366 GCCGCGGGGGAGGCCGCGCCGGG + Exonic
935622906 2:105144332-105144354 TCCCGGGCGGTGGCCCCGCTCGG - Intergenic
935820312 2:106886997-106887019 GCCCCGGAGGTGTCCAGGCGCGG - Intronic
936713651 2:115161553-115161575 GCCCCCGGGGGCTCCCCGCGCGG - Intronic
941001265 2:160205727-160205749 GCCCCGGGGCAGGCCCAGCTGGG - Intronic
942067291 2:172283775-172283797 GCCTCGGGGGTGGGGCCGGGGGG + Intergenic
945234960 2:207625266-207625288 GCCCGGGAGGCGGTCCCGCGTGG + Intronic
947521306 2:230848122-230848144 GCCCCGAGCGAGGCCCGGCGGGG + Intergenic
948207299 2:236168848-236168870 GCCCCGGGGGTGGCTCCGGAGGG - Intergenic
948467475 2:238159165-238159187 GCCCCGGGGAGAGCCGCGCGGGG + Exonic
948479338 2:238240237-238240259 GCCCCGGTGCCGCCCCCGCGGGG - Intronic
1168965332 20:1894974-1894996 GCGGCGGGGGCGGCTCCGCGCGG + Intronic
1169557807 20:6768412-6768434 GTCCCGGAGCCGGCCCCGCGCGG + Exonic
1170890134 20:20369009-20369031 GGCCCGGTGGAGGCGCCGCGGGG + Exonic
1172320594 20:33993240-33993262 GCCCCGGGGGTGGCTACTCTGGG - Intergenic
1172871754 20:38140137-38140159 GCCCTGGGGCTGGCCCCATGCGG - Intronic
1175258841 20:57662702-57662724 GCCCCGGGGGTGGGGGGGCGTGG - Intronic
1175367713 20:58467201-58467223 GCCCCGGGCGTCGCCCCGGCTGG - Exonic
1175545028 20:59772667-59772689 CCCCTGGGGGTGGCCCCACTCGG - Intronic
1175856453 20:62123096-62123118 GCCGAGGGGGCGGCACCGCGGGG - Intronic
1175871618 20:62211948-62211970 GGGCCGAGGGTGGCCCCGCTAGG + Intergenic
1175979877 20:62733239-62733261 GCCTCCAGGGTGGCCCTGCGGGG - Intronic
1176075683 20:63247342-63247364 GCGCCTGGGTTGGCCCCGCCTGG + Intronic
1176144972 20:63561495-63561517 GCCCCCGTGATGGCCCTGCGTGG - Intronic
1176296490 21:5076090-5076112 GCCCCGAGGGTGGGCGCTCGGGG + Intergenic
1176550185 21:8217408-8217430 GCCCCGGGGGCGGACCCGGCGGG - Intergenic
1176550259 21:8217855-8217877 GCCCCCCCGGTGTCCCCGCGAGG + Intergenic
1176569113 21:8400446-8400468 GCCCCGGGGGCGGACCCGGCGGG - Intergenic
1176569187 21:8400893-8400915 GCCCCCCCGGTGTCCCCGCGAGG + Intergenic
1176577027 21:8444678-8444700 GCCCCGGGGGCGGACCCGGCGGG - Intergenic
1176577101 21:8445125-8445147 GCCCCCCCGGTGTCCCCGCGAGG + Intergenic
1178714153 21:34948290-34948312 GCCCCCGGCATGGCCCCGTGAGG - Intronic
1179152489 21:38821036-38821058 GCAACGGGTGTGACCCCGCGTGG + Intronic
1179860559 21:44186031-44186053 GCCCCGAGGGTGGGCGCTCGGGG - Intergenic
1179887311 21:44319686-44319708 GGACATGGGGTGGCCCCGCGGGG + Intronic
1179999341 21:44987994-44988016 GCCCCGGGGGGGGCCACCTGAGG - Intergenic
1180064209 21:45404834-45404856 GGCCCGGGGGCTGCCCCGCGAGG - Intergenic
