ID: 900191890

View in Genome Browser
Species Human (GRCh38)
Location 1:1355578-1355600
Sequence GACCTGCGCGGCCCCGGGGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 218}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900191890_900191897 -4 Left 900191890 1:1355578-1355600 CCACCCCCGGGGCCGCGCAGGTC 0: 1
1: 0
2: 2
3: 17
4: 218
Right 900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 112
900191890_900191902 17 Left 900191890 1:1355578-1355600 CCACCCCCGGGGCCGCGCAGGTC 0: 1
1: 0
2: 2
3: 17
4: 218
Right 900191902 1:1355618-1355640 GGCGGTCGTGCAGCCGGTCCTGG 0: 1
1: 0
2: 0
3: 1
4: 124
900191890_900191903 18 Left 900191890 1:1355578-1355600 CCACCCCCGGGGCCGCGCAGGTC 0: 1
1: 0
2: 2
3: 17
4: 218
Right 900191903 1:1355619-1355641 GCGGTCGTGCAGCCGGTCCTGGG 0: 1
1: 0
2: 0
3: 1
4: 47
900191890_900191901 11 Left 900191890 1:1355578-1355600 CCACCCCCGGGGCCGCGCAGGTC 0: 1
1: 0
2: 2
3: 17
4: 218
Right 900191901 1:1355612-1355634 CGCGCTGGCGGTCGTGCAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 68
900191890_900191899 -1 Left 900191890 1:1355578-1355600 CCACCCCCGGGGCCGCGCAGGTC 0: 1
1: 0
2: 2
3: 17
4: 218
Right 900191899 1:1355600-1355622 CCCAGTGGAGCACGCGCTGGCGG 0: 1
1: 0
2: 0
3: 14
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900191890 Original CRISPR GACCTGCGCGGCCCCGGGGG TGG (reversed) Exonic
900125031 1:1065161-1065183 GGTCTGCGGGGCCCTGGGGGGGG + Intergenic
900191890 1:1355578-1355600 GACCTGCGCGGCCCCGGGGGTGG - Exonic
900226637 1:1536194-1536216 GGCCTCCGCGGCCCCGGGGCGGG - Intronic
900595266 1:3477490-3477512 GACCTGCTCAGCCCCGAGGGAGG - Intronic
900663073 1:3795779-3795801 GAACTGCTCGGCCCCGAGAGGGG + Intronic
901086640 1:6614948-6614970 GCCCTGCGAACCCCCGGGGGCGG - Intronic
901394056 1:8967601-8967623 GACCAGCGCTGCCCCTCGGGAGG - Intronic
901794929 1:11674628-11674650 GACCTGAGCGGCCCCGGGCTGGG + Exonic
903182398 1:21611581-21611603 GGCCTGGGGGGCCCCGGGGCAGG - Exonic
903925102 1:26826547-26826569 GACCTGCGGGGCCCCGCCGCGGG + Intergenic
905037954 1:34929708-34929730 GCCCTGCGCGGGGGCGGGGGCGG - Intergenic
905137026 1:35808057-35808079 GGCGTGCGCGGCCCCGGGCGCGG - Intergenic
912798620 1:112707222-112707244 GCCCTGCGCGGGGCCGGGGCGGG - Intronic
915143922 1:153783547-153783569 GAGCTGCGAGGCACCCGGGGCGG + Intergenic
915299708 1:154945060-154945082 GAGCTGCGGGGCCCAGGGAGGGG - Exonic
915322241 1:155062320-155062342 GACCTGCCCGGCCCAGGGGCTGG + Exonic
915462157 1:156076740-156076762 GGCCTGCGGAGCCCCGGCGGCGG - Exonic
915544982 1:156592006-156592028 GGCCTGCTCTGCCCCGGGGCGGG + Intronic
