ID: 900191894

View in Genome Browser
Species Human (GRCh38)
Location 1:1355584-1355606
Sequence CACTGGGACCTGCGCGGCCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1267
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 1241}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900191894_900191897 -10 Left 900191894 1:1355584-1355606 CCGGGGCCGCGCAGGTCCCAGTG 0: 1
1: 0
2: 3
3: 22
4: 1241
Right 900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 112
900191894_900191907 29 Left 900191894 1:1355584-1355606 CCGGGGCCGCGCAGGTCCCAGTG 0: 1
1: 0
2: 3
3: 22
4: 1241
Right 900191907 1:1355636-1355658 CCTGGGTCCACACCATGCGCGGG 0: 1
1: 0
2: 1
3: 18
4: 210
900191894_900191902 11 Left 900191894 1:1355584-1355606 CCGGGGCCGCGCAGGTCCCAGTG 0: 1
1: 0
2: 3
3: 22
4: 1241
Right 900191902 1:1355618-1355640 GGCGGTCGTGCAGCCGGTCCTGG 0: 1
1: 0
2: 0
3: 1
4: 124
900191894_900191903 12 Left 900191894 1:1355584-1355606 CCGGGGCCGCGCAGGTCCCAGTG 0: 1
1: 0
2: 3
3: 22
4: 1241
Right 900191903 1:1355619-1355641 GCGGTCGTGCAGCCGGTCCTGGG 0: 1
1: 0
2: 0
3: 1
4: 47
900191894_900191905 28 Left 900191894 1:1355584-1355606 CCGGGGCCGCGCAGGTCCCAGTG 0: 1
1: 0
2: 3
3: 22
4: 1241
Right 900191905 1:1355635-1355657 TCCTGGGTCCACACCATGCGCGG 0: 1
1: 0
2: 3
3: 7
4: 99
900191894_900191901 5 Left 900191894 1:1355584-1355606 CCGGGGCCGCGCAGGTCCCAGTG 0: 1
1: 0
2: 3
3: 22
4: 1241
Right 900191901 1:1355612-1355634 CGCGCTGGCGGTCGTGCAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 68
900191894_900191899 -7 Left 900191894 1:1355584-1355606 CCGGGGCCGCGCAGGTCCCAGTG 0: 1
1: 0
2: 3
3: 22
4: 1241
Right 900191899 1:1355600-1355622 CCCAGTGGAGCACGCGCTGGCGG 0: 1
1: 0
2: 0
3: 14
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900191894 Original CRISPR CACTGGGACCTGCGCGGCCC CGG (reversed) Exonic
900170588 1:1266448-1266470 CACTGTGACCTCCGCCTCCCTGG - Intronic
900191894 1:1355584-1355606 CACTGGGACCTGCGCGGCCCCGG - Exonic
900210469 1:1453276-1453298 CACTGCAACCTGCGCCTCCCGGG + Intronic
900229021 1:1546765-1546787 CACTGCAACCTCCGCCGCCCGGG - Intronic
901027103 1:6284498-6284520 CACTGCAACCTGCGCCTCCCGGG - Intronic
901074937 1:6548221-6548243 CACTGCAACCTGCGCCTCCCAGG + Intronic
901081913 1:6588438-6588460 CAAAGGTACCTGGGCGGCCCTGG + Exonic
901273585 1:7972972-7972994 CACTGCAACCTCCGCCGCCCGGG - Intronic
901386686 1:8914174-8914196 CACTGCAACCTCCGCCGCCCGGG + Intergenic
901549266 1:9983277-9983299 CACTGGAACCTGTGCCTCCCGGG - Exonic
901567690 1:10132052-10132074 CACTGCAACCTGCGCCTCCCAGG - Intronic
901708775 1:11097300-11097322 CACTGCAACCTGCGCCTCCCAGG - Intronic
901753082 1:11423719-11423741 CACTGGAACCTCCGCCTCCCGGG - Intergenic
901787899 1:11636845-11636867 CACTGCAACCTCCGCGTCCCAGG - Intergenic
901855581 1:12042379-12042401 CACTGCAACCTGCGCCTCCCGGG + Intergenic
902196493 1:14802326-14802348 CACTGCGACCTCCGCTTCCCGGG - Intronic
902262826 1:15239510-15239532 CACTGTGACCTCCGCCTCCCAGG - Intergenic
902299280 1:15489947-15489969 CACTGCAACCTGCGCCTCCCGGG + Intronic
903166050 1:21521258-21521280 CACTGCAACCTGCGCCTCCCGGG + Intronic
903249770 1:22044345-22044367 CACTGCGACCTCCGCCTCCCGGG + Intergenic
903252246 1:22063794-22063816 CACTGGAACCTTCGCCTCCCGGG + Intronic
903303006 1:22392222-22392244 CACTGCAACCTGCGCCTCCCAGG - Intergenic
903332125 1:22601622-22601644 CACAGGGACGTGCGCGCCCTGGG + Exonic
903395037 1:22994541-22994563 CACTGCAACCTCCGCGTCCCGGG + Intergenic
903498263 1:23786663-23786685 CACTGCGACCTCCGCCTCCCAGG + Intronic
903893985 1:26590348-26590370 CACTGCAACCTGCGCCTCCCAGG - Intergenic
903899578 1:26633778-26633800 CACTGCAACCTCCGTGGCCCAGG - Intergenic
904055982 1:27670360-27670382 CACTGAGACCTTCGCCTCCCAGG + Intronic
904121616 1:28202012-28202034 CACTGCGACCTCCGCCTCCCAGG - Intronic
904168013 1:28570987-28571009 CACTGCAACCTGCGCCTCCCGGG - Intronic
904208430 1:28870325-28870347 CACTGCAACCTCCGCCGCCCGGG + Intergenic
904500229 1:30908839-30908861 CACTGGGGCCCGCCCCGCCCCGG - Intergenic
904653579 1:32025374-32025396 CACTGTGACCTCCGCCTCCCGGG + Intronic
904980461 1:34496745-34496767 CACTGTGACCTCCGCCTCCCGGG - Intergenic
905586761 1:39125915-39125937 CACTGGAACCTCCGCCTCCCGGG - Intronic
905642823 1:39603514-39603536 CACTGCAACCTCCGCTGCCCGGG + Intergenic
905644575 1:39616432-39616454 CACTGTAACCTGCGCCTCCCAGG + Intergenic
906211698 1:44015869-44015891 CACTGGGGGCTGCTCGGCCCGGG - Intronic
906309736 1:44745111-44745133 CACTGGAACCTCCGCCTCCCAGG - Intronic
906440499 1:45839202-45839224 CACTGCGACCTCCGCCTCCCGGG + Intronic
906517454 1:46448142-46448164 CAGTAGGCCCTGCGCCGCCCAGG + Intergenic
907011666 1:50968985-50969007 CACTGGGAGCGGTGCGGCCAAGG + Exonic
907070609 1:51531192-51531214 CACTGGAACCTGCGAGGCAGAGG + Intergenic
907191309 1:52651311-52651333 CACTGCAACCTGCGCCTCCCAGG + Intronic
907364233 1:53946176-53946198 CCCTGGGTCCTGCGGGCCCCGGG - Exonic
907376801 1:54050932-54050954 CACTGCGACCTGCGCCTCCCAGG + Intronic
908076548 1:60525836-60525858 CACTGCGACCTCCGCCTCCCAGG - Intergenic
908169885 1:61493888-61493910 CACTGCAACCTGCGCCTCCCGGG + Intergenic
908339686 1:63164029-63164051 CACTGGAACCTCCGCCTCCCAGG + Intergenic
908477576 1:64505282-64505304 TACTGGTACCTGCTCAGCCCCGG + Intronic
908554077 1:65239733-65239755 CACTGGAACCTCCGCCTCCCGGG + Intergenic
909289673 1:73866488-73866510 CACTGCAACCTCCGCGTCCCAGG - Intergenic
909394141 1:75150750-75150772 CACTGGAACCTCCGCCTCCCGGG + Intronic
909630267 1:77763307-77763329 CACTGCAACCTCCGCCGCCCGGG - Intergenic
910358180 1:86386459-86386481 CACTGTGACCTTCGCCTCCCAGG + Intronic
910489803 1:87756466-87756488 CACTGGAACCTCCGCCTCCCAGG + Intergenic
910717989 1:90253274-90253296 CACTGGGACCTGTGGGGGGCTGG + Intergenic
910943781 1:92565892-92565914 CACTGCAACCTGCGCCTCCCAGG - Intronic
910970298 1:92849586-92849608 CACTGGAACCTCCGCCTCCCAGG + Intronic
911543172 1:99183868-99183890 CACTGCAACCTCCGCCGCCCAGG + Intergenic
911953871 1:104211191-104211213 CACTGCAACCTGCGCCTCCCAGG - Intergenic
913250723 1:116910281-116910303 CACGGGGACTGGCGAGGCCCTGG + Intronic
913304786 1:117416776-117416798 AACTGGTACCTGTGCTGCCCAGG + Intronic
914504937 1:148280914-148280936 CCCTGGGACCCACGCGGCTCAGG - Intergenic
914507627 1:148303234-148303256 CCCTGGGACCCACGCGGCTCAGG + Intergenic
914729899 1:150361128-150361150 CACTGCAACCTCCGCTGCCCAGG + Intergenic
914798563 1:150942370-150942392 CACTGGAACCTCCGCCTCCCTGG - Intronic
914849588 1:151304417-151304439 CACTGCGACCTCCGCCTCCCAGG + Intronic
915126527 1:153669524-153669546 CACTGCAACCTCCGCGTCCCGGG + Intronic
915144292 1:153786028-153786050 CACTGCAACCTGCGCCTCCCAGG + Intergenic
915238713 1:154503510-154503532 CACTGCAACCTGCGCCTCCCGGG - Intronic
915449220 1:155993074-155993096 CACTGTGACCTCCGCCTCCCAGG - Intronic
915551418 1:156637428-156637450 CACTGCGACCTCCGCCTCCCAGG + Intergenic
915604692 1:156943134-156943156 CACTGCAACCTGCGCCTCCCGGG + Intronic
915911308 1:159917283-159917305 CACTGCGACCTCCGCCTCCCAGG - Intergenic
916104054 1:161417933-161417955 CACTGCAACCTGCGCCTCCCGGG - Intergenic
917385187 1:174465273-174465295 CACTGTGACCTCCGCCTCCCGGG + Intronic
917912816 1:179668816-179668838 CACTGCAACCTGCGCCTCCCAGG + Intronic
917941502 1:179927208-179927230 CACTGCAACCTCCGCCGCCCAGG + Intergenic
918307138 1:183257363-183257385 CACTGCAACCTCCGCGTCCCGGG - Intronic
918415930 1:184308931-184308953 CACTGCAACCTGCGCCTCCCGGG + Intergenic
918440708 1:184564382-184564404 CACTGCAACCTGCGCCTCCCAGG + Intronic
918608533 1:186459084-186459106 CACTGCAACCTGCGCCTCCCAGG - Intronic
919702714 1:200647896-200647918 CACTGCAACCTGCGCCTCCCAGG - Intronic
919785065 1:201253647-201253669 CACGGGGACCTGAGCAGGCCTGG + Intergenic
920048466 1:203148951-203148973 CACTGCAACCTCCGCCGCCCGGG + Intronic
920418387 1:205813387-205813409 CGCTGGGACCCGCGCGCTCCAGG - Intronic
920492130 1:206424577-206424599 CACTGGAACCTCCGCTTCCCAGG - Intronic
920636782 1:207711821-207711843 CACTGCAACCTCCGCGTCCCAGG - Intronic
921012105 1:211151797-211151819 CACTGGAACCTCCACGTCCCGGG - Intergenic
921506907 1:215983024-215983046 CACTGGAACCTCCGCCTCCCAGG + Intronic
921513207 1:216057609-216057631 CACTGCAACCTGCGCCGCCCGGG - Intronic
921796935 1:219356422-219356444 CACTGCGACCTCCGCCTCCCGGG - Intergenic
922257954 1:223909701-223909723 CACTGCGACCTCCGCTGCCTGGG + Intergenic
922489966 1:226008125-226008147 CACTGCGACCTCCGCCTCCCGGG - Intergenic
922592944 1:226792075-226792097 CACTGCAACCTCCGCCGCCCAGG - Intergenic
922813987 1:228436198-228436220 CACTGTGACCTCCGCCTCCCGGG - Intergenic
922821080 1:228486432-228486454 CACTGCAACCTCCGCGTCCCGGG - Intergenic
923013771 1:230109750-230109772 CACTGCGACCTCCGCCTCCCAGG - Intronic
923307607 1:232702455-232702477 CACTGTGACCTCCGCCTCCCGGG - Intergenic
923320422 1:232827274-232827296 CACTGCAACCTCCGCGTCCCAGG + Intergenic
923395250 1:233555486-233555508 CACTGCGACCTCCGCCTCCCGGG + Intergenic
923412121 1:233720842-233720864 CACTGCGACCTCCGCCTCCCAGG - Intergenic
923567688 1:235088881-235088903 CACTGGGACCTGCTGGGGTCTGG + Intergenic
923791135 1:237112187-237112209 CACTGTGACCTCCGCTTCCCGGG + Intronic
924534586 1:244924037-244924059 CACTGGAACCTCCGCCTCCCGGG + Intergenic
924554187 1:245104426-245104448 CACTGGAACCTCCGCCTCCCAGG - Intronic
1062939890 10:1413213-1413235 CACTGGGACCCCTGCTGCCCTGG - Intronic
1063443579 10:6093287-6093309 CACTGCGACCTCCGCCTCCCGGG + Intronic
1063999236 10:11649597-11649619 CACTTGGACCTGGGAGGTCCTGG - Intergenic
1064053809 10:12080633-12080655 CACTGCAACCTGCGCCTCCCGGG - Intronic
1064064408 10:12168836-12168858 CACTGCAACCTGCGCCTCCCGGG + Intronic
1064138035 10:12767251-12767273 CACTGCAACCTGCGCCTCCCAGG + Intronic
1064419142 10:15175355-15175377 CACTGCAACCTGCGCCTCCCGGG - Intergenic
1064460637 10:15531867-15531889 CACTGCAACCTGCGCCCCCCAGG - Intronic
1064673148 10:17735981-17736003 CACTGCAACCTTCGCCGCCCAGG - Intergenic
1064805956 10:19133012-19133034 CACTGCAACCTGCGCCTCCCAGG + Intronic
1064836052 10:19532328-19532350 CACTGGAACCTCCGCCTCCCAGG + Intronic
1065846374 10:29747061-29747083 CACTGCGACCTCCGCCTCCCAGG + Intergenic
1066290307 10:34008438-34008460 CACTGCAACCTCCGCGTCCCAGG + Intergenic
1066412732 10:35189589-35189611 CACTGCGACCTCCGCCTCCCAGG + Intronic
1066459072 10:35597394-35597416 CACTGCAACCTCCGCGTCCCAGG - Intergenic
1066536457 10:36397434-36397456 CACTGCGACCTCCGCCTCCCAGG - Intergenic
1067113454 10:43417105-43417127 CACTGTGACCTCCGCCTCCCGGG - Intergenic
1067949338 10:50714445-50714467 CACTGCAACCTGCGCCTCCCTGG - Intergenic
1068433860 10:56966079-56966101 CACTGCAACCTCCGCCGCCCAGG - Intergenic
1068481262 10:57591318-57591340 CACTGCGAACTCCGCCGCCCGGG - Intergenic
1068549729 10:58393053-58393075 CACTGCAACCTGCGCCTCCCGGG + Intronic
1068578086 10:58707603-58707625 CACTGTGACCTCCGCCTCCCGGG + Intronic
1068708360 10:60103024-60103046 CACTGCAACCTGCGCCTCCCGGG + Intronic
1068775431 10:60863606-60863628 CACTGGGACCTCTGCCTCCCAGG + Intergenic
1068981073 10:63062713-63062735 CACTGGGACCTCCACCTCCCAGG + Intergenic
1069465979 10:68639542-68639564 CACTGGAACCTGTGCCTCCCAGG + Intronic
1069523407 10:69145109-69145131 CACTGAAACCTCCGCGTCCCGGG + Intronic
1069543066 10:69309972-69309994 CACTGTGACCTCCGCCTCCCGGG - Intronic
1069644027 10:69978849-69978871 CACTGTGACCTCCGCCTCCCAGG - Intergenic
1069664622 10:70146258-70146280 CACTGGGGCGTGCACAGCCCTGG + Exonic
