ID: 900192660

View in Genome Browser
Species Human (GRCh38)
Location 1:1358078-1358100
Sequence CAGCCCCCGCTCCCAGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 657
Summary {0: 1, 1: 0, 2: 4, 3: 66, 4: 586}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900192660_900192664 0 Left 900192660 1:1358078-1358100 CCCAGGCCTGGGAGCGGGGGCTG 0: 1
1: 0
2: 4
3: 66
4: 586
Right 900192664 1:1358101-1358123 GAACAGACCCCACAGTTCTCAGG 0: 1
1: 0
2: 3
3: 10
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900192660 Original CRISPR CAGCCCCCGCTCCCAGGCCT GGG (reversed) Intronic
900089612 1:914191-914213 CAGCCCCCGCACCCCTCCCTGGG + Intergenic
900103001 1:970799-970821 CAGGCCCCTCTCCAAGTCCTGGG - Intronic
900119700 1:1043241-1043263 CAGGCCCCGTCCCCATGCCTCGG + Exonic
900142814 1:1145627-1145649 CTGCCCCTGCCCCCAGCCCTCGG - Intergenic
900186713 1:1336324-1336346 CAGCCCACGCAGTCAGGCCTCGG - Exonic
900189235 1:1346287-1346309 CATCCCCCAGTCCCAGGCCTGGG + Intronic
900192660 1:1358078-1358100 CAGCCCCCGCTCCCAGGCCTGGG - Intronic
900245019 1:1632662-1632684 CCACGCCCGCTCCCAGCCCTGGG + Intronic
900256250 1:1699821-1699843 CCACGCCCGCTCCCAGCCCTGGG + Intronic
900349966 1:2229745-2229767 CCTCCCCAGCTCCCAGGCCTGGG - Intronic
900563758 1:3322436-3322458 CAGCTCCAGCTCCTGGGCCTCGG + Intronic
900801576 1:4740348-4740370 CATCCCCCTCCCCCAGGCCCTGG - Intronic
901231174 1:7642386-7642408 CAGCCCCGGCTCCCAGAGCCAGG - Intronic
901250116 1:7771510-7771532 CACCGCCCACCCCCAGGCCTCGG - Intronic
901321401 1:8342431-8342453 CCTCCCACTCTCCCAGGCCTAGG + Intronic
901475303 1:9485325-9485347 CAGCTCCCTCTCCCAGTGCTTGG + Intergenic
901482840 1:9537901-9537923 AAGCCATTGCTCCCAGGCCTAGG - Intergenic
901553963 1:10017104-10017126 GAGCCACCGCACCCAGCCCTGGG + Intergenic
901794350 1:11671856-11671878 CCCCCCCCTCACCCAGGCCTTGG - Intronic
901797381 1:11688157-11688179 CTGCCCCCTCTCCCAGGCCCAGG + Intronic
902203161 1:14848920-14848942 CAGCCCCCGCTCCATGCACTTGG - Intronic
902717644 1:18283458-18283480 CTGGCCCAGCTCCCAGGCCTAGG + Intronic
902917234 1:19646044-19646066 CAGCCCCCAAACCCAGGCCACGG - Intronic
903257793 1:22114404-22114426 CAGCCACTGTTCCCAAGCCTTGG - Intergenic
903304481 1:22402943-22402965 CAGCCCCAGCACCCTGGCTTGGG + Intergenic
903499448 1:23793386-23793408 CAGCACCAGCCCCCAGCCCTAGG + Intronic
905187007 1:36203959-36203981 CTGGCTCCGCTCCCAGGCCGAGG + Intergenic
905442696 1:38005295-38005317 CCGCCCCCGCGCCCAGGCCGGGG - Intronic
905800359 1:40838835-40838857 CAGCGCCCGCTCCCACTCCCGGG - Exonic
905869600 1:41395491-41395513 CAGCCACCCCTCCCAGCCCCAGG + Intergenic