920216227 1:204363158-204363180 GAACTGCGAGACCCCGGAGGAGG - Intronic
923505310 1:234600251-234600273 GAGCCGCGCGACCCCGGGCGGGG - Intergenic
1064122963 10:12635217-12635239 GACCTGGGCAGCCACGGGGCAGG - Intronic
1064194413 10:13233699-13233721 CACCTGCCCTGCCCCGTGGGTGG + Intronic
1066126508 10:32347331-32347353 GCCCTTCGCGGGTCCGGGGGCGG + Intronic
1069725115 10:70572491-70572513 GACCCGTGCAGCCCCGTGGGTGG + Intergenic
1070329024 10:75404948-75404970 GGCCGGCGCGGGCCCGGGAGTGG + Intergenic
1072491314 10:95908165-95908187 GGCCTGCGCGGCCCCGGCTCCGG - Intronic
1072719504 10:97771937-97771959 GACCTCCGCGGCGGCGGCGGCGG - Exonic
1075574936 10:123571264-123571286 GCACTGAGCGGTCCCGGGGGCGG + Intergenic
1075871237 10:125773853-125773875 GTCGACCGCGGCCCCGGGGGCGG + Exonic
1077465927 11:2733639-2733661 GGCCTGGGCAGCCCTGGGGGAGG + Intronic
1077476535 11:2792950-2792972 GACCTGCGGCTCCCGGGGGGCGG - Intronic
1078139669 11:8682951-8682973 GGCCGGCGCGGGCCCGGGGCGGG + Intronic
1079163155 11:18012918-18012940 GGCCTGCACCGGCCCGGGGGCGG + Intronic
1081873147 11:46392181-46392203 GCCCTGCGTGGCCCCGCTGGCGG + Intergenic
1083228561 11:61300357-61300379 GACCTGTGCCACCCAGGGGGAGG - Intronic
1083343847 11:61975943-61975965 GACCAGCGCGGCCATGGGGATGG + Intergenic
1084003658 11:66312350-66312372 TTCGTGGGCGGCCCCGGGGGCGG + Intergenic
1084273523 11:68040867-68040889 GCCCAGGGCTGCCCCGGGGGTGG - Intronic
1084758014 11:71251547-71251569 GAGCTGCCCGGCCGCCGGGGAGG + Intronic
1085533562 11:77205386-77205408 GACCTGTGCACCCCCGGGTGAGG - Intronic
1089643114 11:119860567-119860589 GACTTGCGTGGCCTCGTGGGAGG - Intergenic
1090647456 11:128777239-128777261 GAGCCCCGAGGCCCCGGGGGAGG + Intronic
1091640168 12:2230198-2230220 GAGCTCCGCAGCCCGGGGGGCGG + Intronic
1091752844 12:3033390-3033412 GACTTGCGGGGCTCTGGGGGAGG - Intronic
1094841535 12:34344506-34344528 GAGCTGCTGGGCCCCGCGGGGGG - Intergenic
1100992647 12:100267246-100267268 GACGTTTGCGGCCGCGGGGGCGG + Intronic
1103410716 12:120710069-120710091 CTCCTGCGGGGCCCGGGGGGCGG - Intergenic
1103722282 12:122981274-122981296 GGCCAGCACGGCCCCTGGGGCGG + Exonic
1104001630 12:124863965-124863987 GGCCTGAGCGGGCCCGGGGCGGG + Intronic
1107133527 13:36920363-36920385 GGGCTGCGCGGGCCCGGCGGGGG + Intronic
1114514052 14:23286071-23286093 GACCGGCGCGCTCCCGGGGACGG - Exonic
1117549095 14:56816756-56816778 GAGCTGCGCCGCCCCGCTGGAGG + Intergenic
1117875928 14:60249722-60249744 GGCCTGCGCGGCGGCGGCGGCGG + Intronic
1122418435 14:101561191-101561213 GACCTGGGCGTCCGCTGGGGAGG - Intergenic