1071228246 10:83556987-83557009 CACTGGAACCTCCGCCTCCCGGG + Intergenic
1071540590 10:86479331-86479353 CACTGTAACCTGCGCCTCCCGGG + Intronic
1072137754 10:92563173-92563195 CACTGCAACCTCCGCGTCCCGGG - Intronic
1072170703 10:92858839-92858861 CACTGCAACCTCCGCTGCCCAGG + Intronic
1072221911 10:93333938-93333960 CACAGGGCCCTGGGTGGCCCAGG + Intronic
1072239170 10:93479214-93479236 CACTGGAACCTCCGCCTCCCAGG + Intronic
1072344899 10:94495097-94495119 CACTGTGACCTCCGCTGCCTGGG + Intronic
1072393482 10:95014339-95014361 CACTGCAACCTGCGCCTCCCAGG + Intergenic
1072491316 10:95908171-95908193 CCCAGCGGCCTGCGCGGCCCCGG - Intronic
1072707888 10:97695209-97695231 CACTGCAACCTCCGCTGCCCGGG + Intergenic
1072993177 10:100217799-100217821 CACTGCAACCTGCGCCTCCCAGG - Intronic
1073005174 10:100318002-100318024 CACTGCGACCTCCGCCTCCCAGG - Intronic
1073090596 10:100935317-100935339 CACTGCGACCTCCGCCTCCCAGG - Intronic
1073321320 10:102617865-102617887 CACTGAGGCCTGCCCAGCCCTGG - Intronic
1073330407 10:102666851-102666873 CACTGCAACCTGCGCCTCCCAGG - Intergenic
1073416645 10:103389396-103389418 CACTGCAACCTCCGCGTCCCAGG + Intronic
1073542511 10:104325142-104325164 CACTGTGACCTCCGCCTCCCGGG - Intronic
1074147515 10:110729889-110729911 CACTGCGACCTACGCCTCCCAGG + Intronic
1074480841 10:113819148-113819170 CACTGCAACCTCCGCGTCCCAGG + Intergenic
1074576225 10:114672274-114672296 CACTGCAACCTCCGCCGCCCAGG + Intronic
1074860731 10:117508243-117508265 CACTGCAACCTGCGCCTCCCGGG - Intergenic
1075052044 10:119189552-119189574 CACTTGAACCTGGGAGGCCCTGG + Intergenic
1075883023 10:125870759-125870781 CACTGCAACCTGCGCCTCCCGGG - Intronic
1076710450 10:132331123-132331145 CACTGCGACCTCCGCCTCCCAGG - Intronic
1076752006 10:132547973-132547995 CACTGCGACCTCCGCCTCCCAGG + Intronic
1076782865 10:132734067-132734089 CAGAGGTACCTGCGCAGCCCCGG - Intronic
1076922125 10:133459585-133459607 GCCTGGGACCTGCGCGGCGCGGG + Intergenic
1077193678 11:1268052-1268074 CACTGCGACCTCCGCCTCCCAGG + Intergenic
1077387199 11:2275632-2275654 CACAGGGAGCTGTGCTGCCCGGG + Intergenic
1077413294 11:2413385-2413407 CACCAGCACCTGCGAGGCCCAGG + Intronic
1077934234 11:6767149-6767171 CACTGCGACCTCCGCCTCCCAGG + Intergenic
1078437548 11:11338041-11338063 CACTGGGACCTCCGCCTCCCAGG + Intronic
1079233368 11:18669068-18669090 CACTGAAACCTCCGCGTCCCGGG - Intergenic
1079234662 11:18679544-18679566 CACTGCGACCTCCGCCTCCCGGG - Intergenic
1079596937 11:22261587-22261609 CACTGGAACCTCCGCCTCCCAGG - Intronic
1080535535 11:33217961-33217983 CACTGCGACCTCCGCCTCCCAGG - Intergenic
1080807335 11:35665668-35665690 CACTGGAACCTGCGCCTCCCAGG + Intronic
1083022682 11:59523198-59523220 CACTGCAACCTGCGCCTCCCAGG - Intergenic
1083343844 11:61975937-61975959 GGCTGGGACCAGCGCGGCCATGG + Intergenic
1083388177 11:62327909-62327931 CACTGCAACCTCCGCGTCCCGGG - Intergenic
1083432197 11:62619605-62619627 CACTGCAACCTCCGCCGCCCAGG + Intronic
1083555209 11:63620699-63620721 CACTGCAACCTGCGCCTCCCAGG + Intergenic
1083682838 11:64359202-64359224 CGCTGGGGCCCGCGCGGCTCGGG - Exonic
1083792671 11:64996031-64996053 CACTGCGACCTCCGCCTCCCAGG + Intronic
1083941283 11:65897413-65897435 CACTGCAACCTGCGCCTCCCAGG + Intronic
1084209212 11:67613247-67613269 GGCTGGGACCTGCCTGGCCCTGG + Intergenic
1084346004 11:68549380-68549402 CACTGGAACATGCCCTGCCCTGG - Intronic
1084493222 11:69489413-69489435 CACTGCGGCCTGCACTGCCCAGG - Intergenic
1084620166 11:70264483-70264505 CACTGCAACCTCCGCGTCCCGGG + Intergenic
1084635604 11:70390372-70390394 CACTGCGACCTCCGCCTCCCAGG - Intergenic
1085239305 11:75039068-75039090 CACTGCAACCTGCGCCTCCCAGG - Intergenic
1085475180 11:76784486-76784508 CACTGGCCCCTGTGCGGCGCTGG + Intronic
1085605332 11:77892656-77892678 CACTGGAACCTCCGCCTCCCGGG + Intronic
1087569292 11:99904297-99904319 CACTGGGACCTGTCCGGGCTTGG - Intronic
1088327164 11:108612763-108612785 CACTGTGACCTCCGCCTCCCGGG - Intergenic
1088848711 11:113688644-113688666 CACTGGAACCTCCGCCTCCCAGG + Intronic
1088863500 11:113824391-113824413 CACTGTGACCTCCGCCTCCCGGG + Intronic
1089267890 11:117279405-117279427 CACTGCAACCTGCGCCTCCCAGG + Intronic
1089335380 11:117719366-117719388 CACTGCCACCTTCGCCGCCCGGG - Intronic
1089537325 11:119168839-119168861 CACTCGGGCCTGCGGGGTCCTGG - Exonic
1089710179 11:120308861-120308883 CACTGCAACCTGCGCCTCCCGGG - Intronic
1089980394 11:122767200-122767222 CACTGTGACCTCCGCTTCCCGGG - Intronic
1089994230 11:122889832-122889854 CACTGCAACCTGCGCCTCCCGGG + Intronic
1090013491 11:123064842-123064864 CACTGCGACCTCCGCCTCCCAGG + Intergenic
1090014859 11:123077072-123077094 CACTGCAACCTCCGCGTCCCGGG + Intronic
1090145419 11:124316198-124316220 CACTGCAACCTGCGCCTCCCGGG - Intergenic
1090254332 11:125272757-125272779 CACCGGGACCTGTGAGGCACTGG - Intronic
1090286019 11:125500026-125500048 CACTGCAACCTGCGCCTCCCCGG - Intergenic
1091467895 12:701444-701466 CACTGCGACCTCCGCCTCCCGGG - Intergenic
1091499361 12:1000685-1000707 CACTGCAACCTGTGCGTCCCAGG - Intronic
1091524088 12:1279769-1279791 CACTGCAACCTCCGCGTCCCGGG + Intronic
1091674004 12:2474678-2474700 CACTGCAACCTGCGCCTCCCAGG - Intronic
1091898586 12:4124355-4124377 CACTGCGACCTCCGCCTCCCGGG + Intergenic
1091904972 12:4177945-4177967 CACTGCAACCTGCGCCTCCCAGG - Intergenic
1092189108 12:6505139-6505161 CACTGGAACCTCCGCCTCCCCGG + Intronic
1092372887 12:7931955-7931977 CACTGCAACCTGCGCCTCCCAGG + Intronic
1092609342 12:10154883-10154905 CACTGCGACCTCCGCCTCCCGGG - Intergenic
1092863803 12:12742686-12742708 CACTGGAACCTCCGCCTCCCAGG - Intronic
1093455876 12:19364433-19364455 CACTGAGACCTCCGCCTCCCTGG - Intronic
1094012399 12:25823280-25823302 CACTGTGACCTCCGCCTCCCAGG + Intergenic
1094677634 12:32636455-32636477 CACTGACACCTCCGCCGCCCAGG - Intronic
1094750757 12:33404465-33404487 CACTGCGACCTCCGCCTCCCGGG + Intronic
1095379159 12:41568878-41568900 CACTGGAACCTCCGCCTCCCGGG + Intronic
1095575696 12:43735850-43735872 CACTGTGACCTCCGCCTCCCAGG + Intronic
1095607403 12:44086287-44086309 CACTGCAACCTGCGCCTCCCAGG + Intronic
1095842616 12:46710444-46710466 CACTGGAACCTCCGCTTCCCAGG - Intergenic
1095910061 12:47416978-47417000 CACTGCAACCTCCGCCGCCCAGG - Intergenic
1096271369 12:50168186-50168208 CACTGCGACCTCCGCCTCCCAGG - Intergenic
1096330462 12:50707844-50707866 CACTGGGATCTGCCCTGGCCTGG + Intronic
1096419845 12:51447790-51447812 CACTGCAACCTCCGCCGCCCAGG + Intronic
1096625353 12:52892070-52892092 CACTGCAACCTCCGCTGCCCAGG - Intergenic
1097258666 12:57700017-57700039 CACTGCGACCTCCGCCTCCCGGG - Intronic
1097448344 12:59704122-59704144 CACTGGAACCTGTGCCTCCCAGG - Intronic
1097807775 12:63984938-63984960 CACTGCAACCTCCGCCGCCCAGG - Intronic
1097939507 12:65288225-65288247 CACTGGAACCTCCGCCTCCCGGG - Intronic
1098383074 12:69889779-69889801 CACTGCGACCTCCGCCTCCCGGG - Intronic
1098957240 12:76700217-76700239 CACTGCGACCTCCGCTGTCCAGG + Intergenic
1099215093 12:79843777-79843799 CACTGCGACCTCCGCCTCCCGGG + Intronic
1099594834 12:84647810-84647832 CACTGCAACCTCCGCCGCCCGGG + Intergenic
1099989794 12:89709438-89709460 GACTGGGAGCTGAGCGGCACTGG + Intergenic
1100502534 12:95187575-95187597 CACTGGAACCTCCGCCTCCCAGG - Intronic
1100901392 12:99244928-99244950 CACTGCAACCTCCGCCGCCCAGG + Intronic
1100956121 12:99910277-99910299 CACTGCGACCTCCGCCTCCCTGG - Intronic
1101731584 12:107431531-107431553 CACTGCAACCTCCGCCGCCCAGG - Intronic
1101918597 12:108915095-108915117 CACTGTGACCTCCGCCTCCCAGG - Intronic
1101934462 12:109046174-109046196 CACTGGAACCTCCGCCCCCCCGG + Intronic
1102106480 12:110328491-110328513 CACTGCAACCTCCGCTGCCCAGG - Intronic
1102107783 12:110340460-110340482 CACTGCGACCTCCGCCTCCCAGG - Intronic
1102573440 12:113841497-113841519 CACTGCAACCTCCGCGTCCCGGG + Intronic
1103390288 12:120567623-120567645 CACTGAGACCTCCGCCTCCCAGG - Intronic
1103391256 12:120575158-120575180 CACTGTGACCTGTGCCTCCCAGG - Intronic
1103771863 12:123333046-123333068 CACTGGAACCTCCGCCTCCCAGG - Intronic
1103888186 12:124218596-124218618 CACTGCGACCTCCGCCTCCCGGG + Intronic
1104222041 12:126794605-126794627 CACTGCGACCTCCGCCTCCCAGG + Intergenic
1104697541 12:130874896-130874918 CACTGCGACCTCCGCCTCCCGGG + Intronic
1104864627 12:131945570-131945592 CACTGCAACCTGCGCCTCCCGGG + Exonic
1104986927 12:132602696-132602718 CACTGGGCTCTGCGCGGCTGGGG - Intergenic
1104992525 12:132634150-132634172 CAGTGGGGGCTGCGCAGCCCTGG + Intronic
1105239670 13:18598342-18598364 CACTGGGAACTGTGCAGCCAAGG + Intergenic
1105363161 13:19739657-19739679 CACTGGGACCTGGGAGGCAGAGG + Intronic
1105404332 13:20120933-20120955 CACTGCAACCTACGCCGCCCGGG + Intergenic
1105550959 13:21395575-21395597 CACTGGAACCTCCGCCTCCCGGG + Intronic
1107319226 13:39167981-39168003 CACTGCAACCTCCGCGTCCCAGG + Intergenic
1107645120 13:42486120-42486142 CACTGCGACCTCCGCCTCCCGGG - Intergenic
1107947721 13:45434518-45434540 CACTGGAACCTCCGCCTCCCAGG - Intergenic
1108089284 13:46829770-46829792 CACTGTGACCTCCGCCTCCCAGG - Intergenic
1108260504 13:48651216-48651238 CACTGCAACCTGCGCCTCCCGGG + Intergenic
1108608307 13:52062494-52062516 CACTGCAACCTCCGCCGCCCAGG + Intronic
1108807441 13:54176224-54176246 CACTGCTACCTGCGCCTCCCTGG - Intergenic
1109104902 13:58238924-58238946 CACAGGGACCTGCGCAAGCCTGG + Intergenic
1109840175 13:67909335-67909357 CACTGCAACCTCCGCGTCCCAGG - Intergenic
1110456583 13:75696277-75696299 CACTGCAACCTGCGCCTCCCAGG - Intronic
1111590893 13:90348053-90348075 CACTGCAACCTTCGCGTCCCAGG + Intergenic
1112002342 13:95222466-95222488 CACTGGCATCTGCATGGCCCTGG + Intronic
1112016185 13:95333301-95333323 CACTGGAACCTCCGCTTCCCTGG + Intergenic
1112210692 13:97374467-97374489 CACTGCAACCTGCGCCTCCCAGG + Intronic
1112473329 13:99709015-99709037 CACTGGAACCTCCGCCCCCCTGG - Intronic
1112562560 13:100527039-100527061 AACTGGGAACAGCTCGGCCCTGG - Intronic
1112638173 13:101241516-101241538 CACTGGGACCTCTGCCTCCCAGG + Intronic
1112793941 13:103033621-103033643 CACTGGAACCTCCGCCTCCCTGG - Intergenic
1112818792 13:103306411-103306433 CACTGTGACCTCCGCCTCCCAGG + Intergenic
1113052327 13:106227863-106227885 CACTGGAACCTCCGCCTCCCAGG - Intergenic
1113456043 13:110449746-110449768 CAGGGGGACCTGGGAGGCCCGGG - Exonic
1113748729 13:112764249-112764271 CTCTGACACCTGCGGGGCCCCGG + Intronic
1113762039 13:112855275-112855297 CACTGTGACCTCCGCCTCCCAGG + Intronic
1113872202 13:113566197-113566219 CACAGAGACCTGCAGGGCCCTGG + Intergenic
1114065043 14:19053416-19053438 CACTGGGAACTGTGCAGCCAAGG + Intergenic
1114097218 14:19346586-19346608 CACTGGGAACTGTGCAGCCAAGG - Intergenic
1114248521 14:20936869-20936891 CACTGGAACCTCCGCCTCCCAGG + Intergenic
1114857339 14:26465248-26465270 CACTGGAACCTCCGCCTCCCGGG + Intronic
1114864955 14:26579131-26579153 CACTGGAACCTCCGCCTCCCAGG + Intronic
1115080111 14:29440434-29440456 CACTGCGACCTCCGCCTCCCAGG + Intergenic
1115397754 14:32928577-32928599 CACTGCGACCTCCGCCTCCCCGG + Intergenic
1115546916 14:34472213-34472235 CACTGCAACCTCCGCCGCCCGGG + Intergenic
1115548769 14:34487031-34487053 CACTGGAACCTCCGCCTCCCAGG + Intergenic
1116374629 14:44183245-44183267 CACTGCGACCTCCGCCTCCCGGG - Intergenic
1116905024 14:50396108-50396130 CACTGCAACCTGCGCCTCCCAGG - Intronic
1116912643 14:50487230-50487252 CACTGCGACCTCCGCCTCCCAGG - Intronic
1116933879 14:50717334-50717356 CACTGCAACCTGCGCCTCCCAGG - Intergenic