905971089 1:42142989-42143011 CTGCACCCACTCCCATGCCTTGG + Intergenic
906238958 1:44229727-44229749 CCGCTCCCGCTTCCAGGCCTTGG - Intronic
906675288 1:47688783-47688805 CGTCCACCCCTCCCAGGCCTGGG - Intergenic
906745705 1:48220906-48220928 GAGCCCCCTCACCCAGCCCTTGG - Intergenic
907281314 1:53349080-53349102 CAGCCCCACCTGCCAGGACTAGG - Intergenic
907286712 1:53385199-53385221 TACCCCCCGCTCCCCGGTCTTGG + Intergenic
907288511 1:53397421-53397443 CCTCCCCCACTCCCAGGCATTGG + Intergenic
907440747 1:54476645-54476667 AAGCCCCCTTTCCCGGGCCTGGG - Intergenic
907475230 1:54701025-54701047 CAATCCCCACTTCCAGGCCTTGG - Intronic
908138913 1:61162504-61162526 CAGCCATCCCACCCAGGCCTTGG - Intronic
910724923 1:90328294-90328316 CAGTCCCCATTTCCAGGCCTTGG + Intergenic
911039444 1:93580072-93580094 CAGCCCCACCTCCCAGGCCTGGG + Intronic
916442035 1:164836649-164836671 CATCCCCCACCCCCAAGCCTGGG + Intronic
916810561 1:168301881-168301903 CACCCCCTGCACCCATGCCTGGG - Intronic
917944460 1:179954857-179954879 CTGGCCCCGCTCCCCGGCCCGGG - Exonic
919712279 1:200739608-200739630 CCGCCGCCGCTCCCGGGCATAGG - Exonic
919805336 1:201377999-201378021 CAGCTGGCCCTCCCAGGCCTGGG - Intronic
920247342 1:204598292-204598314 GAGCCACCGCACCCCGGCCTGGG + Intergenic
920878760 1:209861116-209861138 CATCCACTGCCCCCAGGCCTAGG + Intergenic
920944722 1:210517541-210517563 CAGTCCCTACTCCCAGACCTTGG - Intronic
921060222 1:211578890-211578912 CAGCCCCCACACCCAGGCGGCGG + Intergenic
922547399 1:226468372-226468394 CACCCCACGCTCCCAGCTCTGGG - Intergenic
922562085 1:226576730-226576752 CACTCCCCCCTCCCAGGCCCTGG + Intronic
922748649 1:228060676-228060698 CAGCCCCTCCTCCCTGCCCTCGG + Exonic
922753423 1:228081733-228081755 CAGGCCCTGCCCCCGGGCCTCGG + Intergenic
924215054 1:241812471-241812493 CTGCCTCTGCTCCCAAGCCTGGG + Intergenic
924382588 1:243478088-243478110 CTTCTCCCGCCCCCAGGCCTCGG + Intronic
924415360 1:243850894-243850916 GAGCCTCCGCTCCCGGGCCTCGG - Intronic
924484772 1:244470998-244471020 CAGCCCTATCTCCCAGCCCTAGG - Intronic
924865116 1:247970781-247970803 CAGCCCCAGATCCCAGGCTCTGG + Intronic
924924715 1:248668200-248668222 CAGGTCCTGCTCCCAGACCTTGG + Intergenic
924952369 1:248896844-248896866 GATCGCCCGCTCCCAGGCCAGGG + Intergenic
1063664035 10:8051294-8051316 AAGCAGCCGCTTCCAGGCCTGGG + Intergenic
1064052326 10:12069202-12069224 CAGCCCCCGCTCCCACCGCCCGG - Intronic
1064219601 10:13429174-13429196 CATCCCCCACTCCCAGCCCCTGG - Intergenic
1065501947 10:26391793-26391815 CAGGGCCCGCTCCCGGTCCTGGG + Intergenic
1065680172 10:28222401-28222423 CAGCCTCAACTCCCAGGCCCAGG - Intronic