1122621137 14:103058031-103058053 GACCTGCCCGGCCGAGGTGGGGG + Intergenic
1122913248 14:104843932-104843954 GGCGTGCGCGGCCCTAGGGGAGG - Intergenic
1122929676 14:104927543-104927565 GACCTGGGCTGCCACTGGGGTGG - Intronic
1124629036 15:31326812-31326834 GGGCGGCCCGGCCCCGGGGGTGG - Intergenic
1126592709 15:50355455-50355477 CGCCTGCGCGGCAGCGGGGGTGG + Intergenic
1127674694 15:61228495-61228517 GACCTGGGAAGTCCCGGGGGTGG - Intronic
1128635270 15:69298860-69298882 GGGCGGGGCGGCCCCGGGGGAGG - Intergenic
1129232010 15:74202217-74202239 GTCCTCTGTGGCCCCGGGGGAGG + Exonic
1130990949 15:88875251-88875273 TGCCTGCACGGTCCCGGGGGCGG - Exonic
1132555504 16:570221-570243 GGTCGGCGCGGGCCCGGGGGCGG - Intronic
1132569053 16:636076-636098 GACAGGTGCGGCCCCCGGGGCGG - Exonic
1132570523 16:642100-642122 GACCTGCGGGCACCGGGGGGCGG - Exonic
1132807504 16:1781954-1781976 GAGCTGCGCGGCCCAGGAGACGG - Intronic
1134482312 16:14630288-14630310 CGCCTGCGCGGCGGCGGGGGCGG + Intronic
1134520875 16:14918737-14918759 CACCAGGGCGGCCCCTGGGGAGG - Intronic
1136518583 16:30782432-30782454 GCCCTCCGCAGCCCCGGGGTAGG + Exonic
1137988515 16:53130617-53130639 GCCCTGGGCGGCCTCGGGGCGGG - Intronic
1138105671 16:54286083-54286105 GAGCTGGGCGGCCCGGGGGTCGG - Exonic
1138229047 16:55324434-55324456 GGCCTGCGCGGCTCAGAGGGAGG + Exonic
1139410034 16:66751619-66751641 GTCCTCGGCGGGCCCGGGGGAGG - Exonic
1140369754 16:74407167-74407189 GCCCTGCGCGTGCCCGCGGGAGG - Intergenic
1141054778 16:80804622-80804644 GCCCGGCCCGGCCCCCGGGGCGG + Intergenic
1142300789 16:89256827-89256849 GACCTGTGTGGTCCCGGGGAGGG - Intergenic
1142764841 17:2059133-2059155 GAGCAGCGCGGAGCCGGGGGAGG - Exonic
1142998396 17:3775033-3775055 GACCTGCCTGAGCCCGGGGGCGG - Intronic
1144586742 17:16491928-16491950 GCCCGGCGCGGCGCCGGGGCTGG + Exonic
1148714685 17:49707710-49707732 GATGTGAGCGACCCCGGGGGCGG - Exonic
1150484869 17:65536832-65536854 GACCCTCGCGGCCGCGGCGGCGG + Intronic
1150791835 17:68205585-68205607 GGCCTGCGAGGCCGCGCGGGAGG - Intergenic
1151391184 17:73787641-73787663 GGCCTGCGTGGCCCTGGGGAGGG - Intergenic
1152157628 17:78645239-78645261 GACCTGGGCGGCCCAGGAGTGGG - Intergenic
1152809588 17:82375297-82375319 CACCTGCGCGGCCGCGTGCGGGG + Exonic
1153006342 18:501058-501080 GAGCTGCTGTGCCCCGGGGGTGG + Intergenic
1153457580 18:5296470-5296492 GGCCTGCGCGCGCCCGGGGGAGG - Intronic
1153636584 18:7117923-7117945 AAGCTGGGCGCCCCCGGGGGAGG - Intergenic
1154447996 18:14450379-14450401 GGCCCGCGCGGCCACGGGCGCGG - Intergenic
1157464312 18:47930841-47930863 TACCCGCGCGGCCGCGGCGGCGG - Intronic