1116935544 14:50736206-50736228 CACTGCAACCTGCGCTTCCCAGG + Intronic
1117419026 14:55525360-55525382 CACTGGAACCTCCGCCTCCCAGG + Intergenic
1117679581 14:58189955-58189977 CACTGCAACCTCCGCGTCCCAGG - Intronic
1117863066 14:60113442-60113464 CACTGGAACCTCCGCCTCCCAGG + Intronic
1118053919 14:62058431-62058453 CACTGCAACCTCCGCGTCCCAGG + Intronic
1118267942 14:64313456-64313478 CACTGGAACCTCCGCCTCCCAGG - Intronic
1118585509 14:67348595-67348617 CACTGGAACCTCCGCTTCCCGGG + Intronic
1118682145 14:68253005-68253027 CACTGCAACCTCCGCCGCCCAGG - Intronic
1118854764 14:69612058-69612080 CAGTGGGGGCTGCGCGGCCGGGG + Intronic
1119252431 14:73168277-73168299 CACTGTAACCTCCGCCGCCCAGG - Intronic
1119283830 14:73434016-73434038 CACTGTGACCTCCGCCTCCCAGG - Intronic
1119312531 14:73661086-73661108 CACTGCGACCTCCGCCTCCCAGG - Intronic
1119313323 14:73669350-73669372 CACTGTGACCTCCGCCTCCCGGG + Intronic
1119451748 14:74717948-74717970 CACTGCGACCTCCGCCTCCCAGG + Intronic
1119454673 14:74744668-74744690 CACTGCAACCTGCGCCACCCAGG + Intergenic
1119735622 14:76979944-76979966 CACTGCAACCTCCGCGTCCCAGG + Intergenic
1119737545 14:76993187-76993209 CACTGCAACCTCCGCGTCCCGGG + Intergenic
1120108813 14:80528362-80528384 CACTGCAACCTCCGCCGCCCTGG + Intronic
1120467790 14:84883651-84883673 CACTGCAACCTCCGCGTCCCAGG - Intergenic
1120568637 14:86090820-86090842 CACTGCAACCTGCGCCACCCAGG + Intergenic
1120801794 14:88698339-88698361 CACTGCGACCTCCGCCTCCCAGG + Intronic
1120917666 14:89723831-89723853 CACTGCGACCTCCGCCTCCCAGG - Intergenic
1121677101 14:95762385-95762407 CACTGCGACCTCCGCTTCCCTGG - Intergenic
1122213654 14:100189218-100189240 CACTGGAACCTCCGCCTCCCCGG - Intergenic
1122247388 14:100413487-100413509 CACTGCGACCTCCGCCTCCCGGG + Intronic
1122550591 14:102547060-102547082 CACTGGCACCTCCGCCTCCCAGG - Intergenic
1122770569 14:104095879-104095901 CCCTGGGAGCTGTGAGGCCCTGG + Intronic
1123155225 14:106218389-106218411 CAGTGGGTCCTGAGCGCCCCCGG + Intergenic
1123698928 15:22900472-22900494 CACTGCAACCTCCGCTGCCCGGG + Intronic
1124430511 15:29603712-29603734 CACTGCAACCTCCGCCGCCCGGG + Intergenic
1124916101 15:33975852-33975874 CACTGTAACCTCCGCTGCCCGGG - Intronic
1125291013 15:38146754-38146776 CACTGGGGCCTGCGCGGGTAAGG + Intergenic
1125569415 15:40704435-40704457 CACTGCAACCTCCGCCGCCCGGG + Intronic
1125622311 15:41074818-41074840 CACTGCGACCTCCGCCTCCCGGG + Intronic
1125626619 15:41114631-41114653 CACTGCGACCTCCGCCTCCCAGG - Intronic
1125806405 15:42497282-42497304 CACTGCGACCTCCGCCTCCCAGG + Intronic
1125818874 15:42610622-42610644 CACTGCAACCTCCGCCGCCCGGG + Intronic
1125978077 15:43973441-43973463 CACTGGAACCTCCGCCTCCCAGG + Intronic
1126037449 15:44559629-44559651 CACTGCAACCTGCGCCTCCCGGG - Intronic
1126458071 15:48886179-48886201 CACTGTGACCTCCGCCTCCCAGG - Intronic
1126495035 15:49280910-49280932 CACTGCAACCTCCGCTGCCCAGG + Intronic
1126605462 15:50471974-50471996 CACTGCAACCTCCGCGTCCCAGG + Intronic
1126614723 15:50565905-50565927 CACTGGGACCTGGGAGGCAGAGG - Intronic
1127067762 15:55257989-55258011 CACTGCAACCTGCGCCTCCCAGG - Intronic
1127085272 15:55418990-55419012 CACTGCGACCTCCGCCTCCCAGG + Intronic
1127403535 15:58615930-58615952 CACTGCAACCTGCGCCTCCCGGG - Intronic
1127459165 15:59182286-59182308 CACTGCAACCTGCGCCTCCCGGG + Intronic
1127833679 15:62772736-62772758 CACTGCAACCTCCGCGTCCCGGG + Intronic
1128184356 15:65631905-65631927 CACTGCAACCTCCGCGTCCCAGG + Intronic
1128385279 15:67143508-67143530 CACTGGAACCTCCGCCTCCCAGG + Intronic
1128510153 15:68308665-68308687 CACTGCGACCTCCGCCTCCCGGG - Intronic
1128634010 15:69291403-69291425 CACTGTGACCTCCGCCTCCCCGG + Intergenic
1128681413 15:69654854-69654876 CACTGCGACCTCCGCCTCCCGGG + Intergenic
1129292912 15:74582241-74582263 CACTGCAACCTCCGCCGCCCGGG + Intronic
1129307941 15:74682244-74682266 CACTGCAACCTGCGCCTCCCAGG - Intronic
1129433518 15:75519182-75519204 CACTGCAACCTCCGCCGCCCGGG + Intronic
1129613639 15:77081568-77081590 CACTGGAACCTCCGTGTCCCAGG - Intronic
1130271082 15:82448009-82448031 CACTGGAACCTCTGCTGCCCAGG + Intergenic
1130321180 15:82843366-82843388 CACTGCAACCTGCGCCTCCCGGG - Intronic
1130463420 15:84175358-84175380 CACTGGAACCTCTGCTGCCCAGG + Intronic
1130474273 15:84249755-84249777 CACTGGAACCTCTGCTGCCCAGG + Intergenic
1130481687 15:84363817-84363839 CACTGGAACCTCTGCTGCCCAGG + Intergenic
1130489252 15:84419436-84419458 CACTGGAACCTCTGCTGCCCAGG - Intergenic
1130500845 15:84498184-84498206 CACTGGAACCTCTGCTGCCCAGG - Intergenic
1130997947 15:88914467-88914489 CACTGGGACCTCTGCCGCCTGGG - Intergenic
1131085221 15:89570222-89570244 CACTGCAACCTCCGCTGCCCAGG + Intergenic
1131134587 15:89924062-89924084 CACTGCAACCTGCGCCTCCCAGG - Intergenic
1131239065 15:90722509-90722531 CACTGCAACCTCCGCTGCCCAGG - Intronic
1131260255 15:90884244-90884266 CCCTGGGGCCTGCGGGGCGCGGG + Intronic
1131321349 15:91395267-91395289 CACTGCGACCTCCGCCTCCCTGG + Intergenic
1131390664 15:92045202-92045224 CACTGGAACCTCCGCCTCCCAGG - Intronic
1132014245 15:98301718-98301740 CACTGAAACCTGCGCCTCCCAGG - Intergenic
1132400800 15:101503714-101503736 CACTGGGAACTCCGCCTCCCAGG - Intronic
1132820389 16:1864562-1864584 CACTGCAACCTGCGCCTCCCAGG + Intronic
1132876088 16:2138257-2138279 CACTGCGACCTCCGCCTCCCGGG - Intergenic
1133006048 16:2882538-2882560 CACAGGGAGCTGTGGGGCCCTGG - Intergenic
1133019119 16:2958897-2958919 CACTGCGACCTCCGCCTCCCAGG - Intergenic
1133257724 16:4527890-4527912 CACTGCGACCTCCGCCTCCCGGG + Intronic
1133731075 16:8578901-8578923 CACTGTGACCTCCGCCTCCCAGG - Intronic
1133769577 16:8859899-8859921 CACTGGAACCTCCGCCTCCCAGG - Intronic
1134177373 16:12018505-12018527 CACTGCAACCTGCGCCTCCCAGG - Intronic
1134177778 16:12022274-12022296 CACTGCGACCTCCGCCTCCCGGG + Intronic
1134274827 16:12766691-12766713 CACTGCAACCTGCGCCCCCCTGG - Intronic
1134324891 16:13198107-13198129 CACTGTGACCTCCGCCTCCCAGG - Intronic
1134325880 16:13207186-13207208 CACTGCAACCTCCGCGTCCCAGG - Intronic
1134528640 16:14964630-14964652 CACTGGAACCTGGGAGGCACAGG - Intergenic
1134630357 16:15751872-15751894 CACTGCAACCTGCGCCTCCCAGG + Intronic
1134647190 16:15878570-15878592 CACTGCAACCTCCGCTGCCCAGG + Intronic
1134655551 16:15945986-15946008 CACTGCAACCTGCGCCTCCCAGG + Intergenic
1135002765 16:18790621-18790643 CACTGCAACCTGCGCCTCCCGGG + Intronic
1135175967 16:20229414-20229436 CACTGCAACCTCCGCGTCCCAGG - Intergenic
1135322058 16:21503521-21503543 CACTGGGAGCTCCGCCTCCCGGG - Intergenic
1135375318 16:21941670-21941692 CACTGGAACCTCCGCCTCCCCGG - Intergenic
1135412829 16:22248138-22248160 CACTGTGACCTCCGCCTCCCGGG + Intronic
1135769535 16:25206717-25206739 CACTGCAACCTGCGCCTCCCGGG + Intergenic
1135774348 16:25243401-25243423 CACTGCAACCTGCGCCTCCCAGG + Intronic
1135972855 16:27084943-27084965 CACAGGGACCTGCTCTGCCCAGG - Intergenic
1136011500 16:27366382-27366404 CACTGCAACCTCCGCGTCCCAGG - Intergenic
1136090810 16:27918581-27918603 CACTGTGACCTCCGCCTCCCAGG - Intronic
1136333534 16:29596648-29596670 CACTGGGAGCTCCGCCTCCCGGG - Intergenic
1136427542 16:30179080-30179102 CACTGTGACCTGCGCCTCCTAGG - Intergenic
1137303062 16:47172410-47172432 CACTGCAACCTGCGCCTCCCAGG - Intronic
1137339079 16:47581753-47581775 CACTGCGACCTCCGCCTCCCGGG + Intronic
1138721263 16:59083197-59083219 CACTGCAACCTGCGCCTCCCAGG + Intergenic
1139753953 16:69127988-69128010 CACTGCAACCTCCGCTGCCCAGG + Intronic
1139952759 16:70680088-70680110 CGCTGGGGCCTGCGCAGTCCCGG + Intronic
1139974785 16:70800944-70800966 CCCTGGCCCCGGCGCGGCCCCGG - Exonic
1140097248 16:71884931-71884953 CACTGCAACCTGCGCCTCCCAGG + Intronic
1140388966 16:74568491-74568513 CACTGGAACCTCCGCCTCCCGGG + Intronic
1140481653 16:75265690-75265712 CACTGGGGCCTCCTCGGCCCCGG - Intronic
1140724150 16:77797185-77797207 CACTGCAACCTGCGCCTCCCAGG + Intronic
1140792555 16:78406426-78406448 CACTGTAACCTCCGCCGCCCGGG + Intronic
1141400415 16:83742250-83742272 TACTGGGGCCTGCGCCACCCTGG - Intronic
1141529382 16:84635610-84635632 CACTGCAACCTGCGCCTCCCAGG - Intergenic
1141560391 16:84863879-84863901 CACTGCAACCTCCGCCGCCCGGG - Intronic
1141635518 16:85312024-85312046 CTCTGGGACCAGGGTGGCCCAGG + Intergenic
1141661502 16:85444058-85444080 CACTGCGACCTCCGCCTCCCGGG + Intergenic
1141683294 16:85556383-85556405 CCCTGGGTCCCGCGCGGCGCCGG + Intergenic
1141927930 16:87181542-87181564 CACTGCGACCTCCGCCTCCCGGG + Intronic
1142222692 16:88863490-88863512 CACGGGGATCTGCGGGGCTCTGG - Exonic
1142381873 16:89737443-89737465 CACTGCAACCTGCGCCTCCCAGG - Intronic
1142389256 16:89787947-89787969 CACTGCAACCTGCGCGTTCCGGG + Intronic
1142692120 17:1612894-1612916 CACTGCAACCTCCGCGTCCCAGG - Intronic
1142752254 17:1996034-1996056 CCCTGGGCCCTGCCCTGCCCTGG + Intronic
1142783947 17:2205142-2205164 CACTGCAACCTCCGCGTCCCAGG + Intronic
1142895065 17:2970196-2970218 CACTGCAACCTGCGCATCCCGGG - Intronic
1143085143 17:4410491-4410513 CACTGCGACCTCCGCCTCCCGGG + Intergenic
1143235179 17:5393510-5393532 CACTGCAACCTGTGCTGCCCGGG + Intronic
1143374088 17:6457281-6457303 CACAGGGAACTGTGGGGCCCTGG - Intronic
1143510990 17:7394826-7394848 CCCAGGGGCCAGCGCGGCCCGGG - Exonic
1143596181 17:7915701-7915723 TCCTGGGGCCTGCGCGGCGCTGG - Intergenic
1143616640 17:8055322-8055344 CACTGCAACCTCCGCGTCCCGGG + Intergenic
1143636942 17:8170295-8170317 CACTGCAACCTCCGCGTCCCAGG - Intergenic
1143679697 17:8467169-8467191 TACTGGGCCCTGCCCAGCCCCGG + Exonic
1143873288 17:9973327-9973349 CACTGCGACCTCCGCCTCCCGGG + Intronic
1143898395 17:10155088-10155110 CACTGCGACCTCCGCCTCCCGGG + Intronic
1143962296 17:10730541-10730563 CACTGCAACCTCCGCCGCCCGGG - Intergenic
1144162194 17:12570649-12570671 CACTGCGACCTCCGCCTCCCAGG + Intergenic
1144486923 17:15674292-15674314 CACTGTGACCTCCGCCTCCCAGG - Intronic
1144495711 17:15743495-15743517 CACTGGGACCTGCCACCCCCAGG + Exonic
1144540829 17:16140736-16140758 CACTGCAACCTCCGCGTCCCAGG - Intronic
1144638487 17:16925329-16925351 CACTGGGACCTGCCATCCCCAGG - Intergenic
1144676651 17:17166432-17166454 CACTAGGACCTTCCTGGCCCAGG - Intronic
1144914103 17:18708010-18708032 CACTGTGACCTCCGCCTCCCAGG + Intronic
1145208422 17:20996614-20996636 CACTGGGACCTGCCACCCCCAGG + Intergenic
1146042610 17:29471353-29471375 CACTGCGACCTTCGCCTCCCGGG + Intronic
1146087393 17:29842376-29842398 CACTGCAACCTGCGCCTCCCAGG - Intronic
1146195146 17:30805636-30805658 CACTGGAACCTTCGCCTCCCGGG - Intronic
1146362835 17:32192745-32192767 CACTGCAACCTCCGCTGCCCGGG + Intronic
1146892870 17:36518012-36518034 CACTGCAACCTGCGCCTCCCGGG - Intronic
1147012679 17:37463875-37463897 CACTGCGACCTCCGCCTCCCGGG - Intronic
1147164012 17:38583974-38583996 CCCTCGGACCTGAGCAGCCCAGG + Intronic
1147230758 17:39016074-39016096 CACTGCAACCTCCGCGTCCCGGG - Intergenic
1147231797 17:39024973-39024995 CACTGAGACCTCCGCCTCCCGGG + Intergenic
1147334510 17:39719183-39719205 CACTGCAACCTCCGCTGCCCAGG - Intronic
1147569386 17:41559109-41559131 CACTGCAACCTCCGCGTCCCAGG + Intergenic
1147784856 17:42972110-42972132 CACTGCGACCTCCGCCTCCCAGG - Intronic
1147809119 17:43154406-43154428 CACTGCAACCTGCGCCTCCCAGG - Intergenic
1148295755 17:46501249-46501271 CACTGCGACCTCCGCCTCCCGGG + Intergenic
1148428936 17:47626035-47626057 CACTGTGACCTGCGCCTCCCGGG - Intergenic
1148634751 17:49140174-49140196 CACTGCGACCTCCGCCTCCCAGG + Intronic
1148701093 17:49587378-49587400 CACTGCGACCTCCGCCTCCCGGG - Intergenic