1065724549 10:28657100-28657122 GAGCCACCGCGCCCAGCCCTGGG - Intergenic
1068108485 10:52650452-52650474 CCTCCACCCCTCCCAGGCCTAGG - Intergenic
1069258754 10:66367037-66367059 CAGCCCACACACCCGGGCCTGGG + Intronic
1069686383 10:70321687-70321709 GAGCCCCTGCTGCCTGGCCTCGG - Intronic
1070329637 10:75408211-75408233 AAGCACCCGCTCCCAGGAGTTGG - Intergenic
1070772854 10:79092400-79092422 CACCTCCCTCTTCCAGGCCTTGG + Intronic
1070823860 10:79379753-79379775 CAGCTCCCGCACACAGCCCTGGG - Intergenic
1071186618 10:83053786-83053808 GAGCCACCGCTCCCAGCCCTAGG + Intergenic
1071563159 10:86658452-86658474 CAGCCCCTGCTCTGAGTCCTGGG - Intronic
1071896724 10:90075948-90075970 AAGCCCCTAATCCCAGGCCTTGG - Intergenic
1073139886 10:101240031-101240053 CAGCCCCCACTCCCAGGGATGGG - Intergenic
1073147053 10:101288002-101288024 CAGCCCCCACTCCCACCCCAAGG + Intergenic
1073179264 10:101574100-101574122 CAGCCCCCTCTGCTGGGCCTTGG - Intronic
1073300614 10:102469046-102469068 CAGACCCAGCAACCAGGCCTGGG - Exonic
1073333722 10:102688785-102688807 GAGCCACCGCACCCAGCCCTTGG + Intronic
1073491182 10:103854712-103854734 CTGCCCCCAGCCCCAGGCCTAGG + Intronic
1073803154 10:107065800-107065822 GAGCCACCACTCCCAGCCCTAGG + Intronic
1076191007 10:128483448-128483470 AAGCTCCTGCTGCCAGGCCTCGG + Intergenic
1076752135 10:132548609-132548631 CAGTCCCTGCTCCCGGCCCTGGG + Intronic
1076769265 10:132654238-132654260 CAGCCCCGGCTTCCCTGCCTGGG + Intronic
1076839386 10:133038604-133038626 CAGCCCCAGCTCCCAGGCCCGGG + Intergenic
1076839603 10:133039518-133039540 CATTCCCCAGTCCCAGGCCTGGG - Intergenic
1076852870 10:133101634-133101656 CAGCCCCCACAGCCCGGCCTCGG - Intronic
1077036696 11:498852-498874 CAGCTCCCGCAGCGAGGCCTTGG + Exonic
1077143915 11:1036438-1036460 CAGCCCCCGCTGCCAGGCCCGGG - Intronic
1077149356 11:1062562-1062584 CAGCTTCCACTCCCAGGGCTGGG - Intergenic
1077243884 11:1526518-1526540 CAGCGCCTGCTCCCTGCCCTGGG + Intergenic
1077307449 11:1874504-1874526 CAGGCCCGGCACCCAGGCCAGGG + Intronic
1077529222 11:3087467-3087489 CTGGCCCCGCACCCAGGCCGGGG - Exonic
1077615338 11:3670001-3670023 CACCCTCCACTCCCAGGGCTGGG + Intronic
1077886670 11:6392108-6392130 CAGCCAGGGCTCCCAAGCCTTGG - Exonic
1078133966 11:8637106-8637128 CAGCCCCCTCTCCCAGAGCTAGG + Intronic
1078798209 11:14615460-14615482 CATCCCTCTCTTCCAGGCCTTGG + Intronic
1079096821 11:17516499-17516521 AAGCCCCGGTTCCCAGGCCCTGG + Intronic
1079334022 11:19555427-19555449 CAGCCAACACTCCCAGACCTGGG + Intronic
1080509359 11:32952122-32952144 GAGCCACTGCGCCCAGGCCTTGG + Intronic
1080644964 11:34181687-34181709 CAGGCCCGGCTCCCAGGGCTGGG + Intronic
