ID: 900191897

View in Genome Browser
Species Human (GRCh38)
Location 1:1355597-1355619
Sequence GGTCCCAGTGGAGCACGCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 112}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900191894_900191897 -10 Left 900191894 1:1355584-1355606 CCGGGGCCGCGCAGGTCCCAGTG 0: 1
1: 0
2: 3
3: 22
4: 1241
Right 900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 112
900191888_900191897 6 Left 900191888 1:1355568-1355590 CCGCGCGGGGCCACCCCCGGGGC 0: 1
1: 0
2: 5
3: 24
4: 262
Right 900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 112
900191884_900191897 16 Left 900191884 1:1355558-1355580 CCAGCAGGCGCCGCGCGGGGCCA 0: 1
1: 0
2: 0
3: 24
4: 316
Right 900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 112
900191893_900191897 -9 Left 900191893 1:1355583-1355605 CCCGGGGCCGCGCAGGTCCCAGT 0: 1
1: 0
2: 1
3: 13
4: 172
Right 900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 112
900191892_900191897 -8 Left 900191892 1:1355582-1355604 CCCCGGGGCCGCGCAGGTCCCAG 0: 1
1: 0
2: 2
3: 18
4: 190
Right 900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 112
900191880_900191897 28 Left 900191880 1:1355546-1355568 CCGAGTACAAGTCCAGCAGGCGC 0: 1
1: 0
2: 0
3: 9
4: 94
Right 900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 112
900191890_900191897 -4 Left 900191890 1:1355578-1355600 CCACCCCCGGGGCCGCGCAGGTC 0: 1
1: 0
2: 2
3: 17
4: 218
Right 900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 112
900191891_900191897 -7 Left 900191891 1:1355581-1355603 CCCCCGGGGCCGCGCAGGTCCCA 0: 1
1: 0
2: 1
3: 13
4: 148
Right 900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900191897 Original CRISPR GGTCCCAGTGGAGCACGCGC TGG Exonic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
905519425 1:38586754-38586776 GGGCACAGTGGAGCACGGGGTGG + Intergenic
906032453 1:42732528-42732550 GGTGCCAGTGGAGCAGGGGTGGG - Intergenic
916048789 1:161020658-161020680 GGTGCGTGTGGAGCGCGCGCTGG + Intronic
920415036 1:205793439-205793461 GGTTCCAGTGCAGCACGTGGTGG - Intronic
923021527 1:230167789-230167811 GGCCACAGTGGAGCAGCCGCAGG - Intronic
923772367 1:236948704-236948726 AGTCCCTGTGGAGCAGGTGCTGG - Intergenic
924657175 1:245983458-245983480 GGTCCCAGGGGGCCACGTGCTGG - Intronic
1065920235 10:30386842-30386864 GGCCCCAGTGGGGCACACGTGGG - Intergenic
1067419483 10:46133949-46133971 GGTCCCACAGGAGCAGGCGGGGG + Intergenic
1067962888 10:50876336-50876358 TGTCCAAGTGGAGCACAGGCTGG - Intronic
1069827395 10:71262504-71262526 GGACCCAGAGGAGCCCGCCCGGG + Intronic
1070828989 10:79407245-79407267 TGTCCCAGAGGAGCACTCGGTGG + Intronic
1073297621 10:102450700-102450722 GGGCCGCGTGGAGCGCGCGCGGG - Exonic
1074317209 10:112370652-112370674 GGGCGCAGTGGAGCAGGGGCCGG - Intergenic
1075220817 10:120582855-120582877 GAGCCCAGTGGAGAACACGCCGG - Intronic
1081657271 11:44865797-44865819 GGTCTCAGTGGAGCAGGAACAGG + Intronic
1083903322 11:65654475-65654497 GCCCCCAGTGGAGCAGGAGCTGG + Exonic
1088367094 11:109051188-109051210 GGTCCAAGTGCAGAACGTGCAGG - Intergenic
1091282906 11:134391968-134391990 GGTCCCCGTGGAGCACCTGCCGG - Exonic
1102519810 12:113471266-113471288 CGCCCCAGTGGAGCGCGCGCAGG + Intronic
1103363680 12:120368385-120368407 GGCGGCAGTGGAGAACGCGCGGG - Intronic
1103447782 12:121005491-121005513 GGAGCCAGTGGAGGGCGCGCTGG + Intronic