1180559097 22:16601534-16601556 GCCCCGGGGGATCCCCGGCGCGG + Intergenic
1180650220 22:17370316-17370338 GCGCGGGGGGGGGGCCCGCGCGG + Intronic
1180701233 22:17782421-17782443 GCCCAGGCTGTGGCCCCCCGGGG + Intergenic
1180736988 22:18024520-18024542 GCCCCGGCGGAGTCCCGGCGGGG - Exonic
1181121600 22:20670997-20671019 GCCCCGGTGGAGGCCCGGCCCGG - Intergenic
1181334562 22:22118018-22118040 GCCCCGGTGGAGGCCCGGCCCGG - Intergenic
1182103666 22:27674128-27674150 GCCCCGGGGGAGGCCCCCCGGGG + Intergenic
1183453919 22:37911212-37911234 GCCCCAGGAGTGGCCCAGTGGGG + Intronic
1183460789 22:37949165-37949187 GCCCCAGGGATGGCCAAGCGGGG - Intronic
1183740044 22:39664288-39664310 GCCCCGGGGCTGGCACCCAGAGG - Intronic
1184136564 22:42553633-42553655 TCCCCGGGTCTGGTCCCGCGCGG + Intronic
1184879450 22:47295693-47295715 GCCCATGGGGAGGCCCCGCTGGG + Intergenic
1185259361 22:49853315-49853337 TCCCCCGGGGGGGCCGCGCGGGG + Intergenic
1185288017 22:50010995-50011017 GCCCTGGGGGGGGACCCGCGCGG - Intronic
1185339835 22:50286339-50286361 GCCCCAGGGGAGGCCCAGCCTGG - Intronic
1203255080 22_KI270733v1_random:133746-133768 GCCCCGGGGGCGGACCCGGCGGG - Intergenic
1203255154 22_KI270733v1_random:134193-134215 GCCCCCCCGGTGTCCCCGCGAGG + Intergenic
1203263136 22_KI270733v1_random:178825-178847 GCCCCGGGGGCGGACCCGGCGGG - Intergenic
1203263210 22_KI270733v1_random:179272-179294 GCCCCCCCGGTGTCCCCGCGAGG + Intergenic
954367649 3:50154960-50154982 GCCCCGGGGGTGGGGCTGGGCGG + Intergenic
954714114 3:52518652-52518674 GCTCTGGTGGTGGCCCTGCGTGG + Intronic
954778869 3:53045330-53045352 GCCCGGGGGGCGGGTCCGCGGGG + Intronic
959539843 3:107525166-107525188 GGACCCGGGGTGGCCGCGCGGGG - Intronic
961518951 3:127455958-127455980 GTCCCGGGGGCGGCCCGGCATGG + Intergenic
961823263 3:129586078-129586100 GCACCTGGGGTGGCACCGCAGGG + Exonic
964438144 3:156675124-156675146 GCACCCGGGGTCGGCCCGCGGGG - Exonic
966449077 3:180037121-180037143 GGCCCGAGGGCGGCCCCGGGCGG + Intergenic
966696240 3:182793416-182793438 GCGCCGGGGGCGGTCCCGGGTGG + Intergenic
966712001 3:182980679-182980701 CGCCCGGGGGAAGCCCCGCGCGG - Intronic
966868533 3:184275967-184275989 ACCCCGGGCGGGGCTCCGCGTGG + Intronic
966883313 3:184361742-184361764 GCCTCTCGGGAGGCCCCGCGCGG - Intronic
968187022 3:196639887-196639909 GCCCCGGGGACGCCCCCACGCGG - Intronic
968309986 3:197675300-197675322 TCCCCTGGGGAGGCCCCGCGAGG + Intronic
968450863 4:675324-675346 GGCCCGAGGGTGGCCCAGCACGG - Intronic
968620326 4:1601020-1601042 GCCCTGGGCGTGGCCCTGGGGGG - Intergenic