1081113154 11:39161968-39161990 GAGCCACCGCTCCCAGCCCCGGG - Intergenic
1081870501 11:46380855-46380877 CAAGCCCCTCCCCCAGGCCTCGG + Exonic
1082719199 11:56652773-56652795 AAGCGCCCGCCACCAGGCCTGGG - Intergenic
1082843839 11:57711636-57711658 GAGCCACCGCGCCCAGCCCTAGG + Intronic
1083158103 11:60837988-60838010 CAGCCCCATGTCCCAGTCCTAGG + Intergenic
1083277287 11:61603912-61603934 CAGCCCCGCCTCCCAGCCCTGGG - Intergenic
1083348826 11:62012968-62012990 TGGCCCCAGGTCCCAGGCCTTGG + Intergenic
1083398204 11:62405765-62405787 TAGCCCCCTCACCCAGGCCCGGG + Intronic
1083745380 11:64733311-64733333 CAGCACCGGCTCCCAGGACCAGG - Intronic
1083747621 11:64744600-64744622 CTGCCCCCTCTCCCAGACCCGGG + Intronic
1083936490 11:65872508-65872530 CAGGCCCAGGTCCCAGGCCCGGG + Intronic
1084041866 11:66547116-66547138 CAGCCCGGCCTCTCAGGCCTCGG - Intronic
1084112464 11:67023067-67023089 AACCCCTCGCTCCCACGCCTGGG - Intronic
1084391913 11:68882925-68882947 GAGCCCCCGCTCCCAGCCCCAGG + Intergenic
1084531220 11:69728954-69728976 CCACCCTCCCTCCCAGGCCTGGG - Intergenic
1084649173 11:70478602-70478624 CAGTCCCCACATCCAGGCCTCGG - Intronic
1084654075 11:70505227-70505249 AAGGCCCTGCTCTCAGGCCTTGG - Intronic
1084868733 11:72081136-72081158 GAGCCACCGCTCCCGGCCCTGGG - Intronic
1085510962 11:77088008-77088030 CACCCTGAGCTCCCAGGCCTGGG - Intronic
1085521991 11:77144463-77144485 CAGCCCCCACTCTCAGGGCCTGG - Intronic
1085538592 11:77244314-77244336 GAGCCACCGCGCCCAGCCCTGGG + Intronic
1086590527 11:88509335-88509357 CAGCGCCAGCGCCCAGGCCACGG + Exonic
1086927077 11:92652190-92652212 AAGCCTCTGCTCCCAGGCCTTGG + Intronic
1087032007 11:93715432-93715454 GAGTCCCCGATTCCAGGCCTTGG - Intronic
1089063754 11:115646429-115646451 CAGTCCCCAGTCCCAGTCCTCGG + Intergenic
1089165400 11:116472135-116472157 CAGCCCCAGCCCCCAGCTCTAGG + Intergenic
1089329051 11:117677269-117677291 CAGCCCCCGACCCCAGCCCTTGG - Intronic
1089384560 11:118059313-118059335 CTGCCCCCACCCCCATGCCTGGG - Intergenic
1090227996 11:125083068-125083090 CTGCCCTCCCTCCCAGCCCTGGG + Intronic
1090613443 11:128492864-128492886 CAGCCCCAGCTCCCAGCACATGG + Intronic
1090636960 11:128695159-128695181 CAGCCGCCGCCGCCAAGCCTGGG + Intronic
1091716801 12:2783495-2783517 CAGCCCCGACTCCCCTGCCTGGG + Intergenic
1094815485 12:34179302-34179324 CAGCCCCCCATCACAGGCCCTGG - Intergenic
1095052705 12:37568489-37568511 GAGCCACCGCACCCAGGCTTTGG + Intergenic
1095960068 12:47828873-47828895 CACCCCCCGGCCCCAGGCCCTGG - Intronic
1096387369 12:51203839-51203861 CAGGCACTGCTCCCTGGCCTTGG - Intronic
1096647706 12:53047501-53047523 GAGCCCCCGGCCCCAGCCCTGGG - Intronic