1159511359 18:69401162-69401184 GACCCGCGCAGACCCGGCGGCGG + Exonic
1160025398 18:75211681-75211703 CTCCTGAGCGGCCCCGGGCGCGG + Intronic
1160500639 18:79399878-79399900 GCCCTGCGGAGCCCCGGGAGTGG - Intronic
1160691435 19:462053-462075 CACCTCCCCGGCCCCGCGGGCGG - Intergenic
1160826231 19:1081804-1081826 GCCCTGCGGGAGCCCGGGGGTGG - Exonic
1160861798 19:1240270-1240292 GACCTGCGTGAGCGCGGGGGCGG + Intergenic
1161183486 19:2900894-2900916 GAGCTCCGAGGCCCCGAGGGCGG + Exonic
1161433502 19:4248157-4248179 GACCTGCGTGGGGCCGGGCGCGG - Intronic
1161446845 19:4323444-4323466 GCCCTCCGCGGCCCAGGGGGAGG + Intronic
1161702952 19:5805021-5805043 GGCCGGCGCGGGGCCGGGGGCGG - Intergenic
1161808774 19:6459697-6459719 ACCCTGCGGGGTCCCGGGGGGGG - Exonic
1162341867 19:10096185-10096207 GCCCGGGGCGGGCCCGGGGGCGG - Exonic
1162398312 19:10430679-10430701 GACCCGCCCCGCCCTGGGGGCGG + Intronic
1163464012 19:17455684-17455706 GGCGGGCGCGACCCCGGGGGAGG - Exonic
1164631123 19:29762133-29762155 GCCCTTCACGGCCCTGGGGGAGG - Intergenic
1166809878 19:45508524-45508546 CACCTGCGCGGCCCTGGAGAGGG + Intronic
1166925224 19:46262150-46262172 CACCTGCCCGGCCCTGGGGGTGG + Intergenic
1167454465 19:49591285-49591307 GTCCCGGGCGGCCCCGGGGTGGG - Intergenic
1167454610 19:49591688-49591710 GACCCGCTCGGCGCCGGGGCGGG + Exonic
1167507658 19:49879384-49879406 CACCTGCGCTGCCCCAGGGCAGG + Intronic
1167623276 19:50570189-50570211 GACTTGAGCGGCGCCAGGGGCGG - Intergenic
1168694414 19:58396576-58396598 GCCTTGCGCGGCCCGGGCGGGGG - Exonic
924962312 2:46120-46142 GCCCTGCGCGCCACCGGGGCCGG + Exonic
927249258 2:20983214-20983236 GAGCTGCAGGGCCCCGGAGGAGG + Intergenic
933706342 2:85293461-85293483 CACCTGCTCGGCTCCTGGGGAGG - Intronic
934754607 2:96816505-96816527 GTCCTGGGTGGCCCCGGAGGGGG + Exonic
939629396 2:144515903-144515925 GAGCTGCGCGGCGCGGGGAGGGG - Intronic
940639811 2:156333899-156333921 GACTTGGACGGCCGCGGGGGTGG - Intronic
940646831 2:156400473-156400495 GCCCTGCGCGGCCACAGCGGCGG - Intergenic
945080905 2:206085608-206085630 GGCCTGCGCGGGCCAGGTGGGGG - Intronic
946248274 2:218399214-218399236 GACGTGCGGGGCCCCGGGTGGGG + Intronic
946325332 2:218981913-218981935 GTCCTGGGCGGCCGCGGCGGCGG + Exonic
946747569 2:222861212-222861234 GGCCTGCGCGGGCCCGAGGCCGG + Exonic
947762290 2:232611579-232611601 GAACTGTTCTGCCCCGGGGGAGG - Intronic
948690121 2:239696758-239696780 GGCCTGAGAGGCCCCTGGGGAGG - Intergenic
1169244481 20:4015204-4015226 GTCCGGCGCGGCCCCGGGACTGG - Intronic
1170999051 20:21395993-21396015 GCGCTGCACGGCCCGGGGGGCGG - Exonic