968914986 4:3493426-3493448 AAGCCGGGGGTGGCCCCGCGTGG - Exonic
968985256 4:3871455-3871477 GCGCCGGGGTGGGCTCCGCGGGG + Intergenic
969032723 4:4227156-4227178 GCCCCGGGCGTTGCCCAGTGAGG - Intergenic
969668299 4:8574956-8574978 GCCCCAGGGGTGGCCCACCCTGG - Intronic
969717070 4:8872909-8872931 GGCCCGGGGCTGGCCCTGGGAGG - Intergenic
972960461 4:44447476-44447498 GCCCCGCTGGAGGCCCCGCGGGG - Intronic
982198074 4:152936098-152936120 GCCCCGGGGGAGACGCCTCGGGG - Intergenic
986125643 5:4880528-4880550 GCACCAGGGGTGCCCCCGCAAGG + Intergenic
987439078 5:17933171-17933193 GTCCCGGTGGTGGCCCAGTGGGG - Intergenic
1001561074 5:172669407-172669429 GGCCCAGAGGTGGCCCCGCGAGG + Intronic
1002060039 5:176620619-176620641 GCCCCGGGGTTGGACGCGGGCGG + Exonic
1002122380 5:177015476-177015498 GCTCCAAGGGTGGCCCAGCGGGG + Intronic
1002352129 5:178590449-178590471 GCGGCCGGGCTGGCCCCGCGCGG + Exonic
1002445018 5:179285357-179285379 GCCCCTGCGCTGGCCCCGTGAGG - Intronic
1002692507 5:181059875-181059897 GCCGCGGGACTGGCCCCGGGGGG + Exonic
1008659527 6:53651978-53652000 ACCCCGGGGCTGGCACTGCGCGG - Exonic
1013242651 6:108260676-108260698 GACCCGGGAGTGGACCCCCGCGG - Intronic
1013459037 6:110358072-110358094 GCCGCGCGGCTGGCCCGGCGCGG + Exonic
1017810657 6:157981590-157981612 GCTCCCGGGGTCGCCCCGCGCGG + Intergenic
1019282530 7:207676-207698 GTCCCTGGTGTGGCCCCGTGAGG + Intronic
1019399482 7:844116-844138 GCCCAGGAGGAGGCCCCCCGCGG - Intronic
1019408563 7:896863-896885 GCCCCGCAGGCGGCCCCTCGTGG + Intergenic
1019549884 7:1596784-1596806 GCCCCCGAGGTGACCCAGCGTGG - Intergenic
1019711471 7:2520002-2520024 GCGCCGGGGCAGCCCCCGCGGGG - Exonic
1020231580 7:6323182-6323204 GCCCCGGGGCTGTGCCCGTGAGG - Intergenic
1024472257 7:49775772-49775794 GCCTGCGGGGTGTCCCCGCGGGG - Exonic
1026840582 7:73668230-73668252 CCCCCGGGGGTGGCTCCGCGGGG - Intronic
1029690583 7:102178673-102178695 GGCCCGGGGGTGGCCCGAGGAGG + Intronic
1030018085 7:105244600-105244622 GCGCTGGGGCTGGCGCCGCGTGG - Intronic
1031025147 7:116672066-116672088 GCGCCGCGCCTGGCCCCGCGGGG - Intergenic
1032020655 7:128405708-128405730 GGCCCGGGGGTCGCGGCGCGTGG + Intronic
1032091877 7:128915275-128915297 GCCCAGGGGGTGTGCCCCCGCGG - Intergenic
1033683622 7:143620336-143620358 GCCACGGGGGAGGCCCCGCGTGG - Intergenic
1033700990 7:143837302-143837324 GCCACGGGGGAGGCCCCGCGTGG + Intergenic
1034159649 7:148983366-148983388 GCCGCGGGGGTGGGGCCGGGCGG - Intergenic
1034335972 7:150323622-150323644 GCCCAGCAGGTGGCCCCCCGGGG - Intronic