1096839487 12:54371573-54371595 CAGCCCCGGCTTCCTTGCCTGGG - Exonic
1097264751 12:57738524-57738546 CAGCGCCCCCACCCAGGCCGGGG - Intronic
1097717751 12:62984203-62984225 GAGCCACCGCGCCCAGCCCTGGG + Intergenic
1100986344 12:100204774-100204796 GAGCCCCCACTCCCAGCCTTTGG + Intronic
1102266680 12:111491904-111491926 AAGCTCCCGATCCCAGGCCCTGG + Intronic
1102544522 12:113645102-113645124 CAGCCCCCACTCCCAGAACCAGG - Intergenic
1102924299 12:116815155-116815177 CAGAGGCCACTCCCAGGCCTGGG + Intronic
1102933393 12:116879026-116879048 CAGCCTCCCCTTCCAGGCCCCGG + Intronic
1103272918 12:119688389-119688411 CAGCACCCGCTCCAGAGCCTGGG + Intronic
1103274475 12:119700205-119700227 CAGCCCACAGTCCCAGCCCTGGG - Intronic
1103547506 12:121712696-121712718 CGGCCCCGCCTCCCAGGCGTGGG + Intergenic
1103795346 12:123499439-123499461 CAGGCCCAGCTCCCTGTCCTTGG + Exonic
1103852333 12:123941250-123941272 CAGGCCCAGCTCCCAGTCCCAGG + Intronic
1103910584 12:124349943-124349965 CACCTCCACCTCCCAGGCCTGGG + Intronic
1103968707 12:124656076-124656098 CATCCCCCGCCCCCTAGCCTGGG - Intergenic
1104158772 12:126158716-126158738 GAGCCACCGCGCCCAGCCCTTGG + Intergenic
1104221325 12:126787449-126787471 CAGCCCCTGCTCCCAGAGCTCGG - Intergenic
1104437928 12:128770637-128770659 CAGCCTCATCTCCCAGGCTTTGG + Intergenic
1104607363 12:130199876-130199898 CATCCCACCCTCCCCGGCCTGGG - Intergenic
1104805334 12:131586165-131586187 CAGCCCCAGCTCCACGCCCTGGG - Intergenic
1104927811 12:132322652-132322674 CAAACCCCCCTCCCATGCCTGGG - Intronic
1106135230 13:26968599-26968621 AAGCCCCAGCTGCCAGGACTGGG + Intergenic
1106379531 13:29223148-29223170 CAGCCTGGGCCCCCAGGCCTTGG - Intronic
1106810004 13:33350153-33350175 CAGCCCGCTCGCCCCGGCCTTGG + Intronic
1106840138 13:33678154-33678176 GAGCCACTGCTCCCAGCCCTGGG + Intergenic
1110119884 13:71867032-71867054 CAGCCCTCGATCCCAGCCCCCGG - Intronic
1112306648 13:98280346-98280368 CAGCCTCAGCTTTCAGGCCTCGG + Intronic
1112567082 13:100560954-100560976 CAGCCCACTATCCCAGGCCCTGG - Intronic
1112686164 13:101830267-101830289 CTGCCTCCTCTCCCAGGCCCAGG - Intronic
1113541819 13:111115281-111115303 CCGCCGCCGCCCCCCGGCCTCGG - Exonic
1113552849 13:111206440-111206462 CTGCCCCTGCTCCCAGGGATGGG - Intronic
1113840092 13:113354283-113354305 CAGCCCCAGCTCCCAGCCTTGGG + Intronic
1113970478 13:114185138-114185160 CAGGACCTGCTCCCAGGCCCAGG + Intergenic
1114211930 14:20623080-20623102 CCGCCCCCGCTTCCCTGCCTGGG + Intergenic
1114463895 14:22906752-22906774 GAGCCACCGCGCCCAGCCCTGGG - Intronic
1114634690 14:24180790-24180812 CAGCCCCAGACCCCAGGTCTAGG + Intronic