1103909586 12:124344907-124344929 GGAGCCAGTGGTGGACGCGCCGG + Exonic
1106357028 13:28992665-28992687 GGGCCCAGGGGAGCATGCGAGGG - Intronic
1111257312 13:85687246-85687268 GGTACCAGTGGAGCACCCCTTGG - Intergenic
1113117121 13:106885405-106885427 GGGGACAGTGGAGCACGCACTGG - Intergenic
1113659137 13:112092795-112092817 GGTCCCAGAGGAGCCCGGGCAGG - Intergenic
1115768535 14:36647508-36647530 GGCCCCAGTCGAGGGCGCGCAGG - Intergenic
1117842091 14:59870556-59870578 GGTCCCAGTGGCTCAGGCACCGG - Exonic
1122038087 14:98962750-98962772 CAGCCCAGGGGAGCACGCGCGGG + Intergenic
1127972829 15:63975137-63975159 AGCCCCAGTGGAGCACATGCTGG - Intronic
1129051228 15:72783543-72783565 GGTCCCGGGGGCGCAGGCGCGGG + Exonic
1129405415 15:75313720-75313742 GGTCCCGGTGGGGCACACGTGGG + Intergenic
1132600218 16:769767-769789 GGTCCCAGGAGAGCAGCCGCAGG - Intronic
1136418342 16:30116935-30116957 GATCACAGTGGAGGAAGCGCTGG - Exonic
1136615848 16:31397931-31397953 GTTCCCTGTGGAGCACATGCTGG + Intronic
1141813002 16:86388745-86388767 GGTCTCAGTGGAGCACTGGCTGG - Intergenic
1146905955 17:36618042-36618064 GGTCCCAGTGGAGCAGCAGCTGG + Intergenic
1149500530 17:57149110-57149132 GGTCGCAGTGGGGCACGAGGGGG - Intergenic
1152616811 17:81341663-81341685 GGCTCCAGTGGAGGACGCGGTGG + Intergenic
1153752317 18:8245344-8245366 TGGCCCAGTGGAGCATGCACAGG + Intronic
1157721280 18:49926467-49926489 GGTCCCAGTGGGACAGGCTCTGG + Intronic
1159928669 18:74291343-74291365 GCTCCCAGGTGTGCACGCGCAGG + Intronic
1160228939 18:77032071-77032093 TGTCCCACTGGAGAAGGCGCCGG + Intronic
1161203286 19:3028012-3028034 GGTCCCAGAGGAGGAAGCGGGGG + Intronic
1161755534 19:6130875-6130897 GGCACCAGTGGAGGACGCACAGG + Intronic
1161799890 19:6411777-6411799 GGCCCCAGTGTAGCACTCGTCGG - Intergenic
1162841508 19:13359729-13359751 GGTCCCATTGGGGCAGGTGCGGG + Exonic
1163015146 19:14450370-14450392 CTTCCGAGTGGAGCACGCGGTGG + Exonic
1164728037 19:30479949-30479971 GGTTCCAAGGGAGCCCGCGCTGG + Intronic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
1167409244 19:49335307-49335329 TGTCCCAGTGGAGCAGGTGAGGG + Intronic
1168332984 19:55580491-55580513 GGTCCCGGTGGAGGAGGGGCTGG + Intronic
925173436 2:1766765-1766787 GCTCCCAGAGGAGCAGGTGCAGG + Intergenic
925559114 2:5168827-5168849 GGTCCCAGTGTAGCAGAAGCAGG + Intergenic
930476810 2:51892079-51892101 CGTCCCAGAGGGGCACCCGCTGG - Intergenic
941541716 2:166794241-166794263 GGTACCAGTGGAGCATGTCCAGG + Intergenic
944817650 2:203394728-203394750 GGTACCACTGGAGGACGCACTGG - Exonic
945668934 2:212778925-212778947 GGTCTCAGTGGAGCACGTCAAGG - Intergenic
946302348 2:218831708-218831730 GGTCCCAGGGGAGCCGGAGCCGG - Intronic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
948787766 2:240361880-240361902 AGGCCCAGTGGAGCAGGTGCCGG + Intergenic
1168800878 20:642566-642588 GGTCCCGGCGGCGGACGCGCGGG + Intergenic
1171444729 20:25195607-25195629 GGACCCAGTTGCGCAGGCGCGGG - Intergenic
1171866129 20:30488516-30488538 GGTCCCAAAGGCGCACGCCCGGG + Intergenic
1175859596 20:62143234-62143256 CTTCCAAGTGGAGTACGCGCAGG - Exonic
1175926085 20:62472292-62472314 GGTCCCAGTGGAGCAGGTGGTGG - Intronic
1179044566 21:37832754-37832776 GCTCCCAGTGGAGCCCCCACTGG - Intronic
1179881112 21:44293698-44293720 GGTCCCAGGGGAGAGCGCACAGG + Intronic
1180918675 22:19506984-19507006 GGTCCCAGTGGAGGGCTCTCCGG + Intronic
1184804923 22:46788557-46788579 GGTCCCAGTGGGGCTGGTGCTGG - Intronic