1172239266 20:33401403-33401425 GAGCAGCGCGGCCGCCGGGGTGG - Intronic
1172458049 20:35092941-35092963 GTCCTGCGCGGCAGCGGGGTAGG + Intergenic
1172579700 20:36037107-36037129 GCCCTGCTCAGCCCCTGGGGTGG - Intergenic
1174607036 20:51768456-51768478 GCGCCGCGCCGCCCCGGGGGAGG + Exonic
1176201264 20:63861690-63861712 GACCTGCGCGGCAGCCGCGGCGG + Exonic
1179476363 21:41648732-41648754 GACCAGCTGGGCCCCGGGGGAGG + Intergenic
1179840772 21:44071805-44071827 GACCAGAGCAGGCCCGGGGGAGG + Intronic
1180609362 22:17085514-17085536 GAACTCCGCGGCCCGGGCGGAGG - Intronic
1180921519 22:19523919-19523941 CACCTGCGTGGCCCCGGGCCCGG - Exonic
1180950605 22:19718933-19718955 GACCTGCGAGGCCGCTGCGGAGG - Intronic
1180969141 22:19805945-19805967 GACATGAGCGGCCCCGAGGAGGG + Intronic
1180970550 22:19812689-19812711 GTCCAGCGTGGCCCCGGGGTGGG + Intronic
1180997157 22:19971292-19971314 GGCCTGCTGGGCCCGGGGGGAGG + Exonic
1182148066 22:28009576-28009598 CACCTGCGCTGCCCAGGTGGAGG - Intronic
1182604133 22:31490007-31490029 CCCCTGCGCGGGCCGGGGGGTGG + Intronic
1184033971 22:41910014-41910036 GACCGGCGGGGCCCAGGGGCAGG + Exonic
1184180186 22:42816480-42816502 GACCTGCTCGGCCCAGTGAGAGG - Intronic
1185044924 22:48523990-48524012 GGCCAGCCCGGCCCCGGGGCAGG - Intronic
1185105846 22:48869356-48869378 CACCTGCGGGGCCCTGGGGAGGG + Intergenic
1185188557 22:49418075-49418097 CACCCGCGCGGCCCCAGGAGGGG + Intronic
949129371 3:482806-482828 GAACTGCGTGACCCCGGAGGCGG + Intergenic
949129392 3:482895-482917 GAACTGCGTGACCCCGGAGGCGG + Intergenic
949129412 3:482984-483006 GAACTGCGTGACCCCGGAGGCGG + Intergenic
949129432 3:483073-483095 GAACTGCGTGACCCCGGAGGCGG + Intergenic
949129473 3:483251-483273 GAACTGCGTGACCCCGGAGGCGG + Intergenic
949129515 3:483429-483451 GAACTGCGTGACCCCGGAGGCGG + Intergenic
949129536 3:483518-483540 GAACTGCGTGACCCCGGAGGCGG + Intergenic
950345524 3:12288466-12288488 GACCTCCGCGTCCCCGGCGGAGG + Intronic
950429113 3:12940847-12940869 GCCCTGAGCGGTCCCTGGGGAGG - Intronic
950496688 3:13338114-13338136 GACCTGCGGGGCCTTGGGAGAGG - Intronic
951565012 3:24004439-24004461 GACCTGTGAGGCCCTAGGGGAGG + Intergenic
954368899 3:50160111-50160133 GCCCTGAGCAGCCCCTGGGGTGG + Intronic
954693797 3:52409953-52409975 GGACTGAGGGGCCCCGGGGGCGG - Exonic
954982959 3:54762498-54762520 GAACTGCCAGGCCCCAGGGGGGG + Intronic
959849824 3:111072388-111072410 GACCCGCGCGGCCGCGGGGGAGG - Intronic
961237686 3:125381777-125381799 GACCTGTGCAGCCCCGGGCCAGG + Intergenic
961403940 3:126665995-126666017 GACCTGCGGGGCCGTGGGAGAGG + Intergenic