1116286404 14:42978218-42978240 CCTCCCCTGCTCCCAGCCCTTGG + Intergenic
1118009174 14:61592070-61592092 CAGCCCCTCCCTCCAGGCCTGGG + Intronic
1118760836 14:68879437-68879459 AAGCCCATGCTCCCACGCCTTGG + Intronic
1120720689 14:87887327-87887349 CAGCCCCTGCTTCCAGCCCTTGG + Intronic
1121038794 14:90728211-90728233 GAGCCACCACTCCCAGCCCTGGG - Intronic
1121175785 14:91889778-91889800 CAGGCCCGGCACCCAGGCCTGGG - Intronic
1121559673 14:94865018-94865040 CAGCCACCGGCCCCAGGCCCCGG - Intergenic
1121958589 14:98237822-98237844 CATCCCCTGCTCCCAGTCCGTGG - Intergenic
1122090625 14:99336522-99336544 GAGCCACCGCACCCAGCCCTGGG + Intergenic
1122356726 14:101127097-101127119 CACCCCCAGCCCTCAGGCCTGGG + Intergenic
1122398387 14:101451427-101451449 AAGCCCCCCATGCCAGGCCTAGG + Intergenic
1122556854 14:102585238-102585260 CAGCCCCCTGTCCCAGGCCCTGG - Intergenic
1122703275 14:103604652-103604674 CAGCTCCCACTCCCAGTCCCTGG + Intronic
1122851395 14:104533960-104533982 GAGCCACCGCTCCCAGCCGTAGG + Intronic
1122857580 14:104567279-104567301 CAGCCCTGGCTCCCAGGACCGGG - Intronic
1123052178 14:105549806-105549828 CGGCCTCCGCACCCAGGCCTGGG - Intergenic
1202862404 14_GL000225v1_random:90748-90770 CAGCCACCGGCCACAGGCCTCGG - Intergenic
1125135603 15:36337419-36337441 GAGCCACCGCACCCAGGCTTTGG + Intergenic
1128037261 15:64537810-64537832 GAGCCACCGCGCCCAGCCCTAGG - Intronic
1128325760 15:66723043-66723065 AAGTACCAGCTCCCAGGCCTTGG + Intronic
1128374772 15:67066665-67066687 CAGCCCCAGCTCCCCGGAGTGGG - Intronic
1128650602 15:69409958-69409980 CTGCCCCTACTCCCAGGCCTTGG - Intergenic
1128692354 15:69734659-69734681 CACCCCCTGATCCCAGGCATCGG - Intergenic
1128758835 15:70201097-70201119 CCGCCCCCTCGCCCAGGCCCAGG - Intergenic
1128807229 15:70540082-70540104 CAGGTCTCGCTCCCAGGCCCTGG + Intergenic
1129154614 15:73709978-73710000 GAGCCCCTGCTCCCACCCCTAGG - Intronic
1129417302 15:75392944-75392966 GAGCCACCGCTCCCAGTCCCAGG - Intronic
1129456834 15:75680569-75680591 CAGCTCCCACTCCCACTCCTGGG - Intronic
1129792069 15:78348124-78348146 CACCCCCACCCCCCAGGCCTTGG + Exonic
1130843774 15:87725527-87725549 CAGCTCTCTCTCCCAGTCCTGGG + Intergenic
1131000920 15:88939284-88939306 CACCCCCAGCTTCCAGGCCCAGG + Intergenic
1131177563 15:90219682-90219704 CGGCCTCTGCTCCCAGGACTGGG - Intronic
1131367593 15:91853503-91853525 CAGCCCCAGCCCCAAGGCCTGGG - Intergenic
1132146568 15:99433030-99433052 CAGCTCCTGCTGCCGGGCCTGGG + Intergenic
1132314681 15:100880820-100880842 CAGCCCCAGCTCAGAGGCCTCGG - Intronic
1132389855 15:101430364-101430386 CACTCCCCTCTCCCAGGCCCTGG + Intronic
1132568223 16:632838-632860 CAGGCCCCGCAGGCAGGCCTCGG - Exonic