1148768696 17:50054876-50054898 CACTGCAACCTGCGCCTCCCGGG + Intergenic
1148825498 17:50390414-50390436 CACTGCAACCTGCGCCTCCCGGG - Intronic
1149180238 17:53927739-53927761 CACTGCAACCTGCGCCTCCCAGG + Intergenic
1149773791 17:59341581-59341603 CACTGCAACCTGCGCCTCCCAGG - Intronic
1149919499 17:60643303-60643325 CACTGCAACCTGCGCCTCCCAGG - Intronic
1150014850 17:61543903-61543925 CACTGCAACCTGCGCCTCCCAGG + Intergenic
1150059932 17:62058443-62058465 CACTGCGACCTCCGCCTCCCAGG - Intronic
1150079029 17:62220105-62220127 CACTGTGACCTCCGCCTCCCAGG + Intergenic
1150315165 17:64163066-64163088 CACAGGGCCCTGCTCAGCCCTGG + Intronic
1150381885 17:64727397-64727419 CACTGAGACCTCCGCTTCCCAGG + Intergenic
1150384630 17:64748841-64748863 CACTGCAACCTCCGCCGCCCAGG + Intergenic
1150419250 17:65016435-65016457 CACTGCAACCTGCGCCTCCCAGG + Intronic
1150823030 17:68450966-68450988 CACTGGGCCCGGCGCAGGCCAGG + Intronic
1151002132 17:70389721-70389743 CACTGCAACCTGCGCCTCCCAGG - Intergenic
1151124862 17:71833390-71833412 CACTGCGACCTCCGCCTCCCAGG - Intergenic
1151183761 17:72348946-72348968 CACTGGAACCTCCGCCTCCCGGG - Intergenic
1151315638 17:73320456-73320478 CACTGGAACCTCCGCCTCCCAGG - Intergenic
1151410392 17:73922706-73922728 CACTGCGACCTCCGCCTCCCAGG + Intergenic
1151590855 17:75043535-75043557 CACTGCAACCTCCGCCGCCCAGG - Intronic
1151609021 17:75158967-75158989 CACTGCAACCTGCGCCACCCAGG - Intronic
1151762654 17:76114791-76114813 CACTGCGACCTCCGCCTCCCAGG - Intronic
1152203476 17:78960655-78960677 CACTGGAACCTCCGCCTCCCAGG - Intergenic
1152245276 17:79182190-79182212 CACTGGGCCCTGCAGGCCCCAGG + Intronic
1152254000 17:79226926-79226948 CTCTGGGACCTGCCAGGCCTGGG + Intronic
1152315762 17:79579480-79579502 CCCTGGGACCTGCTCGGGGCAGG + Intergenic
1152697629 17:81804701-81804723 CGGTGGCACCGGCGCGGCCCAGG + Intronic
1153245864 18:3072427-3072449 CACTGCGACCTCCGCCTCCCAGG + Intronic
1153636156 18:7115901-7115923 CACTGCGACCTCCGCCTCCCGGG - Intronic
1154169077 18:12037881-12037903 CACTGCAACCTGCGCCTCCCAGG - Intergenic
1154222227 18:12466350-12466372 CACTGCGACCTCCGCCTCCCGGG + Intronic
1154267738 18:12893692-12893714 CACTGCGACCTCCGCCTCCCAGG - Intronic
1154358910 18:13643009-13643031 CACTGCAACCTCCGCGTCCCAGG + Intronic
1154449159 18:14460432-14460454 CACTGGGAACTGTGCAGCCAAGG - Intergenic
1154967403 18:21373407-21373429 CACTGCAACCTCCGCGTCCCAGG + Intronic
1154976502 18:21462523-21462545 CACTGTGACCTCCGCTTCCCAGG + Intronic
1155185276 18:23382162-23382184 CACTGTAACCTACGCTGCCCGGG - Intronic
1155454205 18:25993690-25993712 CACTGCGACCTCCGCCTCCCAGG - Intergenic
1155473393 18:26213764-26213786 CACTGCAACCTCCGCGTCCCAGG - Intergenic
1156271046 18:35532250-35532272 CACTGTAACCTCCGCCGCCCAGG - Intergenic
1157242672 18:46025828-46025850 CACTGCGACCTCCGCCTCCCGGG + Intronic
1157515022 18:48304597-48304619 CACTGCAACCTCCGCTGCCCGGG - Intronic
1157658706 18:49419281-49419303 CACTGCGACCTCCGCCTCCCAGG - Intronic
1158177846 18:54677553-54677575 CACTGTGACCTCCGCCTCCCAGG - Intergenic
1158599210 18:58842661-58842683 CACTGCGACCTCCGCCTCCCTGG - Intergenic
1158927628 18:62285211-62285233 CACTGCAACCTGCGCCTCCCTGG + Intronic
1158944455 18:62436579-62436601 CACTGCGACCTCCGCCTCCCGGG - Intergenic
1158993300 18:62892162-62892184 CACTGTGACCTCCGCCTCCCAGG + Intronic
1159205732 18:65249592-65249614 CACTGCAACCTCCGCGTCCCGGG + Intergenic
1159981504 18:74786879-74786901 CACTGTGACCTCCGCCTCCCGGG + Intronic
1160248252 18:77178151-77178173 CACTGCAACCTCCGCGTCCCAGG + Intergenic
1160803955 19:983365-983387 CACTGAGACCTCCGCCTCCCGGG + Intergenic
1160885517 19:1345327-1345349 CACTGTGACCTCCGCCTCCCAGG + Intergenic
1160956118 19:1692479-1692501 CACTGCAACCTCCGCGTCCCGGG + Intergenic
1160997410 19:1889549-1889571 CACTGTGACCTCTGCCGCCCTGG - Intergenic
1161029610 19:2051531-2051553 CCGTGGGACCTGCGAGGCCCTGG + Intergenic
1161318148 19:3627968-3627990 CACTGCGACCTCCGCCTCCCAGG - Intergenic
1161512222 19:4678186-4678208 CACTGGAACCTCCGCCTCCCAGG + Intronic
1161549978 19:4907343-4907365 CACTGGAACCTCCGCTTCCCAGG + Intronic
1161593701 19:5140657-5140679 CACTGCAACCTCCGCCGCCCAGG - Intronic
1161629865 19:5348374-5348396 CACTGCGACCTCCGCCTCCCAGG - Intergenic
1161759713 19:6162188-6162210 CACTGGAACCTCCGCCTCCCGGG - Intronic
1162217613 19:9149394-9149416 CACTGCAACCTGCGCCTCCCGGG - Intronic
1162250088 19:9435359-9435381 CAGGAGGACCCGCGCGGCCCCGG + Intronic
1162460095 19:10809823-10809845 CCCTGGGAGCAGCGAGGCCCTGG - Intronic
1162535073 19:11258506-11258528 CACTGCAACCTCCACGGCCCGGG + Intronic
1162679458 19:12329395-12329417 CACTGCAACCTGCGCTTCCCGGG - Intronic
1162734997 19:12741841-12741863 CACTGTGACCTCCGCCTCCCAGG - Intronic
1162900735 19:13794363-13794385 CACTGCAACCTGCGCCTCCCGGG - Intergenic
1162934019 19:13971928-13971950 CACTGCGACCTCCGCCTCCCGGG - Intronic
1163114159 19:15179187-15179209 CAATGGCACCTGCGTGGACCTGG - Exonic
1163245907 19:16094038-16094060 CACTGCAACCTGCGCCTCCCGGG + Intronic
1163457190 19:17414203-17414225 CACTGTGACCTCCGCCTCCCGGG - Intronic
1163554125 19:17982962-17982984 CACTGCAACCTCCGCGTCCCAGG - Intronic
1163622726 19:18370343-18370365 CACTGTGACCTCCGCCTCCCGGG - Intergenic
1164209672 19:23088092-23088114 CACTGGAACCTCCGCCTCCCGGG + Intronic
1164243604 19:23411239-23411261 CACTGCAACCTGCGCCTCCCAGG - Intergenic
1164310938 19:24045590-24045612 CACTGCAACCTCCGCGTCCCGGG - Intronic
1164985884 19:32648188-32648210 CACTGCAACCTGCGCCTCCCAGG - Intronic
1165176205 19:33931740-33931762 CACTGGGACCTCTGCTTCCCAGG + Intergenic
1165194396 19:34090312-34090334 CACTGTGACCTCCGCCTCCCGGG - Intergenic
1165438483 19:35810181-35810203 CACTGCGACCTCCGCCTCCCGGG - Intronic
1165471674 19:36007939-36007961 CACTGGGACCTGGGAGGCGGAGG + Intronic
1165616780 19:37209178-37209200 CACTGCGACCTCCGCCTCCCAGG + Intronic
1165868208 19:38952024-38952046 CACTGCGACCTCCGCCTCCCGGG + Intronic
1165988877 19:39794503-39794525 CACTGCGATCTGCGCCTCCCGGG + Intergenic
1166048813 19:40245888-40245910 CACTGGGCCCTGCTGCGCCCTGG - Intronic
1166138278 19:40790755-40790777 CACTGCGACCTCCGCCTCCCGGG + Intronic
1166199525 19:41227559-41227581 CACTGCAACCTCCGCAGCCCGGG + Intronic
1166286597 19:41834030-41834052 CACTGCAACCTGCGCCTCCCGGG - Intergenic
1166311312 19:41964340-41964362 CACTGGAACCTCCGCCTCCCGGG + Intergenic
1166530649 19:43541309-43541331 CACTGCAACCTCCGCCGCCCGGG + Intergenic
1166554987 19:43692869-43692891 CACTGCGACCTCCGCCTCCCGGG - Intergenic
1166572357 19:43805581-43805603 CACTGGAACCTCCGCCTCCCAGG + Intronic
1166579889 19:43886572-43886594 CACTGCAACCTGCGCCTCCCAGG - Intronic
1166877989 19:45909658-45909680 CACTGCAACCTGCGCCTCCCAGG + Intergenic
1167050234 19:47073494-47073516 CACTGGAACCTCCGCCTCCCAGG - Intronic
1167180327 19:47898377-47898399 CACTGCGACCTCCGCTTCCCGGG + Intergenic
1167272142 19:48511651-48511673 CATGGGGACCCGCGCGACCCTGG + Intronic
1167316870 19:48768885-48768907 CACTGGAACCTCCGCCTCCCGGG + Intergenic
1167458907 19:49614031-49614053 CACTGCGACCTCCGCCTCCCGGG - Intronic
1167566443 19:50260347-50260369 CACTGCGACCTCCGCCTCCCAGG - Intronic
1167865026 19:52318180-52318202 CACTGGTACCTGCGCCTCCCAGG + Intronic
1168028970 19:53664720-53664742 CACTGTGACCTCCGCCCCCCAGG - Intergenic
1168065655 19:53918842-53918864 CACTGCAACCTCCGCGTCCCAGG + Intronic
1168106159 19:54166875-54166897 CACTGCAACCTCCGCCGCCCGGG - Intronic
1168279153 19:55294875-55294897 CACTGCAACCTACGCCGCCCGGG + Intronic
1168286645 19:55338264-55338286 CACTGCAACCTCCGCCGCCCAGG - Intergenic
1168613833 19:57821907-57821929 CACTGGAACCTCCGCCTCCCGGG + Intronic
1168698731 19:58421991-58422013 CACTGCAACCTCCGCGTCCCGGG + Intergenic
925367084 2:3317931-3317953 CACTGTGAACTGGGTGGCCCAGG - Intronic
925733782 2:6942906-6942928 CACTGCGACCTCCGCCTCCCAGG - Intronic
925743454 2:7025594-7025616 CACTGCAACCTGCGCCTCCCAGG - Intronic
925794460 2:7527242-7527264 CACTGCAACCTCCGCTGCCCAGG - Intergenic
926042314 2:9683418-9683440 CACTGGAACCTCCGCCTCCCGGG + Intergenic
926125188 2:10267631-10267653 CCCTGGGAGCTGGGGGGCCCAGG + Intergenic
926171212 2:10553650-10553672 CACTGCGACCTCCGCCTCCCGGG - Intergenic
926187869 2:10705828-10705850 CACTGGAACCTGGGCGGCGGAGG - Intergenic
926194475 2:10754299-10754321 CACTGCAACCTCCGCCGCCCGGG + Intronic
926197250 2:10771525-10771547 CTCAGTGACCTGCGCTGCCCTGG - Intronic
926480437 2:13386541-13386563 CACTGCAACCTGCGCCTCCCGGG + Intergenic
926832174 2:16975876-16975898 CACTGCGACCTTCGCCTCCCGGG + Intergenic
927232459 2:20837513-20837535 CACTGCAACCTGCGCCTCCCGGG + Intergenic
927692233 2:25216229-25216251 GCCTGGGACCTGCGGGCCCCAGG + Intergenic
927726422 2:25427100-25427122 CACTGGAACCTCCGCCTCCCAGG - Intronic
927763909 2:25786314-25786336 CACTGGAACCTCCGCCTCCCAGG + Intronic
927796784 2:26056272-26056294 CACTGCAACCTGCGCCTCCCGGG + Intronic
928131704 2:28656476-28656498 CACTGCAACCTGCGCCTCCCAGG + Intergenic
928153968 2:28858968-28858990 CACTGGAACCTCCGCCTCCCAGG + Intronic
928587811 2:32779145-32779167 CACTGCGACCTCCGCCTCCCAGG - Intronic
929189529 2:39126333-39126355 CACTGCAACCTCCGCGTCCCAGG + Intergenic
929227784 2:39528118-39528140 CACTGCGACCTCCGCCTCCCAGG + Intergenic
929588796 2:43132274-43132296 CACTGGGAATTGAGCGCCCCAGG - Intergenic
929656603 2:43738965-43738987 CACTGGAACCTCCGCCTCCCGGG + Intronic
930195012 2:48500831-48500853 CACTGCGACCTCCGCCTCCCAGG - Intronic
930640666 2:53851536-53851558 CACTGCAACCTGCGCCTCCCGGG - Intergenic
930647675 2:53929088-53929110 CACTGGAACCTCCGCCTCCCAGG - Intronic
931291382 2:60877030-60877052 CACTGGAACCTCCGCCTCCCGGG + Intergenic
931389737 2:61831034-61831056 CACTGGAACCTCCGCCTCCCGGG - Intronic
931478307 2:62612920-62612942 CACTGCAACCTCCGCTGCCCAGG - Intergenic
931649089 2:64453117-64453139 CACTGCAACCTTCGCCGCCCGGG - Intergenic
932200627 2:69824425-69824447 CACTGCGACCTCCGCCTCCCAGG - Intronic
932259339 2:70313870-70313892 CACTGCAACCTCCGCCGCCCGGG - Intergenic
932269418 2:70396421-70396443 CACTGGAACCTCCGCCTCCCAGG - Intergenic
932339485 2:70952385-70952407 CACTGCAACCTGCGCCTCCCAGG - Intronic
932562632 2:72887008-72887030 CACTGGGTGCTGGGCGTCCCTGG - Intergenic
933353397 2:81184529-81184551 CACTTGAACCTGGGCGGCCTAGG + Intergenic
933509566 2:83222689-83222711 CACTGCAACCTCCGCGTCCCAGG - Intergenic
933683607 2:85124993-85125015 CACTGCAACCTCCGCCGCCCCGG - Intergenic
933805039 2:85992508-85992530 CACTGCAACCTGCGCCTCCCAGG - Intergenic
934071466 2:88388012-88388034 CACTGTGACCTCCGCCTCCCGGG - Intergenic
934082180 2:88478295-88478317 CACTGCAACCTCCGCGTCCCGGG + Intergenic
934101098 2:88653754-88653776 CACTGCGACCTCCGCCTCCCGGG + Intergenic
934773439 2:96922423-96922445 CACTGCGACCTCCGCCTCCCGGG + Intronic
935187455 2:100747004-100747026 CACTGCAACCTGCGCCTCCCAGG - Intergenic
935710234 2:105892106-105892128 CACTGCAACCTGCGCCTCCCAGG - Intronic
935716330 2:105942530-105942552 CAGTGGGCCCTGGGCGACCCAGG - Intergenic
935930799 2:108122370-108122392 CACTGCAACCTCCGCCGCCCTGG - Intergenic
935953893 2:108355460-108355482 CACTGCAACCTGCGCCTCCCGGG + Intergenic
935991304 2:108720971-108720993 CACTGGAACCTCCGCCTCCCGGG - Intronic
936010238 2:108920878-108920900 CACTGGGAGCTGCCCGGGGCAGG + Intronic
936115328 2:109697933-109697955 CACTGCGACCTCCGCCTCCCAGG + Intergenic
936370315 2:111898093-111898115 CTCTGGGAGCGGCGCGGCCAGGG + Intergenic