962108491 3:132417628-132417650 GAGCTGCAGGGCCCCGGCGGGGG + Exonic
963904524 3:150762886-150762908 GACCCGGGCGGCCCCGCGGCAGG - Exonic
964975612 3:162615468-162615490 GATTTGGGCGGGCCCGGGGGTGG + Intergenic
967980245 3:195061199-195061221 GGCATGGGCGGCCCCGGGTGAGG - Intergenic
968093044 3:195909771-195909793 CGCCTGCGCCGCCCCGGGGTGGG + Intronic
968230698 3:197003176-197003198 GGGCCGCGCGGGCCCGGGGGCGG + Exonic
969330836 4:6472677-6472699 CACCTGCAGGGCCGCGGGGGCGG - Intronic
972686885 4:41360704-41360726 GACCTGCGCCGGCCGGGGGCGGG + Intronic
973619512 4:52712686-52712708 GCCCTCGGCGGCCCGGGGGGCGG + Intergenic
973623693 4:52751186-52751208 GCCCTCGGCGGCCCAGGGGGCGG - Intronic
975249316 4:72159841-72159863 GACCTCCGTGGCCCAGGGGTGGG - Intergenic
975991880 4:80266524-80266546 GAGCCTCGCGGTCCCGGGGGCGG - Intergenic
979547182 4:121951617-121951639 GACCTTCCCGGCGCCGGAGGAGG - Exonic
983484621 4:168318657-168318679 GAGCTGCGCGCCCCGCGGGGAGG + Exonic
985662163 5:1162670-1162692 GCCCTTCGAGGCCCTGGGGGTGG + Intergenic
986721653 5:10564535-10564557 GACCTGCGCGCCCCGGGGTGGGG - Exonic
988609306 5:32710570-32710592 AACCTGCGTGGCCCAGGGGGAGG + Intronic
997585436 5:135040499-135040521 GGCCTGCGGGGCCACAGGGGTGG - Intronic
999279731 5:150357477-150357499 GTCCCGGCCGGCCCCGGGGGCGG + Intergenic
1000391404 5:160726924-160726946 GACCTGGAAGCCCCCGGGGGTGG + Intronic
1001070259 5:168579439-168579461 GAGATGCCCGGCCCAGGGGGCGG + Exonic
1002081621 5:176740858-176740880 GGCCTGGGGGGCCCCGGGGAAGG + Intergenic
1002181228 5:177432122-177432144 GCCCTGCCCAGCCCCGCGGGTGG + Intronic
1002185931 5:177454829-177454851 GTCCCGCGCGGCCCCGGGTGAGG + Exonic
1002278300 5:178116860-178116882 GCCCTGTGTGGCCCTGGGGGCGG - Intronic
1002617712 5:180465972-180465994 GACCTGCCTGGGCTCGGGGGAGG + Intergenic
1002638332 5:180618988-180619010 GGCCTGCGGGGCGCCGCGGGCGG - Intronic
1003218524 6:4136044-4136066 GACTTGCGCGGCGCGTGGGGCGG + Intergenic
1004228867 6:13813829-13813851 GCCCTGCTCGGCCGCGGTGGCGG - Intronic
1005526788 6:26659410-26659432 GGCCTGCGGGGCCCAGGGGTGGG - Intronic
1006451051 6:34105927-34105949 GACCTGGGCGGTCCTGGTGGAGG - Intronic
1011517383 6:88167465-88167487 ACCCTGCAGGGCCCCGGGGGCGG - Intergenic
1011610436 6:89145971-89145993 TTCCCGCGCGGCGCCGGGGGCGG + Intergenic
1016947198 6:149546127-149546149 GAACTGCTCGGAACCGGGGGCGG - Intergenic
1017497784 6:154996054-154996076 GACGGGCGCGGCTCCTGGGGGGG + Intronic
1018060897 6:160088938-160088960 GGCCTGCGCAGCCCGGGGAGTGG + Intronic