1034618222 7:152436473-152436495 GCCCCGGGGGATCCCCGGCGCGG - Intergenic
1035171638 7:157020727-157020749 GCCCCCGGGAGGGTCCCGCGTGG - Intergenic
1035402453 7:158576439-158576461 GCCCCGGGGCTTGTCCCGAGAGG - Intronic
1047393731 8:124475048-124475070 GCCCCGGGCCCTGCCCCGCGCGG + Exonic
1049236382 8:141514447-141514469 GCCCAGAGGGTGGCCCTGCAGGG + Intergenic
1049569108 8:143360064-143360086 GCCCACGCGGTGGCCACGCGGGG + Intergenic
1049620944 8:143598020-143598042 GCCCGGGCCGCGGCCCCGCGTGG + Exonic
1051170743 9:14315904-14315926 GCCCTGGGGATGGGCCCGCGAGG - Intronic
1053569384 9:39288317-39288339 GTGCCTGGGGTGGCGCCGCGCGG - Intergenic
1054127761 9:61330693-61330715 GTGCCTGGGGTGGCGCCGCGCGG + Intergenic
1054906710 9:70419423-70419445 GACCGGGGGGGAGCCCCGCGCGG + Intergenic
1057488611 9:95506040-95506062 GCCCCGGGGCTGGCCTCTCCCGG - Intronic
1057752484 9:97803746-97803768 GCGCGGGGGGAGGCCCCGGGCGG + Intergenic
1058686854 9:107487897-107487919 GACCCGGGCGTGGCGCCGGGCGG - Exonic
1059405834 9:114098084-114098106 GCGCCGGCGGCGCCCCCGCGGGG - Intronic
1060105200 9:120868986-120869008 GCCGCGGGGGTGGGGCCTCGGGG - Intronic
1060152902 9:121299966-121299988 GCCCCTGGGGCGCCCCCGCCTGG - Exonic
1061285533 9:129620392-129620414 TCCCGGGGGGCGGCGCCGCGTGG - Exonic
1062003561 9:134228583-134228605 GCTCAGGCGGTGGACCCGCGGGG - Intergenic
1062043485 9:134414827-134414849 GCCCCGGGGGCTGCTCAGCGTGG + Intronic
1062406751 9:136400302-136400324 GCCCCCAGGGCGGCCGCGCGAGG - Intergenic
1062499670 9:136846982-136847004 GCGCCGGGGGCGGCCGCGCGGGG - Exonic
1062587443 9:137255608-137255630 GCCCCGGGGGCCGCCCCACCTGG - Exonic
1062653400 9:137590048-137590070 GCCCGGCTGCTGGCCCCGCGCGG - Intronic
1203471478 Un_GL000220v1:116883-116905 GCCCCGGGGGCGGACCCGGCGGG - Intergenic
1203471552 Un_GL000220v1:117330-117352 GCCCCCCCGGTGTCCCCGCGAGG + Intergenic
1203479299 Un_GL000220v1:160855-160877 GCCCCGGGGGCGGACCCGGCGGG - Intergenic
1203479373 Un_GL000220v1:161302-161324 GCCCCCCCGGTGTCCCCGCGAGG + Intergenic
1187648364 X:21374311-21374333 GCCCTGGGGGCGGGACCGCGCGG + Intergenic
1187900944 X:24025862-24025884 GCCCCGACGGCGGCGCCGCGGGG - Intronic
1190322321 X:49186424-49186446 GCCCGGGGGCGGGCCCTGCGGGG - Intronic
1190567289 X:51743690-51743712 TCCCCGGGGTCGGCCCCGAGCGG + Exonic
1190881547 X:54495679-54495701 GCCCCGGCCCCGGCCCCGCGCGG + Exonic
1191251919 X:58263898-58263920 GCCCCTGTGCTGGGCCCGCGGGG + Intergenic
1196804915 X:119575041-119575063 GCTCCGGGGCGGGCCCCCCGCGG + Intronic
1197745916 X:129932241-129932263 GCGCCGGGGGACGCCTCGCGGGG - Intergenic