936720125 2:115241191-115241213 CACTGGAACCTCCGCCTCCCGGG - Intronic
937349995 2:121154690-121154712 CTCTGGGACCTCAGAGGCCCGGG + Intergenic
938021341 2:127908211-127908233 CACTGCAACCTCCGCTGCCCAGG + Intergenic
938283673 2:130088663-130088685 CACTGCAACCTCCGCGACCCTGG + Intronic
938339955 2:130528907-130528929 CACTGCGAGCTGCGCTTCCCGGG - Intergenic
938349880 2:130591841-130591863 CACTGCGAGCTGCGCTTCCCGGG + Intergenic
938431934 2:131250230-131250252 CACTGCAACCTCCGCGACCCTGG - Intronic
938473535 2:131587781-131587803 CACTGCAACCTCCGCCGCCCGGG - Intergenic
938482295 2:131672419-131672441 CACTGGGAACTGTGCAGCCAAGG + Intergenic
939119529 2:138099923-138099945 CACTGCAACCTCCGCCGCCCAGG - Intergenic
939179603 2:138788744-138788766 CACTGGGGCCTGCCCGGGCTGGG - Intergenic
939191510 2:138921887-138921909 CACTGCGACCTCCGCCTCCCAGG + Intergenic
939442205 2:142263649-142263671 CACTGCAACCTGCGCCTCCCGGG - Intergenic
939816319 2:146901643-146901665 CACTGTGACCTCCGCCTCCCAGG + Intergenic
940734732 2:157437622-157437644 CACTGCAACCTCCGCCGCCCGGG - Intronic
941449474 2:165642636-165642658 CACTGCGACCTCCGCCTCCCAGG + Intronic
941784293 2:169480755-169480777 CACTGCGACCTCCGCCTCCCAGG + Intronic
941807389 2:169722715-169722737 CACTGCAACCTGCGCCTCCCGGG + Intronic
941899802 2:170667278-170667300 CACTGCAACCTCCGCCGCCCAGG - Intergenic
942287449 2:174434679-174434701 CACTGCAACCTGCGCCTCCCAGG + Exonic
942299744 2:174549438-174549460 CACTGCAACCTCCGCGTCCCGGG - Intergenic
942327319 2:174787069-174787091 CACTGCGACCTCCGCCCCCCGGG + Intergenic
942365516 2:175222266-175222288 CACTGCAACCTCCGCGTCCCGGG + Intergenic
942584786 2:177464015-177464037 CACTGCAACCTCCGCGTCCCGGG + Intronic
942595790 2:177590951-177590973 CACTGCAACCTCCGCCGCCCAGG + Intergenic
943078551 2:183228765-183228787 CACTGCGACCTCCGCCTCCCAGG + Intergenic
943087708 2:183333145-183333167 CACTGCGACCTCCGCCTCCCAGG + Intergenic
943714607 2:191136673-191136695 CACTGCAACCTGCGCCTCCCAGG - Intronic
944237994 2:197457695-197457717 CACTGCAACCTCCGCGTCCCAGG + Intronic
945880881 2:215323847-215323869 CACTGTGACCTCCGCCTCCCGGG + Intronic
945937216 2:215915032-215915054 CACTGGAACCTCCGCCTCCCAGG + Intergenic
946032464 2:216716030-216716052 CACTGCGACCTCCGCCTCCCGGG - Intergenic
946368088 2:219262963-219262985 CACTGCGACCTCCGCCTCCCGGG - Intronic
946437574 2:219668107-219668129 CACTGCAACCTGCGCCTCCCAGG + Intergenic
946623056 2:221579674-221579696 CACTGCAACCTGCGCCTCCCAGG + Intergenic
946928060 2:224645054-224645076 CACTGCAACCTCCGCGTCCCGGG - Intergenic
946936054 2:224721967-224721989 CACTGCGACCTGTGCCTCCCAGG + Intergenic
946965503 2:225033256-225033278 CACTGCGACCTCCGCCTCCCAGG + Intronic
947233331 2:227912306-227912328 CACTGCAACCTGCGCCTCCCAGG + Intronic
947411105 2:229840624-229840646 CACTGCAACCTGCGCCTCCCGGG - Intronic
947788219 2:232843749-232843771 CACTGGAACCTCCGCCTCCCAGG - Intronic
947844154 2:233230570-233230592 CACTGCGACCTCCGCCTCCCAGG - Intronic
947884435 2:233555115-233555137 CACTGCGACCTCCGCCTCCCAGG - Intronic
948194476 2:236085138-236085160 CACTGCGACCTCCGCCTCCCGGG - Intronic
948266820 2:236641075-236641097 CACTGGGAGCAGTGCTGCCCTGG + Intergenic
948389241 2:237600249-237600271 CACTGGGCCATGTGGGGCCCTGG + Intronic
948784959 2:240347524-240347546 CAAAGGGACCAGCCCGGCCCAGG + Intergenic
949079822 2:242088251-242088273 CTGTGGGACCCGCGCGGCGCGGG + Intergenic
1168899493 20:1350392-1350414 CACTGTGACCTCCGCCTCCCAGG + Intronic
1169221991 20:3829329-3829351 CACTGCGACCTCCGCCTCCCGGG + Intergenic
1169373398 20:5045647-5045669 CACTGCGACCTCCGCCTCCCAGG - Intergenic
1169472775 20:5902542-5902564 CACTGCAACCTCCGCCGCCCAGG + Intergenic
1170218854 20:13919847-13919869 CACTGCAACCTCCGCGTCCCAGG - Intronic
1170610262 20:17907077-17907099 CACTGTGACCTCCGCCTCCCAGG + Intergenic
1171479192 20:25439917-25439939 CACTGGAACCTCCGCTTCCCAGG - Intronic
1172041174 20:32047082-32047104 CACTGTGACCTCCGCCTCCCAGG - Intergenic
1172228594 20:33322045-33322067 CACTGGAACCTCCGCCTCCCAGG + Intergenic
1172242242 20:33420906-33420928 CACTGGAACCTCCGCCTCCCGGG - Intronic
1172308261 20:33897255-33897277 CACTGCGACCTCCGCCTCCCAGG + Intergenic
1172325462 20:34031118-34031140 CACTGGAACCTCCGCCTCCCAGG + Intronic
1172347753 20:34217360-34217382 CACTGCAACCTGCGCCTCCCAGG - Intronic
1172546330 20:35764485-35764507 CACTGCAAACTGCGCGTCCCTGG - Intergenic
1172568080 20:35946783-35946805 CACTGCGACCTCCGCCTCCCGGG + Intronic
1172570327 20:35965251-35965273 CACTGCAACCTGCGCCTCCCAGG + Intronic
1172599541 20:36174346-36174368 CACTGTGACCTCTGCCGCCCGGG + Intronic
1172729609 20:37074747-37074769 CACTGCAACCTGCGCCTCCCAGG - Intronic
1172732896 20:37103300-37103322 CACTGCAACCTCCGCGTCCCAGG + Intronic
1172912065 20:38417136-38417158 CACTGGAACCTCCGCCTCCCGGG + Intergenic
1172954782 20:38748510-38748532 CACTGGGTCCGGTGCGGCACGGG - Exonic
1173519736 20:43690279-43690301 CACTGCAACCTCCGCGTCCCAGG + Intronic
1174431454 20:50472726-50472748 CACTGGAACCTCCGCCTCCCGGG - Intergenic
1174743347 20:53038114-53038136 CACTGCGACCTCCGCCTCCCGGG - Intronic
1174807577 20:53617699-53617721 CACTGTGACCTCCGCCTCCCGGG - Intergenic
1175104932 20:56608108-56608130 CACTGCAACCTCCGCGTCCCAGG - Intergenic
1175398870 20:58688031-58688053 CACTGCAACCTGCGCCTCCCAGG + Intronic
1175455915 20:59113767-59113789 CCCTGGGCCCTGTGCGGGCCAGG - Intergenic
1175660732 20:60809856-60809878 CACTGCAACCTCCGCCGCCCGGG - Intergenic
1175764250 20:61581922-61581944 CACAGGCACCTCCTCGGCCCTGG + Intronic
1175934122 20:62507346-62507368 CACTGGGACCTCCCTGGCCCAGG - Intergenic
1175958970 20:62625559-62625581 CACTGGGCCCGGCCCTGCCCAGG + Intergenic
1176447043 21:6830070-6830092 CACTGGGAACTGTGCCGCCAAGG + Intergenic
1176825214 21:13695096-13695118 CACTGGGAACTGTGCCGCCAAGG + Intergenic
1177314816 21:19445245-19445267 CACTGCGACCTCCGCCTCCCGGG + Intergenic
1177320339 21:19512720-19512742 CACAGGGACCTGTGCAACCCTGG + Intergenic
1177558762 21:22723804-22723826 CACTGTGACCTCCGCCTCCCGGG + Intergenic
1177582962 21:23051618-23051640 CACTGGAACCTCCGCCTCCCAGG + Intergenic
1177712568 21:24798034-24798056 CACTGCGACCTCCGCCTCCCAGG + Intergenic
1177798408 21:25803032-25803054 CACTGCGACCTCCGCCTCCCAGG - Intergenic
1178130777 21:29570424-29570446 CACTGTGACCTCCGCCTCCCAGG - Intronic
1178456058 21:32752713-32752735 CACTGCAACCTCCGCCGCCCAGG + Intronic
1178603494 21:34015261-34015283 CACTGCGACCTCCGCCTCCCAGG + Intergenic
1178605102 21:34029479-34029501 CACTGCAACCTGCGCCTCCCGGG - Intergenic
1178718529 21:34988403-34988425 CCCTGGGATCTGCACCGCCCTGG - Intronic
1178947733 21:36961876-36961898 CACTGGGACCTCCGCCTCCTGGG - Intronic
1178948291 21:36966307-36966329 CAGTGCGGCCTGTGCGGCCCGGG - Intronic
1178991661 21:37361708-37361730 CACTGGAACCTCCGCCTCCCAGG - Intergenic
1179093818 21:38293416-38293438 CACTGGGACTTTCCCTGCCCGGG - Intronic
1179260919 21:39757650-39757672 CACTGCAACCTGCGCCTCCCGGG + Intronic
1179663676 21:42894137-42894159 CACTGCAACCTCCGCGTCCCGGG - Intronic
1179882581 21:44299806-44299828 CACTGGGGCCAGCCCCGCCCTGG + Intergenic
1180054543 21:45351138-45351160 CGCTGGGACCGAGGCGGCCCTGG - Intergenic
1180099837 21:45579227-45579249 CCCTGGGACGTGGGCGGCCCTGG + Intergenic
1180260742 21:46667336-46667358 CGCTGGGAGCTGCGCGCACCGGG - Intergenic
1180321620 22:11327037-11327059 CACTGAAACCTGCGCCTCCCGGG + Intergenic
1180483533 22:15776036-15776058 CACTGGGAACTGTGCAGCCAAGG + Intergenic
1180692166 22:17726273-17726295 CACTGCAACCTCCGCGTCCCAGG - Intronic
1180693947 22:17739964-17739986 CACTGGCACCGGCAAGGCCCTGG + Intronic
1180755870 22:18160843-18160865 CACTGGAACCTCCGCCTCCCGGG + Intronic
1180789090 22:18564519-18564541 CACTGCGACCTCTGCTGCCCGGG + Intergenic
1180872743 22:19156156-19156178 CACTGCAACCTCCGCGTCCCAGG + Intergenic
1181232649 22:21430793-21430815 CACTGCGACCTCTGCTGCCCGGG - Intronic
1181246002 22:21504064-21504086 CACTGCGACCTCTGCTGCCCGGG + Intergenic
1181294018 22:21820406-21820428 CACTGCGACCTCCGCCTCCCAGG + Intronic
1181303650 22:21901555-21901577 CACTGCAACCTCCGCCGCCCGGG + Intergenic
1181810067 22:25398577-25398599 CTCTGAGCCCTGCGGGGCCCTGG + Intronic
1181857080 22:25789550-25789572 CACTGGGACCTGGGAGGCAGAGG + Intronic
1181858098 22:25797150-25797172 CACTGCAACCTCCGCGCCCCCGG - Intronic
1181979518 22:26756346-26756368 CACTGGAACCTCCGCCTCCCGGG + Intergenic
1182068344 22:27445899-27445921 CAGTGGGACCTCCTCAGCCCGGG + Intergenic
1182096373 22:27628751-27628773 CACTGCAACCTGCGCCTCCCGGG + Intergenic
1182231774 22:28842891-28842913 CACTGTAACCTGCGCCTCCCAGG - Intergenic
1182244141 22:28941877-28941899 CACTGCGACCTCCGCCTCCCGGG - Intronic
1182303701 22:29353396-29353418 CACTGAGACATGCCCTGCCCTGG - Intronic
1182565267 22:31193966-31193988 CACTGGAACCTCCGCCTCCCGGG + Intronic
1182625350 22:31641742-31641764 CACTGCAACCTGCGCCTCCCGGG - Intronic
1183118901 22:35714234-35714256 CACTGCAACCTCCGCCGCCCAGG - Intergenic
1183193647 22:36338071-36338093 CACTGCAACCTCCGCCGCCCAGG + Intronic
1183205508 22:36416314-36416336 CACTGCAACCTGCGCCTCCCAGG + Intergenic
1183287319 22:36975334-36975356 CACTGGAACCTCCGCCTCCCAGG - Intergenic
1183524792 22:38316873-38316895 CGCTGGGCCCTCCGAGGCCCCGG - Intronic
1183730827 22:39617541-39617563 CGCTGGCACCCGCGGGGCCCAGG - Intronic
1183770864 22:39924624-39924646 CACTGCAACCTCCGCCGCCCGGG - Intronic
1183822117 22:40354791-40354813 CACTGCAACCTCCGCGTCCCGGG - Intronic
1183931406 22:41237996-41238018 CCCTGGGACCTGCGCTGCCCTGG - Exonic
1184055711 22:42047512-42047534 CACTGCAACCTCCGCCGCCCAGG - Intronic
1184059254 22:42072230-42072252 CACTGCAACCTCCGCCGCCCAGG + Intergenic
1184083256 22:42240929-42240951 CACTGCGACCTCCGCCTCCCGGG + Intronic
1184307189 22:43612816-43612838 CACTGCAACCTCCGCCGCCCAGG - Intronic
1184475279 22:44717265-44717287 CACTGCGACCTCCGCCTCCCGGG + Intronic
1184482693 22:44757351-44757373 CACTGCAACCTCCGCGTCCCGGG + Intronic
1184528755 22:45041069-45041091 CACTGCAACCTCCGCGTCCCAGG - Intergenic
1184716422 22:46284791-46284813 CACTGTAACCTCCGCGTCCCAGG - Intronic
1184879845 22:47297788-47297810 CTCTGGGACCTGAGGTGCCCTGG + Intergenic
1185237089 22:49720446-49720468 AGCTGGGACCTGCGGGACCCTGG - Intergenic
1185349597 22:50327490-50327512 CTCTGGGGCCCGCGCGGCCTGGG + Intergenic
1185375178 22:50479361-50479383 CACTGCGACCTCCGCCTCCCAGG - Intergenic
949195495 3:1301110-1301132 CACTGCAACCTCCGCGTCCCCGG + Intronic
950213257 3:11139353-11139375 CACTGCGACCTCCGCCTCCCGGG + Intronic
950345522 3:12288460-12288482 CACGGGGACCTCCGCGTCCCCGG + Intronic
950687119 3:14626653-14626675 CACTGGAACCTCCGCCTCCCGGG + Intergenic
951279132 3:20725709-20725731 CACTGGAACCTCCGCCTCCCAGG - Intergenic
951563526 3:23990288-23990310 CACTGGAACCTCCGCCTCCCAGG - Intergenic
951984668 3:28605189-28605211 CACTGAAACCTCCGCGTCCCTGG - Intergenic
952063777 3:29542434-29542456 CACTGCAACCTGCGCCTCCCGGG + Intronic
952247407 3:31609037-31609059 CACTGCGACCTCCGCCTCCCAGG - Intronic
952361768 3:32637405-32637427 CACTTGAACCTGGGAGGCCCAGG - Intergenic
952581230 3:34836327-34836349 CACTGCAACCTGCGCCTCCCAGG + Intergenic
952823125 3:37502288-37502310 CACTGAGACCTCTGCGTCCCGGG + Intronic
953175753 3:40550658-40550680 CACTGCAACCTCCGCTGCCCAGG + Intronic
953397442 3:42584328-42584350 CACTGCAACCTGCGCCTCCCAGG + Intronic
953863890 3:46567057-46567079 CACTGCAACCTGCGCCTCCCGGG + Intronic