1019171715 6:170136645-170136667 GCCCTGCGCGGCACTGGAGGGGG - Intergenic
1019563201 7:1667880-1667902 AATCGGCGCGGCCACGGGGGAGG + Intergenic
1021510595 7:21428339-21428361 CATCTCAGCGGCCCCGGGGGAGG - Intronic
1022088076 7:27088149-27088171 GACCTGCGCCGGTCCGGGGCGGG - Intergenic
1022103807 7:27184601-27184623 GACCTCCGCGGCGGCGGCGGCGG - Exonic
1023984261 7:45085915-45085937 GGCCTGGGCGGACCCAGGGGAGG - Exonic
1024471681 7:49773523-49773545 GGCCCGCGCTGCCCCGGGGGAGG - Intergenic
1024524377 7:50336236-50336258 GCCCTGCCTGGCCCCGGCGGGGG + Intronic
1025017241 7:55449372-55449394 GACCTGCGCGTCCCTGGAGAGGG - Intronic
1026817030 7:73521578-73521600 AAAGTGCGGGGCCCCGGGGGCGG + Intronic
1027001434 7:74657395-74657417 GGCCTGCGCGGCCGCCCGGGTGG - Intergenic
1027055765 7:75048387-75048409 GACCTGCAGGGCCCACGGGGAGG + Intronic
1029207500 7:98878449-98878471 GGCCTGCGCGGGCACGGGGAGGG - Intronic
1031008420 7:116499650-116499672 GCCCTGCGAGGCCCGGGCGGCGG - Exonic
1032125333 7:129189057-129189079 GACCTCGGCGGCCGCGGAGGCGG - Exonic
1032306071 7:130733620-130733642 GACCGCCGCGGCGCCGGAGGCGG + Exonic
1035160922 7:156949601-156949623 GAGCTGCGCGGAGCCGGGTGCGG - Intergenic
1035385256 7:158467844-158467866 GACCTGGGAGCCCCCGGGGAAGG + Intronic
1037609204 8:20462265-20462287 GACCTGTGCAGCCCTGGGGGTGG - Intergenic
1040110893 8:43566795-43566817 GGCCTGCCCCGACCCGGGGGGGG - Intergenic
1049219445 8:141422252-141422274 GAACCGCCCGGCCCCGGTGGAGG + Exonic
1049297805 8:141852458-141852480 GCCCTGGGAGGCCCCGAGGGAGG + Intergenic
1049509002 8:143018477-143018499 CAGCCGCGCGGCCCCGGGGCGGG - Intronic
1049686260 8:143940430-143940452 GACCTGGGCGACCCCAGGGGTGG + Intronic
1049694585 8:143977104-143977126 GATCTCCGCGGCCCAGGGGCGGG - Intergenic
1053136026 9:35650677-35650699 CACCTGCTGGGCCCTGGGGGTGG - Intronic
1056188846 9:84165069-84165091 CACCTGCTCGGCCTCTGGGGAGG - Intergenic
1061285427 9:129620039-129620061 GCCCCGCGGGGCCCGGGGGGCGG - Intronic
1062031401 9:134363645-134363667 CACCTGTGCGGCACCGGGTGTGG + Intronic
1062489971 9:136800250-136800272 GACTTGCGGGTCCCCTGGGGAGG + Intronic
1062574604 9:137200358-137200380 GATCTGCGCGGCCCCCGGGGCGG + Exonic
1062685910 9:137813329-137813351 GACGTGCTCTGCCCAGGGGGTGG - Intronic
1189301253 X:39954164-39954186 GACCTGCACTGCACCGGGGCAGG + Intergenic
1190099765 X:47513549-47513571 GGCCCGCGCGGCCGCAGGGGCGG - Intergenic
1190385646 X:49879972-49879994 CCCCGGCGCGGCCCTGGGGGCGG + Exonic
1200244570 X:154516168-154516190 GACCCGCTCCGCCCCGGGAGAGG + Exonic
1200277864 X:154751164-154751186 GGCCGCCGCGGCCCCCGGGGAGG + Intronic