950680223 3:14580109-14580131 GGTCCCTGTGGGGCAGGGGCTGG + Intergenic
953992668 3:47496236-47496258 GTTCCCAGTGGAGCAGGTCCTGG - Intronic
954861593 3:53695168-53695190 GGTCCCCGTGGAGGAGGTGCTGG + Intronic
961412329 3:126731380-126731402 GGCCCCAGTGGAGCACAGGGTGG + Intronic
966863216 3:184241969-184241991 GGTCCCAGTGGCGCAGTAGCAGG - Exonic
966905976 3:184525996-184526018 GCTCCCAGTAGAGCCTGCGCAGG + Intronic
968051554 3:195658240-195658262 GGTCCGAGCGGAGCGGGCGCCGG + Intergenic
968104263 3:195990093-195990115 GGTCCGAGCGGAGCGGGCGCCGG - Intergenic
968302564 3:197627683-197627705 GGTCCGAGCGGAGCGGGCGCCGG - Intergenic
970032521 4:11692818-11692840 AGTCCCAGTGGATCACCTGCTGG + Intergenic
970491822 4:16582797-16582819 GGTCCCAGTGGAGCTGTGGCTGG - Intronic
972251592 4:37308554-37308576 GGTCCCTGGGGAGCATGCACAGG + Intronic
980698795 4:136395645-136395667 GGGCGCAGTGGAGCAGGCGGCGG - Intergenic
983576965 4:169270823-169270845 GGTCCCCGTCGACCCCGCGCCGG + Intronic
985111932 4:186555308-186555330 CGTCCCCGCGGAGCACGGGCTGG + Exonic
985497622 5:218493-218515 GGTCCGAGCGGAGCGGGCGCCGG + Intronic
985678524 5:1244387-1244409 GGTCCCAGAGGAGCACTCGGCGG - Intronic
988489098 5:31692045-31692067 GGGCGCAGTGGAGCACGGGGTGG + Intronic
988707582 5:33740896-33740918 GGAGACAGTGGAGCACGAGCTGG - Intronic
990488449 5:56281136-56281158 GGGCCCACTGGAGCAGGAGCTGG - Intergenic
993068910 5:83134003-83134025 GGTTCCAGGTGAGCACGGGCTGG + Intronic
994082144 5:95718867-95718889 GGTCCCAGGAGAGCACAAGCAGG + Intronic
997625300 5:135327129-135327151 CGTCCCAGAGAAGCCCGCGCGGG + Intronic
1000343919 5:160298511-160298533 AGGCCCAGGGGAGCAGGCGCTGG - Intronic
1001406528 5:171481003-171481025 GGTCCCAGTGGAGCCCCAGGTGG - Intergenic
1001902632 5:175444379-175444401 GATCCCCGCGCAGCACGCGCAGG + Intergenic
1002599601 5:180346657-180346679 GGCCCCAGGGGCGCACGCACTGG - Intronic
1006003828 6:30987269-30987291 GGTCCCACTGGAGGTCGTGCTGG - Exonic
1014673706 6:124339044-124339066 GGACCCAGTGGCTCACGGGCTGG + Intronic
1018054459 6:160040022-160040044 GCTCCCAGTGAAGCACGCCAAGG - Intronic
1018908796 6:168090123-168090145 GGTCCCAGTGGTGGACGTGGAGG - Intergenic
1019478272 7:1254550-1254572 GGTCCCAGAGGACCAGGCTCTGG - Intergenic
1019574782 7:1732128-1732150 GGTCACAGCGGAGCAAGCACAGG + Intronic
1022410344 7:30135026-30135048 GGCCCCGGAGGAGCCCGCGCAGG + Exonic
1026574454 7:71560569-71560591 GGTCCTAGTGGCGCAGGCACAGG + Intronic
1026680783 7:72465001-72465023 GGTCCCAGAGGAACACCCACTGG + Intergenic
1029485653 7:100838398-100838420 GGCCCTAGTGGGGCACGCGCAGG + Intronic
1031528539 7:122850244-122850266 GCCCCCAGTGGAGCAGGAGCTGG - Intronic
1035340522 7:158157774-158157796 TCTCCCAGGGGAGCAGGCGCAGG - Intronic
1035625780 8:1069363-1069385 GGTCTCACTGGAGGACGGGCCGG + Intergenic
1036708021 8:11059587-11059609 GGTGCCAGTGGAGGAGGAGCAGG + Intronic
1048886778 8:138915263-138915285 GTGCCCAGAGGCGCACGCGCTGG - Intergenic
1049225261 8:141447707-141447729 GGTTTCAGGGGAGCACGCCCTGG + Intergenic
1053135987 9:35650528-35650550 TGTCCCAGTGGACCAGGGGCCGG - Exonic
1055359288 9:75472155-75472177 GATCCCAGTGGAGTGCTCGCTGG + Intergenic
1061207865 9:129174898-129174920 GGTCAGAGGGGAGCGCGCGCCGG + Intergenic
1062339235 9:136086551-136086573 GGTCACAGTGGAGCCCGGGGTGG - Intronic
1062341238 9:136094811-136094833 GGTCCCTGGGGAGGCCGCGCGGG + Intronic
1062478596 9:136741449-136741471 GGTCCCACGGGAGCAGGGGCGGG - Intronic