953984655 3:47432239-47432261 CACTGGAACCTCCGCCTCCCGGG - Intronic
954086043 3:48244888-48244910 CACTGGAACCTCCGCCTCCCGGG + Intronic
954218422 3:49137456-49137478 CACTGCAACCTGCGCCCCCCGGG - Intergenic
954338492 3:49934689-49934711 CACTGTGACCTCCGCCTCCCCGG - Intergenic
954554319 3:51506202-51506224 CACTGAGACCTGCACCTCCCGGG + Intergenic
954742107 3:52761352-52761374 CACTGCAACCTCCGCTGCCCAGG + Intronic
954798639 3:53174462-53174484 CTCTGGGGCCTCCGTGGCCCAGG + Intronic
955402015 3:58599015-58599037 CACTGTGACCTCCGCCTCCCAGG + Intronic
955620687 3:60859966-60859988 CACTGGAACCTCCGCCTCCCAGG - Intronic
956196858 3:66661646-66661668 CACTGGAACCTGGGAGGCCGAGG + Intergenic
956291735 3:67667893-67667915 CACTGCGACCTCCGCCTCCCAGG + Intergenic
956695150 3:71912441-71912463 CACTGAGACCTGGGCGGTACTGG - Intergenic
956785412 3:72638121-72638143 CACTGGAACCTCCGCCTCCCAGG - Intergenic
957382232 3:79446897-79446919 CACTGTGACCTCCGCCTCCCGGG + Intronic
957464224 3:80565580-80565602 CACTGGAACCTCCGCCTCCCAGG - Intergenic
958592499 3:96175666-96175688 GACTGGGGCATGCCCGGCCCAGG + Intergenic
959700949 3:109298638-109298660 CACTGGAACCTCCGCCTCCCAGG - Intronic
959849828 3:111072394-111072416 CACGGCGACCCGCGCGGCCGCGG - Intronic
959948377 3:112150911-112150933 CACTGCAACCTCCGCCGCCCAGG + Intronic
960033831 3:113083296-113083318 CACTGGAACCTGCGCCTCCTGGG + Intergenic
960182237 3:114594340-114594362 CACTGCAACCTCCGCCGCCCGGG + Intronic
960742162 3:120846289-120846311 CACTGGGATGTGGGCTGCCCTGG + Intergenic
960967029 3:123112622-123112644 CACTGCGACCTCCGCCCCCCGGG + Intronic
961403938 3:126665989-126666011 GGCTGGGACCTGCGGGGCCGTGG + Intergenic
961616035 3:128181887-128181909 CACTGGAACCTCCGCCTCCCGGG + Intronic
961744492 3:129055718-129055740 CACTGCAACCTGCGCCTCCCAGG + Intergenic
962204547 3:133424125-133424147 CACTGCAACCTCCGCCGCCCGGG + Intronic
962213983 3:133503983-133504005 CACTGGAACCTCCGCCTCCCGGG + Intergenic
962499643 3:135977773-135977795 CACTGCGACCTCCGCTTCCCGGG + Intronic
962545925 3:136435751-136435773 CACTGGAACCTGGGCGGCAGAGG - Intronic
962591901 3:136898319-136898341 CACTGGAACCTCCGCCTCCCGGG - Intronic
962778571 3:138688423-138688445 CACTGCGACCTCCGCCTCCCGGG - Intronic
962859027 3:139380085-139380107 CACTGCGACCTCCGCCTCCCAGG + Intronic
963026413 3:140923676-140923698 CACTGCAACCTGCGCCTCCCGGG + Intergenic
964134178 3:153325949-153325971 CACTGCAACCTCCGCGTCCCAGG + Intergenic
964542412 3:157794094-157794116 CACCTGGATTTGCGCGGCCCTGG - Intergenic
964672942 3:159247170-159247192 CACTGCGACCTCCGCCTCCCGGG + Intronic
964740080 3:159955658-159955680 CACTGCGACCTCCGCCTCCCAGG - Intergenic
964794263 3:160480692-160480714 CACTGGAACCTCCGCCTCCCAGG + Intronic
964875796 3:161367099-161367121 CACTGTGACCTCCGCCTCCCAGG - Intronic
965187575 3:165484394-165484416 CACTGCAACCTCCGCCGCCCAGG - Intergenic
965396735 3:168168111-168168133 CACTGCAACCTCCGCGTCCCGGG - Intergenic
965538230 3:169847267-169847289 CACTTGAACCTGGGCGGCCGAGG - Intronic
965589052 3:170345000-170345022 CACTGCAACCTCCGCGTCCCGGG - Intergenic
965714832 3:171591620-171591642 CACTGGGGCCTGTCGGGCCCGGG - Intergenic
965994924 3:174869918-174869940 CACTGGAACCTCCGCCTCCCAGG - Intronic
966687591 3:182712668-182712690 CACTGCAACCTCCGCCGCCCTGG - Intergenic
966743466 3:183254303-183254325 CGCTGGGCCGTGCGCGGTCCGGG - Intronic
966777770 3:183557963-183557985 CACTGCGACCTCCGCTTCCCAGG + Intergenic
966784928 3:183614737-183614759 CACTGCGACCTCCGCCTCCCAGG - Intergenic
966850411 3:184161349-184161371 CACTGCAACCTGCGCCTCCCGGG - Intronic
967527234 3:190508809-190508831 CACTGCAACCTGCGCTTCCCAGG - Intergenic
967541660 3:190675220-190675242 CACTGGAACCTCCGCATCCCAGG - Intergenic
967805126 3:193708993-193709015 TACTGCGACCTGCAGGGCCCAGG - Intergenic
967814339 3:193786569-193786591 CACTGCGACCTCCGCCTCCCAGG - Intergenic
968157623 3:196395839-196395861 CACTGTGACCTCCGCCTCCCAGG + Intronic
968430789 4:557139-557161 CACTGTGACCTCCGCCTCCCAGG - Intergenic
968622008 4:1608034-1608056 CACTGCGACCTCCGCCTCCCGGG - Intergenic
969099396 4:4757458-4757480 CCCTGGGACCTGAGCAGCGCAGG + Intergenic
969355080 4:6620469-6620491 GAATGGGACCTGTGCGTCCCAGG - Intronic
969368374 4:6714076-6714098 CACTGCAACCTGCGCCTCCCAGG + Intergenic
969971757 4:11055252-11055274 CACTGCAACCTCCGCTGCCCGGG + Intergenic
969975195 4:11092227-11092249 CACTGAGACCTCCGCCTCCCGGG - Intergenic
970103507 4:12554085-12554107 CACTGTAACCTGCGCCTCCCGGG + Intergenic
970431989 4:15997533-15997555 CACTGCAACCTGCGCCTCCCTGG + Intronic
970541066 4:17080007-17080029 CACTGGGACCTCCGCCTCCTGGG + Intergenic
970707085 4:18816974-18816996 CACTGCAACCTCCGCTGCCCAGG - Intergenic
971006107 4:22375605-22375627 CACTGCAACCTCCGCGTCCCAGG - Intronic
971023809 4:22567661-22567683 CACTGAAACCTGCGCCTCCCAGG - Intergenic
971533209 4:27715460-27715482 CACTGCAACCTCCGCCGCCCGGG + Intergenic
971816384 4:31496071-31496093 CACTGAGACCTCCGCCTCCCAGG - Intergenic
972068729 4:34986530-34986552 CACTGCAACCTCCGCGTCCCGGG - Intergenic
972184530 4:36513033-36513055 CACTGCAACCTGCGCCTCCCAGG + Intergenic
972310673 4:37879226-37879248 CACTGCAACCTCCGCCGCCCAGG + Intergenic
972380231 4:38512474-38512496 CACTGTGACCTCCGCCTCCCAGG - Intergenic
972424565 4:38920129-38920151 CACTGGAACCTCCGCCTCCCGGG - Intronic
972525753 4:39909199-39909221 CACTGCAACCTCCGCCGCCCAGG + Intronic
973058256 4:45687314-45687336 CACTGCGACCTCCGCCTCCCAGG - Intergenic
973909647 4:55566496-55566518 CACTGGAACCTCCGCCTCCCGGG + Intronic
973954191 4:56047464-56047486 CACTGCAACCTCCGCGTCCCGGG + Intergenic
974822863 4:67089993-67090015 CACTGCGACCTCCGCTTCCCCGG - Intergenic
975135941 4:70874630-70874652 CACTGCAACCTCCGCCGCCCGGG + Intergenic
975464961 4:74698733-74698755 CACTGCAACCTGCGCATCCCAGG + Intergenic
975578435 4:75885931-75885953 CACTGCAACCTCCGCGTCCCAGG - Intronic
976070814 4:81237449-81237471 CACTGCAACCTGCGCCTCCCGGG - Intergenic
976127664 4:81851457-81851479 CACTGGAACCTCCGCCTCCCAGG - Intronic
976542680 4:86296098-86296120 CACTGGAACCTCCGCCTCCCGGG - Intronic
976864394 4:89706698-89706720 CACTGCGACCTCCGCCTCCCAGG + Intergenic
977245754 4:94629271-94629293 CACTGTGACCTCCGCCCCCCAGG - Intronic
977894888 4:102352371-102352393 CACTGTGACCTCCGCCTCCCAGG + Intronic
978374181 4:108057947-108057969 CACTGCAACCTGCGCCTCCCAGG + Intronic
978841680 4:113221581-113221603 CACTGGAACCTCCGCCTCCCGGG - Intronic
979621337 4:122801670-122801692 CACTGGAACCTCCGCCTCCCAGG - Intergenic
980066772 4:128197958-128197980 CACTGCAACCTCCGCTGCCCGGG + Intronic
980121674 4:128734226-128734248 CACTGGAACCTCCGCCTCCCGGG - Intergenic
980190607 4:129519931-129519953 CACTGCAACCTCCGCGTCCCAGG + Intergenic
980801302 4:137753679-137753701 CACTGAAACCTCCGCTGCCCAGG - Intergenic
980917695 4:139049454-139049476 CACTGCGACCTCCGCCTCCCAGG + Intronic
980941754 4:139280999-139281021 CACTGCGACCTCCGCCTCCCGGG - Intronic
981088101 4:140704323-140704345 CACTGCAACCTGCGCCTCCCAGG - Intronic
981358313 4:143818511-143818533 CACTGGAACCTCCGCCTCCCGGG + Intergenic
981369565 4:143944640-143944662 CACTGGAACCTCCGCCCCCCGGG + Intergenic
981601840 4:146498191-146498213 CACTGCAACCTCCGCGCCCCGGG + Intronic
981665987 4:147227439-147227461 CACTGCAACCTCCGCCGCCCAGG + Intergenic
981791349 4:148540388-148540410 CACTGCAACCTCCGCTGCCCAGG - Intergenic
982161769 4:152577453-152577475 CACTGGAACCTCCGCCTCCCGGG - Intergenic
982764744 4:159333053-159333075 CACTGCAACCTGTGCCGCCCAGG + Intronic
982764745 4:159333061-159333083 CACTTGAACCTGGGCGGCACAGG - Intronic
982946855 4:161635310-161635332 CACTGGAACCTCCGCCTCCCAGG - Intronic
983058798 4:163130952-163130974 CACTGCAACCTCCGCTGCCCGGG + Intronic
983400848 4:167263541-167263563 CACTGTGACCTCCGCCTCCCGGG - Intergenic
984291143 4:177795962-177795984 CACTGCGACCTGCGCCTCCCGGG - Intronic
984292670 4:177814916-177814938 CACTGCGACCTCCGCCTCCCAGG + Intronic
984487171 4:180385731-180385753 CACTGCGACCTCCGCCTCCCGGG + Intergenic
985044785 4:185929609-185929631 CACTGGAACCTCCGCCTCCCGGG + Intronic
985126357 4:186698675-186698697 CACTGGCTCCTGTGCAGCCCTGG - Intronic
985264906 4:188148416-188148438 CACTGCAACCTCCGCCGCCCGGG - Intergenic
985481565 5:114531-114553 CACTGCGACCTCCGCCACCCAGG + Intergenic
985488978 5:168056-168078 CTCTGGGTCCTGCCCTGCCCTGG + Intronic
985712472 5:1437173-1437195 CACTGTCACCTGCGCGTCCCGGG - Intronic
985875964 5:2594113-2594135 CCCTGGGAGCTGCGGGGGCCAGG + Intergenic
986662186 5:10069225-10069247 CACTGCGACCTCCGCCACCCAGG + Intergenic
986684491 5:10264197-10264219 CACTGGAACCTCTGCGTCCCGGG - Intronic
987096748 5:14557144-14557166 CACTGGAACCTCCGCCTCCCTGG + Intergenic
987161972 5:15154433-15154455 CACTGCAACCTGCGCCTCCCGGG + Intergenic
987350117 5:17014599-17014621 CACTGTAACCTGCGCCTCCCAGG - Intergenic
988012095 5:25501763-25501785 CACTGCAACCTCCGCCGCCCGGG - Intergenic
988531908 5:32035334-32035356 CACTGCAACCTGCGCCTCCCAGG + Intronic
988595891 5:32590669-32590691 CACTGCAACCTTCGCGTCCCGGG + Intronic
988706253 5:33728536-33728558 CACTGGGATCAGCCTGGCCCTGG + Intronic
989042157 5:37240272-37240294 CACTGCGACCTCCGCCTCCCGGG - Intronic
989054027 5:37348829-37348851 CACTGCAACCTCCGCCGCCCAGG + Intronic
989139821 5:38191250-38191272 CACTGTGACCTGTGCCTCCCAGG - Intergenic
989638708 5:43562900-43562922 CACTGCGACCTCCGCCTCCCTGG + Intergenic
990379236 5:55205784-55205806 CACTGGAACCTCCGCCTCCCAGG - Intergenic
990473064 5:56135443-56135465 CACTGTGACCTCCGCCTCCCAGG + Intronic
990540219 5:56765139-56765161 CACTGCGACCTCCGCCTCCCGGG + Intergenic
991059070 5:62352075-62352097 CACTGTGACCTCCGCCTCCCAGG - Intronic
991061687 5:62383000-62383022 CACTGCGACCTCCGCCTCCCAGG + Intronic
991245696 5:64506501-64506523 CACTGTGAGCTGCGCGCCTCAGG + Exonic
992044416 5:72871043-72871065 CACTGCAACCTCCGCTGCCCGGG + Intronic
992275345 5:75110631-75110653 CACTGGAACCTCCGCCTCCCAGG - Intronic
992511608 5:77441660-77441682 CACTGCGACCTCTGCGTCCCAGG - Intronic
992574177 5:78094754-78094776 CACTGGAACCTCCGCCTCCCAGG + Intronic
992869941 5:80995766-80995788 CACTGCAACCTGCGCCTCCCGGG + Intronic
993041204 5:82816654-82816676 CACTGCTACCTCCGCCGCCCGGG - Intergenic
993643958 5:90440003-90440025 CACTGCAACCTCCGCGTCCCGGG - Intergenic
993969840 5:94406000-94406022 CACTGCAACCTCCGCGTCCCAGG + Intronic
994766202 5:103921255-103921277 CACTGCAACCTCCGCGTCCCAGG + Intergenic
994786156 5:104166806-104166828 CACTGCAACCTGCGCCTCCCAGG + Intergenic
995786754 5:115839045-115839067 CACTGCAACCTCCGCGTCCCGGG - Intronic
996056833 5:118991269-118991291 CACTGCGACCTCCGCCTCCCGGG + Intergenic
996681907 5:126236835-126236857 CACTGCGACCTCCGCCTCCCGGG - Intergenic
997305377 5:132831975-132831997 CACTGAAACCTGCGCCTCCCAGG + Intergenic
997472948 5:134126819-134126841 CACTGTGACCTCCGCCTCCCAGG - Intronic
997476906 5:134147898-134147920 CACTGGAACCTCCGCCTCCCGGG - Exonic
998274941 5:140743628-140743650 CACTGCGACCTCCGCCTCCCGGG + Intergenic
998289090 5:140895885-140895907 CACTGCAACCTCCGCGTCCCGGG + Intronic
998748611 5:145291259-145291281 CACTGCGACCTCCGCCTCCCGGG - Intergenic
998816859 5:146023282-146023304 CACTGCGACCTCCGCCTCCCAGG + Intronic
998943969 5:147317401-147317423 CACTGCAACCTCCGCCGCCCAGG + Intronic
999149410 5:149416853-149416875 CACTGCGACCTCCGCCTCCCAGG - Intergenic
1000339369 5:160265557-160265579 CACTGCAACCTTCGCTGCCCAGG - Intronic
1001303079 5:170552171-170552193 CACTGGGCCCTGGGAGGACCAGG + Intronic
1001507988 5:172295520-172295542 CACTGTGACCTCCGCCTCCCAGG - Intergenic
1001557646 5:172647438-172647460 TAGTGAGACCTGCCCGGCCCAGG + Intronic
1002148285 5:177204427-177204449 CACTGCAACCTCCGCGTCCCAGG + Intronic
1003077088 6:2991779-2991801 CACTGCAACCTCCGCGTCCCGGG - Intronic
1003270307 6:4602341-4602363 CAGTGTGACCTGCGGGGCCCAGG + Intergenic
1003596503 6:7479041-7479063 CACTGGAACCTCCGCCTCCCGGG + Intergenic
1003895507 6:10603969-10603991 CACTGCAACCTCCGCCGCCCCGG + Intronic
1003936855 6:10984091-10984113 CACTGCGACCTCCGCCTCCCGGG + Intronic
1004064301 6:12228038-12228060 CACTGTGACCTCCGCCTCCCAGG + Intergenic
1004120913 6:12821385-12821407 CACTGCGACCTCCGCCTCCCAGG - Intronic
1004328366 6:14698354-14698376 CACTGCGACCTGCGCCTCCCAGG - Intergenic
1004640077 6:17506562-17506584 CACTGCGACCTCCGCCTCCCAGG - Intronic
1004941179 6:20557849-20557871 CACTGGAACCTCCGCCTCCCAGG - Intronic
1005480315 6:26249305-26249327 CACTGGGACCTCCGCCTCCCGGG - Intergenic
1005491692 6:26353398-26353420 CACTGCAACCTGCGCCTCCCGGG + Intergenic
1005803943 6:29456152-29456174 CACTGGAACCTCCGCCTCCCAGG - Intronic
1006191311 6:32211182-32211204 CACTACAACCTGCGCTGCCCAGG - Intronic
1006307943 6:33235989-33236011 CACTGGAACCTCCGCCTCCCGGG - Intergenic
1006322081 6:33325289-33325311 CACTGCGACCTCCGCCTCCCGGG - Intronic
1006425554 6:33960773-33960795 CAGTGGGAGCTGGGAGGCCCTGG + Intergenic
1006644454 6:35506218-35506240 CACTGGGACCTGCTGGGAGCGGG - Intronic
1006674002 6:35749152-35749174 CACTGCAACCTGCGCCTCCCTGG + Intergenic
1006702586 6:35987985-35988007 CACTGCGACCTCCGCCTCCCGGG + Intronic
1006940732 6:37750522-37750544 CACTGAGACCTCCGCCTCCCGGG - Intergenic
1006953631 6:37846785-37846807 CACTGCAACCTCCGCCGCCCAGG + Intronic
1006995173 6:38253036-38253058 CACTGGAACCTCCGCCTCCCAGG - Intronic
1007151559 6:39697616-39697638 CACTGTGACCTCCGCCTCCCAGG + Intronic
1007286944 6:40754768-40754790 CGCTGGGACATGCGCGGACAGGG - Intergenic
1007417573 6:41700933-41700955 CACTGGGACCAGCTGGGCCCTGG + Intronic
1007608606 6:43134112-43134134 CACTGCAACCTGCGCCTCCCAGG + Intronic
1007879994 6:45153992-45154014 CACTGGAACCTCCGCCTCCCGGG - Intronic
1008990199 6:57592713-57592735 CACTGAGACCTCCGCCTCCCAGG - Intronic
1009292852 6:61905929-61905951 CACTGCAACCTCTGCGGCCCGGG + Intronic
1009429113 6:63547263-63547285 CACTGCAACCTGCGCCTCCCAGG + Intronic
1009436175 6:63620921-63620943 CACTGGAACCTCCGCCTCCCAGG + Intergenic
1009979575 6:70711601-70711623 CACTGTGACCTCCGCCTCCCAGG + Intronic
1010200528 6:73278085-73278107 CACTGCGACCTCCGCCTCCCGGG + Intronic
1010219023 6:73431393-73431415 CACTGCAACCTGCGCCTCCCAGG - Intronic
1010221358 6:73451748-73451770 CCCTGGGACGTGCCCAGCCCCGG - Exonic
1010497860 6:76557523-76557545 CACTGCGACCTCCGCCTCCCTGG - Intergenic
1010532375 6:76984340-76984362 CACTGGAACCTCCGCCTCCCGGG + Intergenic
1010699872 6:79031017-79031039 CACTGCAACCTCCGCAGCCCAGG + Intronic
1010782016 6:79954574-79954596 CACTGCGACCTCCGCCTCCCAGG + Intergenic
1010911521 6:81563856-81563878 CACTGCAACCTGTGCGGCCCGGG + Intronic
1011088699 6:83571178-83571200 CACTGCAACCTGCGCCTCCCAGG + Intronic
1011116177 6:83895239-83895261 CACTGCAACCTGCGCCTCCCAGG + Intronic
1011116971 6:83905128-83905150 CACTGCAACCTCCGCGTCCCAGG + Intronic
1011193405 6:84758330-84758352 CACTGGAACCTCCGCCTCCCAGG - Intronic
1011548616 6:88507671-88507693 CACTGGAACCTCCGCACCCCAGG - Intergenic
1011572735 6:88756395-88756417 CACTGCAACCTCCGCCGCCCTGG - Intronic
1011685391 6:89819665-89819687 CACTGGGACCTCGGCGGCTTGGG - Exonic
1011886881 6:92107883-92107905 CACTGGAACCTCCGCCTCCCGGG - Intergenic
1012147264 6:95700567-95700589 CACTGGGACCTGCACCTCCTGGG - Intergenic
1012275253 6:97265795-97265817 CACTGCAACCTGCGCCTCCCAGG + Intronic
1012850220 6:104437866-104437888 CACTGCGACCTCCGCCTCCCGGG + Intergenic
1013106058 6:107027740-107027762 CACTGCGACCTCCGCCTCCCGGG - Intergenic
1013204126 6:107931264-107931286 CACTGCGACCTTCGCCTCCCAGG - Intronic
1013263789 6:108473631-108473653 CACTGCAACCTGCGCCTCCCGGG + Intronic
1013497884 6:110717046-110717068 CACTGGAACCTGGGAGGCACAGG + Intronic
1013600980 6:111704668-111704690 CACTTGAACCTGGGAGGCCCAGG + Intronic
1014282145 6:119453417-119453439 CACAGGGAGCTGAGCGGGCCCGG + Intergenic
1014569632 6:122993149-122993171 CACTGCAACCTGCGCCTCCCAGG - Intergenic
1014636833 6:123858189-123858211 CACTGCAACCTCCGCGTCCCGGG + Intronic
1015307000 6:131720655-131720677 CACTGGAACCTCCGCCTCCCAGG + Intronic
1015401016 6:132788083-132788105 CACTGCAAACTGCGCCGCCCAGG - Intronic
1015967878 6:138713019-138713041 CACTGCAACCTCCGCCGCCCAGG + Intergenic
1016048238 6:139502630-139502652 CACTGCGACCTCCGCCTCCCGGG - Intergenic
1016057730 6:139596035-139596057 CACTGCAACCTCCGCCGCCCAGG - Intergenic
1016270922 6:142289675-142289697 CACTGCGACCTCCGCTTCCCAGG + Intergenic
1016383599 6:143510561-143510583 CACTGCAACCTTCGCCGCCCGGG - Intronic
1016555016 6:145326862-145326884 CACTGCAACCTCCGCTGCCCAGG + Intergenic
1016963745 6:149698624-149698646 CACTGCAACCTCCGCCGCCCAGG + Intronic
1017160679 6:151362790-151362812 CACTGCGACCTCCGCCTCCCGGG - Intergenic
1017493437 6:154963980-154964002 CACTGCAACCTCCGCTGCCCAGG + Intronic
1017504885 6:155059397-155059419 GACTGGGACCTCCGCCTCCCAGG + Intronic
1017521060 6:155202971-155202993 CACTGCGACCTCCGCCTCCCAGG - Intronic
1017902173 6:158727757-158727779 CACTGTGACCTCCGCCTCCCAGG + Intronic
1018092437 6:160356574-160356596 CCCTGGGAGCTGCTCAGCCCAGG - Intronic
1018766679 6:166938968-166938990 GCATGGGACCTGCGCCGCCCAGG - Exonic
1018893623 6:167998974-167998996 CACTGCGACCTCCGCCTCCCAGG - Intronic
1018955122 6:168404461-168404483 CACTGGAACCTCCGCCTCCCGGG - Intergenic
1019094832 6:169570751-169570773 CACTGTGACCTCCGCCTCCCAGG - Intronic
1019367211 7:640085-640107 CACTGCAACCTGCGCCTCCCGGG - Intronic
1019393451 7:802817-802839 CACTGCAACCTCCGCGTCCCAGG - Intergenic
1019540679 7:1549792-1549814 CACTGGGTCCCCCGGGGCCCGGG - Intronic
1019654206 7:2179893-2179915 CACTGTGACCTCCGCCTCCCAGG - Intronic
1019987185 7:4666191-4666213 CACTGCAACCTCCGCGTCCCAGG + Intergenic
1019997213 7:4732366-4732388 CACTGCGGCCTCCGCTGCCCAGG + Intronic
1020093420 7:5354125-5354147 CACTGCGACCTCCGCCTCCCGGG - Intronic
1020189388 7:5983725-5983747 CACTGCAACCTGCGCCTCCCAGG + Intronic
1020291897 7:6729089-6729111 CACTGGAACCTCCGCCTCCCGGG + Intergenic
1020293531 7:6740931-6740953 CACTGCAACCTGCGCCTCCCAGG - Intergenic
1020799939 7:12720809-12720831 CACTGGGACCTCCGCCTCCCAGG - Intergenic
1021685708 7:23183293-23183315 CACTGCGACCTCCGCCTCCCAGG + Intronic
1021890045 7:25178963-25178985 CACTGGGACCTCTGCCTCCCAGG - Intronic
1022189796 7:28006291-28006313 CACTGTGACCTCCGCTTCCCAGG - Intronic
1022191731 7:28022830-28022852 CACTGCAACCTCCGCTGCCCAGG + Intronic
1022730954 7:33025061-33025083 CACTGCAACCTGCGCCTCCCAGG - Intronic
1023012393 7:35935930-35935952 CACTGCAACCTGCGCATCCCAGG - Intergenic
1023308348 7:38855132-38855154 CACTGCAACCTCCGCCGCCCAGG - Intronic
1023706821 7:42949916-42949938 CACTGCAACCTGCGCCTCCCAGG + Intergenic
1023737084 7:43244728-43244750 CACTGGGCCCTGTGCTGCTCGGG + Intronic
1023902192 7:44490415-44490437 CACCAAGGCCTGCGCGGCCCCGG + Exonic
1023917176 7:44598085-44598107 CACTGCAACCTCCGCGTCCCGGG - Intergenic
1024078733 7:45837911-45837933 CACTGCAACCTGCGCATCCCAGG + Intergenic
1024295100 7:47835474-47835496 CACTGCGACCTCCGCCTCCCGGG + Intronic
1024481462 7:49867641-49867663 CTCTAGCACCTGCGAGGCCCTGG + Intronic
1024603879 7:51009598-51009620 CACTGGAACCTCCGCCTCCCAGG - Intergenic
1024641567 7:51333400-51333422 CACTGCGACCTCCGCCTCCCGGG + Intergenic
1025120394 7:56296861-56296883 CACTGGGACCTGGGAGGCAGAGG - Intergenic
1025126055 7:56346044-56346066 CACTGCAACCTGCGCATCCCAGG - Intergenic
1025190178 7:56890399-56890421 CACTGCAACCTCCGCCGCCCGGG - Intergenic
1025681761 7:63686521-63686543 CACTGCAACCTCCGCCGCCCGGG + Intergenic
1025960048 7:66211888-66211910 CACTGCGACCTCCGCCTCCCGGG - Intronic
1026033483 7:66815306-66815328 CACTGCGACCTCCGCCTCCCAGG + Intergenic
1026059305 7:67011795-67011817 CACTGCGACCTCCGCCTCCCAGG - Intronic
1026221051 7:68398074-68398096 CACTGGAACCTCCGCCTCCCAGG + Intergenic
1026636255 7:72084432-72084454 CACTGCAACCTGCGCCTCCCGGG + Intronic
1026762824 7:73139396-73139418 CACTGCAACCTGCGCCTCCCAGG + Intergenic
1026769452 7:73185718-73185740 CACTGGGGCCTCCGCCTCCCGGG + Intergenic
1026771557 7:73204117-73204139 CACTGCGACCTCCGCCTCCCAGG - Intergenic
1026843315 7:73683053-73683075 GACGAGGACCTGCGCGGACCTGG - Exonic
1026860799 7:73787169-73787191 CACTGCAACCTGGACGGCCCAGG + Intergenic
1027010321 7:74739104-74739126 CACTGGGGCCTCCGCCTCCCGGG + Intronic
1027012423 7:74757513-74757535 CACTGCGACCTCCGCCTCCCAGG - Intronic
1027039288 7:74949184-74949206 CACTGCAACCTGCGCCTCCCAGG + Intergenic
1027075617 7:75188540-75188562 CACTGCGACCTCCGCCTCCCAGG + Intergenic
1027077721 7:75206940-75206962 CACTGGGGCCTCCGCCTCCCGGG - Intergenic
1027084354 7:75253196-75253218 CACTGCAACCTGCGCCTCCCAGG - Intergenic
1027378230 7:77575925-77575947 CACTGCGACCTCCGCCTCCCAGG + Intronic
1027547463 7:79546502-79546524 CACTGCGACCTCCGCCTCCCAGG + Intergenic
1027653377 7:80899114-80899136 CACTGCAACCTCCGCCGCCCGGG + Intronic
1028467397 7:91168184-91168206 CACTGCGACCTCCGCCTCCCGGG - Intronic
1028542692 7:91961233-91961255 CACTGTGACCTCCGCCTCCCGGG + Intronic
1028905698 7:96151867-96151889 CACTGCAACCTCCGCTGCCCGGG - Intronic
1029098205 7:98106117-98106139 CCCTGGGAGCTGCTCTGCCCTGG + Intergenic
1029127822 7:98307186-98307208 CACTGCAACCTGCGCCTCCCAGG + Intronic
1029211739 7:98914637-98914659 CACTGTGACCTCCGCCTCCCAGG - Intronic
1029420076 7:100467761-100467783 CACCGGGGCCTGGGAGGCCCTGG - Intronic
1029456027 7:100673055-100673077 CACTGCAACCTCCGCCGCCCGGG - Intergenic
1029475187 7:100779125-100779147 CACTGAGACCTCCGCCTCCCGGG - Intronic
1030034661 7:105398457-105398479 CACTGGAACCTCCGCCTCCCAGG + Intronic
1031106221 7:117546067-117546089 CACTGGAACCTCTGCTGCCCGGG + Intronic
1031480885 7:122277508-122277530 CACTGCAACCTCCGCCGCCCAGG + Intergenic
1032223600 7:130012511-130012533 CACTGGAACCTCCGCCTCCCGGG + Intergenic
1032834902 7:135663418-135663440 CACTGGAACCTCCGCCTCCCGGG + Intronic
1033596738 7:142864448-142864470 CACGGGGGCCTGCCTGGCCCTGG + Exonic
1033636882 7:143220090-143220112 CACTGAGACCTCCGCCTCCCAGG + Intergenic
1033647607 7:143317322-143317344 CACTGCGACCTCCGCCTCCCGGG + Intronic
1033881564 7:145890440-145890462 CACTGGAACCTCCGCCTCCCAGG + Intergenic
1033984455 7:147206485-147206507 CACTGCAACCTCCGCTGCCCAGG - Intronic
1034154487 7:148943695-148943717 CACTGCAACCTGCGCCTCCCAGG - Intergenic
1034158875 7:148977752-148977774 CACTGCTACCTCTGCGGCCCAGG - Intergenic
1034184360 7:149163278-149163300 CACTGGAACCTCCGCCTCCCAGG + Intronic
1034510190 7:151527756-151527778 CACTGCAACCTCCGCTGCCCGGG + Intergenic
1035211374 7:157330774-157330796 CACTGCAACCTCCGCTGCCCGGG + Intergenic
1035537874 8:406536-406558 CTGTGGGACCCGCGCGGCGCGGG + Intronic
1035847257 8:2878685-2878707 CACTGGAACCTGGGAGGCACAGG - Intergenic
1035926620 8:3734633-3734655 CACTGCGACCTCCGCCTCCCAGG - Intronic
1036159641 8:6375265-6375287 CACTGCGACCTCCGCCTCCCAGG + Intergenic
1036435949 8:8733638-8733660 CACTGCGACCTCCGCCTCCCAGG + Intergenic
1037260096 8:16999596-16999618 CACTGCAACCTGCGCCTCCCGGG + Intronic
1037862814 8:22417976-22417998 CACTGCAACCTCCGCGTCCCGGG + Intronic
1038571725 8:28668405-28668427 CACTGCAACCTCCGCGTCCCAGG + Intronic
1038849429 8:31260962-31260984 CACTGCCACCTCCGCCGCCCGGG + Intergenic
1039001957 8:32991350-32991372 CACTGGAACCTCCGCCTCCCAGG + Intergenic
1039470623 8:37811550-37811572 CACTGGAACCTCCGCCTCCCAGG + Intronic
1039541250 8:38372972-38372994 CACTGCAACCTCCGCGTCCCGGG - Intronic
1039974051 8:42344737-42344759 CACTGGAACCTCCGCCTCCCGGG - Intronic
1040071446 8:43192002-43192024 CACTGCAACCTGCGCCTCCCAGG + Intronic
1040432018 8:47352199-47352221 CACTGCGACCTCCGCCTCCCGGG - Intronic
1040441852 8:47451503-47451525 CACTGCAACCTGCGCCTCCCAGG - Intronic
1040477352 8:47791397-47791419 CACTGCAACCTGCGCCTCCCGGG - Intronic
1040489262 8:47904715-47904737 CACTGCAACCTGCGCCTCCCAGG - Intronic
1040794069 8:51270858-51270880 CACTGCGACCTCCGCCTCCCTGG + Intergenic
1041100330 8:54390677-54390699 CACTGGAACCTGGGAGGCACAGG - Intergenic
1042267784 8:66926071-66926093 CACTGCAACCTCCGCTGCCCGGG - Intergenic
1042297636 8:67239080-67239102 CACTGCGACCTCCGCCTCCCAGG + Intronic
1042556338 8:70036393-70036415 CACTGCGACCTCCGCCTCCCAGG - Intergenic
1042559210 8:70060015-70060037 CACTGCAACCTGCGCCTCCCAGG - Intronic
1042708384 8:71687115-71687137 CACTGCGACCTCCGCCTCCCAGG - Intergenic
1042874923 8:73433278-73433300 CACTGGAACCTCCGCCTCCCGGG + Intronic
1042876672 8:73447015-73447037 CACTGCAACCTCCGCGTCCCGGG + Intronic
1042893699 8:73642445-73642467 CACTGTGACCTCCGCCTCCCGGG - Intronic
1042930588 8:74009317-74009339 CACTGCAACCTCCGCTGCCCAGG - Intronic
1042937627 8:74076397-74076419 CACTGCGACCTCCGCCTCCCGGG + Intergenic
1042945184 8:74147154-74147176 CACTGTGACCTCCGCCTCCCAGG + Intergenic
1043576677 8:81666792-81666814 CACTGCAACCTGCGCCTCCCAGG - Intronic
1043581655 8:81721726-81721748 CACTGCGACCTCCGCCTCCCAGG - Intronic
1043874480 8:85468682-85468704 CACTGCGACCTCCGCCTCCCGGG - Intronic
1044481332 8:92692506-92692528 CACTGCGACCTCCGCCTCCCAGG + Intergenic
1045103390 8:98867336-98867358 CACTGGAACCTCCGCCTCCCAGG - Intronic
1045307823 8:100974012-100974034 CACTGCAACCTCCGCCGCCCAGG + Intergenic
1045369308 8:101505499-101505521 CACTGCAACCTCCGCGTCCCAGG - Intronic
1046774293 8:118147434-118147456 CACTGCAACCTGCGCCTCCCCGG + Intergenic
1046858384 8:119062553-119062575 CACTGCGACCTCCGCCCCCCGGG + Intronic
1047322109 8:123796533-123796555 CACTGTGACCTCCGCCTCCCGGG + Intronic
1047502455 8:125452737-125452759 CACTGCAACCTCCGCTGCCCTGG + Intergenic
1048383074 8:133885193-133885215 CACTGCAACCTCCGCTGCCCAGG - Intergenic
1049110491 8:140639403-140639425 CACTGCGACCTCCGCCTCCCAGG - Intergenic
1049328407 8:142036560-142036582 CACTGGAACCTCCGCCTCCCAGG - Intergenic
1049454532 8:142680373-142680395 GACTCGGACCTGCCCAGCCCCGG + Intronic
1049740043 8:144234966-144234988 CACTGTGACCTCCGCCTCCCAGG + Intronic
1050473729 9:6019418-6019440 CACTGCAACCTGCGCCTCCCGGG - Intergenic
1050581307 9:7060555-7060577 CACTGCAACCTCCGCGTCCCGGG + Intronic
1050685399 9:8163287-8163309 CACTTGTACCTGGGTGGCCCTGG - Intergenic
1050814050 9:9787059-9787081 CACTGCAACCTCCGCTGCCCGGG - Intronic
1051459831 9:17299165-17299187 CACTGCGACCTCCGCCTCCCAGG - Intronic
1051473343 9:17474790-17474812 CACTGCGACCTCCGCCTCCCAGG - Intronic
1052463259 9:28794904-28794926 CACTGCAACCTGCGCCTCCCAGG + Intergenic
1052559774 9:30070220-30070242 CACTGCAACCTGCGCCTCCCAGG - Intergenic
1053126873 9:35588625-35588647 CACTGCGACCTCCGCCTCCCAGG - Intergenic
1053251443 9:36577438-36577460 CACTGCAACCTGCGCCTCCCAGG - Intronic
1054743497 9:68831749-68831771 CACTGCAACCTCCGCTGCCCGGG + Intronic
1054789257 9:69239736-69239758 CACTGCGACCTCCGCCTCCCGGG - Intronic
1055024111 9:71701179-71701201 CACTGTGACCTCCGCCTCCCAGG + Intronic
1055044464 9:71910631-71910653 CACCTGCACCTGAGCGGCCCGGG + Exonic
1055323736 9:75106876-75106898 CACTGCAACCTCCGCGTCCCAGG - Intronic
1055437830 9:76310170-76310192 CACTGCGACCTCCGCCTCCCGGG - Intronic
1055574413 9:77647582-77647604 CACTGGCACCCGCGCGGCCCTGG - Intronic
1055957917 9:81791760-81791782 CACTGCAACCTCCGCCGCCCAGG + Intergenic
1056190866 9:84182657-84182679 CACTGCAACCTGCGCCTCCCTGG + Intergenic
1056268524 9:84923822-84923844 CACTGCGACCTCCGCCTCCCGGG - Intronic
1057142201 9:92734436-92734458 CACTGGAACCTCCGCTTCCCAGG - Intronic
1057257976 9:93566678-93566700 CACCGGGACCTGCGCGGTGGCGG - Intergenic
1057334241 9:94143310-94143332 CTCTGGGAGCTGCACTGCCCAGG - Intergenic
1057345760 9:94249281-94249303 CACTGCAACCTCCGCCGCCCGGG + Intergenic
1057395255 9:94674332-94674354 CACTGCAACCTCCGCGTCCCAGG - Intergenic
1057399075 9:94706711-94706733 CACTGCAACCTCCGCGTCCCAGG + Intergenic
1057602050 9:96466996-96467018 CACTGCAACCTCCGCTGCCCAGG + Intronic
1057783449 9:98069347-98069369 CACTGCAACCTCCGCTGCCCGGG + Intronic
1058398373 9:104582774-104582796 CACTGCGACCTCCGCCTCCCGGG - Intergenic
1060095666 9:120787102-120787124 CACTGGAACCTCCGCCTCCCGGG + Intronic
1060491767 9:124090523-124090545 CACTGCAACCTCCGCGTCCCAGG + Intergenic
1060612319 9:124978934-124978956 CACTGTAACCTCCGCTGCCCAGG + Intronic
1060697268 9:125720096-125720118 CACTGCGACCTCCGCCTCCCGGG + Intergenic
1060715131 9:125919287-125919309 CACTGCGACCTCCGCTTCCCAGG + Intronic
1060856010 9:126915215-126915237 CCCGGGGACCAGCGCGCCCCTGG - Intronic
1060950627 9:127599992-127600014 CACTGCAACCTCCGCCGCCCAGG + Intergenic
1061161008 9:128893952-128893974 CACTGCAACCTGCGCCTCCCGGG + Intronic
1061448329 9:130654677-130654699 CACTGGAACCTCCGCCTCCCAGG - Intergenic
1061484320 9:130912629-130912651 CACTGCAACCTGCGCCTCCCGGG - Intronic
1061556149 9:131370543-131370565 CACTGGAACCTGGGCGGCGGAGG + Intergenic
1061556150 9:131370551-131370573 CACTGCAACCTCCGCCGCCCAGG - Intergenic
1061591991 9:131603676-131603698 CTCTGGGACCAGCGTGGCACGGG - Intronic
1061678448 9:132231119-132231141 CCCTGGGACCTGAGCTGACCTGG - Intronic
1061682290 9:132248997-132249019 CACTGCGACCTCCGCCTCCCGGG - Intergenic
1061695989 9:132373988-132374010 CACTGGAACCTCCGCCTCCCAGG + Intergenic
1061772616 9:132937788-132937810 CACTGCGACCTTCGCCTCCCAGG + Intronic
1061812510 9:133170669-133170691 CACTGGAACCTCCGCCTCCCAGG + Intergenic
1061839081 9:133347438-133347460 CACTGCGACCTGTGCTTCCCGGG - Exonic
1061844707 9:133380575-133380597 CACTGCAACCTCCGCCGCCCGGG - Intronic
1061978743 9:134087726-134087748 CACTGTGACCTGGGCGGCCCTGG - Intergenic
1062275802 9:135729999-135730021 CACTGGGACCTGGGAGGTGCAGG + Intronic
1062494281 9:136824404-136824426 CACTGGAACCTCCGCCTCCCGGG + Intronic
1062587822 9:137257576-137257598 CACTGCGACCTCCGCCTCCCAGG + Intronic
1062603635 9:137332509-137332531 CACTGGAACCTCCGCCTCCCAGG - Intronic
1062613356 9:137385014-137385036 CACTGCGACCTCCGCCTCCCGGG - Intronic
1062660497 9:137629166-137629188 CACTGGAACCTCCGCCTCCCAGG + Intronic
1062718747 9:138023853-138023875 CGCTGGGGCCCGCGCCGCCCCGG - Intronic
1203522147 Un_GL000213v1:54461-54483 CACTGGGAACTGTGCCGCCAAGG - Intergenic
1203369845 Un_KI270442v1:292908-292930 CACTGAAACCTGCGCCTCCCGGG + Intergenic
1185618547 X:1438205-1438227 CACCGGGACCTCCGCCTCCCGGG - Intronic
1185892147 X:3831326-3831348 CACTGCAACCTGCGCTTCCCAGG + Intronic
1185897254 X:3869745-3869767 CACTGCAACCTGCGCTTCCCAGG + Intergenic
1185902373 X:3908177-3908199 CACTGCAACCTGCGCTTCCCAGG + Intergenic
1186673906 X:11795554-11795576 CACTGCAACCTCCGCTGCCCGGG + Intergenic
1187074521 X:15921003-15921025 CACTGCAACCTGCGCCTCCCGGG + Intergenic
1187074727 X:15922499-15922521 CACTGCAACCTGCGCCTCCCGGG - Intergenic
1187496771 X:19802309-19802331 CACTGGAACCTGGGAGGCGCAGG + Intronic
1187496772 X:19802317-19802339 CACTGCAACCTGCGCCTCCCAGG - Intronic
1187529560 X:20084123-20084145 CACTGGAACCTCCGCCTCCCGGG - Intronic
1187611727 X:20950830-20950852 CACTGCAACCTCCGCGTCCCAGG - Intergenic
1187859682 X:23668999-23669021 CACTGCAACCTCCGCCGCCCGGG + Intronic
1187886548 X:23894218-23894240 CACTGGAACCTCCGCCTCCCGGG + Intronic
1188472157 X:30553035-30553057 CACTGCAACCTGCGCCTCCCAGG - Intergenic
1188612717 X:32119256-32119278 CACTGAAACCTCCGCGTCCCAGG - Intronic
1188768773 X:34127904-34127926 CACTGTGACCTCCGCCTCCCAGG - Intergenic
1188857529 X:35214954-35214976 CACTGGAACCTTCGCCTCCCAGG - Intergenic
1188903830 X:35767660-35767682 CACTGCAACCTCCGCGTCCCAGG + Intergenic
1189445073 X:41073568-41073590 CACTGGAACCTCCGCCTCCCAGG + Intergenic
1189491183 X:41472872-41472894 CACTGGAACCTCCGCCTCCCGGG + Intronic
1189797801 X:44662610-44662632 CACTGCGACCTCCGCCTCCCGGG + Intergenic
1189809758 X:44770810-44770832 CACTGCAACCTGCGCCTCCCAGG + Intergenic
1189825080 X:44910260-44910282 CACTGCAACCTGCGCCTCCCGGG + Intronic
1190081960 X:47363637-47363659 CACTGTGACCTCCGCCTCCCGGG - Intergenic
1190253109 X:48742452-48742474 CACTGCGACCTCCGCCTCCCAGG - Intergenic
1190286432 X:48964438-48964460 CACTGGAACCTCCGCCTCCCGGG - Intronic
1190300378 X:49053782-49053804 CACTGCGCCCTGCTCGTCCCCGG - Intronic
1190679805 X:52816017-52816039 CACTGTGACCTCCGCCTCCCGGG + Intronic
1190833396 X:54079184-54079206 CACTGGGAGCTCCGCCTCCCGGG - Intronic
1190872999 X:54440460-54440482 GGCTGGGGTCTGCGCGGCCCTGG + Exonic
1191086326 X:56571496-56571518 CACTGCAACCTCCGCGTCCCGGG + Intergenic
1191857506 X:65639217-65639239 CACTGCGACCTCCGCTTCCCAGG + Intronic
1192115235 X:68404233-68404255 CACTGCGACCTCCGCCTCCCAGG + Intronic
1192201893 X:69071475-69071497 CACTGTGTCCTGCGGAGCCCGGG - Intergenic
1192471503 X:71403102-71403124 CACTGCAACCTGCGCCTCCCAGG + Intronic
1192509423 X:71713165-71713187 ATCTGGGACCTGCCCAGCCCAGG + Intergenic
1192517274 X:71768388-71768410 ATCTGGGACCTGCCCAGCCCAGG - Intergenic
1192569137 X:72188431-72188453 CACTGCGACCTCCGCCTCCCAGG + Intronic
1192747204 X:73951185-73951207 CACTGCGACCTCCGCCTCCCAGG + Intergenic
1195465412 X:105173806-105173828 CACTGCAACCTCCGCCGCCCAGG + Intronic
1195648843 X:107263690-107263712 CACTGCGACCTCCGCTTCCCAGG - Intergenic
1195702554 X:107716206-107716228 CACGGTGGCCTGCGCGCCCCAGG - Intronic
1196426349 X:115573777-115573799 CACTGCAACCTCCGCGTCCCAGG + Intronic
1196728742 X:118920981-118921003 CACTGCAACCTGCGCCTCCCGGG - Intergenic
1196813278 X:119645312-119645334 CACTGCAACCTCCGCGTCCCGGG + Intronic
1197162391 X:123338624-123338646 CACTGGAACCTTCGCCTCCCGGG + Intronic
1197208925 X:123813536-123813558 CACTGGAACCTCCGCCTCCCAGG - Intergenic
1197799033 X:130329754-130329776 CACTGGAACCTCCGCCTCCCGGG + Intergenic
1198737195 X:139799726-139799748 CACTGCGACCTTCGCCTCCCGGG + Intronic
1199270637 X:145878938-145878960 CACTGCAACCTGCGCCTCCCGGG - Intergenic
1199768921 X:150961192-150961214 CACTGCGACCTCCGCCTCCCAGG - Intergenic
1199770476 X:150972224-150972246 CACTGCGACCTGTGCCTCCCAGG + Intergenic
1200112355 X:153747600-153747622 CACTGCAACCTTCGCGTCCCGGG - Intergenic
1200118598 X:153780169-153780191 CACTGTGCCCTGTGCTGCCCTGG + Intronic
1200888243 Y:8294083-8294105 CACTGCAACCTGCGCCTCCCTGG - Intergenic
1201855097 Y:18532722-18532744 CACTGGGAGCTGGGCTGCACTGG - Intergenic
1201878224 Y:18787662-18787684 CACTGGGAGCTGGGCTGCACTGG + Intronic
1201894807 Y:18982071-18982093 CACTGGAACCTCCGCCTCCCAGG + Intergenic
1202376717 Y:24245117-24245139 CACTGGAACCTCTGCTGCCCAGG - Intergenic
1202494063 Y:25425002-25425024 CACTGGAACCTCTGCTGCCCAGG + Intergenic