1132604610 16:788479-788501 CAGCCCCCGCGTCCTGTCCTGGG - Intergenic
1132611075 16:816557-816579 CAGCCCCCCTCCCCTGGCCTGGG + Intergenic
1132656517 16:1043908-1043930 CTCCCGCCTCTCCCAGGCCTGGG + Intergenic
1132802163 16:1759756-1759778 CAGAGCAGGCTCCCAGGCCTTGG - Intronic
1132828987 16:1918434-1918456 CCGCGCCCGCTCCCAGGCTGCGG - Exonic
1132856586 16:2047766-2047788 CAGCCCCGGGTCCCAGGCTCCGG + Exonic
1133286148 16:4691833-4691855 CAGCCCCCGCTCCCCTGCCCAGG + Intergenic
1133339781 16:5028703-5028725 CTGACCCTGCTCCTAGGCCTGGG + Intronic
1133350487 16:5097810-5097832 CTGCCCCCGCTCACTGCCCTGGG - Intergenic
1134117027 16:11556605-11556627 CACCTCCAGCTCCCATGCCTGGG - Exonic
1135588230 16:23687592-23687614 CAGCCCACGCTCCGAGGGCTTGG - Exonic
1135984701 16:27175591-27175613 AAGCCACCGCACCCAGCCCTTGG + Intergenic
1136622258 16:31436974-31436996 CAGCACCCGGCCCCAGGCCTCGG + Exonic
1137303022 16:47172198-47172220 GAGCCACCACACCCAGGCCTGGG - Intronic
1138651871 16:58465247-58465269 CAGCCCCCTCCCCCAGGTGTCGG - Intronic
1138971622 16:62151245-62151267 CAGCCCCCACTCCCCGCCCCCGG + Intergenic
1139428668 16:66899460-66899482 CAGCCCCCAATCCCAGGCATAGG - Intergenic
1139446247 16:67000459-67000481 CAGCCCCGGGGCCCAGGACTGGG - Intronic
1139750639 16:69107156-69107178 CAGCCCCCCGCCCCAGGTCTGGG + Intronic
1140030083 16:71328699-71328721 CAGCCTCCATTACCAGGCCTGGG + Intergenic
1140051384 16:71484451-71484473 CAGCCTCCGCTCCCCGGTCCCGG + Intronic
1140078516 16:71723558-71723580 CCGCGCCCGCGTCCAGGCCTCGG - Intronic
1140098638 16:71895788-71895810 CACGCCCCCCACCCAGGCCTGGG - Intronic
1141412556 16:83845399-83845421 CACCCGCCACTCTCAGGCCTGGG + Intergenic
1141603176 16:85138383-85138405 CAGCCTCCCCTCCCGGGCTTAGG + Intergenic
1141661415 16:85443651-85443673 CACCTCCTGCTGCCAGGCCTCGG - Intergenic
1141861273 16:86718111-86718133 CAGCCCCACCTCTCAGGCCAGGG - Intergenic
1141993071 16:87621367-87621389 CAGCCGCGGATCCCAGGTCTGGG - Intronic
1142131416 16:88433180-88433202 CAGCTCCAGCTCCCAGGGCCTGG + Exonic
1142173190 16:88633546-88633568 CAGCCCCCGGCCACAGCCCTAGG + Intergenic
1142688535 17:1591511-1591533 CAGCCCCCGCCCCCCAGCCGGGG - Intronic
1142807809 17:2380616-2380638 TAGCTCCTGCCCCCAGGCCTAGG + Exonic
1142855105 17:2724703-2724725 CAGGCCCCGCGCCCGGGCCCCGG - Intergenic
1143198924 17:5098518-5098540 GAGCCACCGCGCCCAGCCCTTGG - Intergenic
1143392940 17:6570932-6570954 CAGCCCCCGCCCTCATGCCCAGG + Intergenic
1143633368 17:8151167-8151189 CACCTCCTGCTCCGAGGCCTTGG - Intronic
1144268465 17:13594320-13594342 CAGCCTGCTCTCCCAGGCCCTGG + Intronic
1144648582 17:16991621-16991643 CAGCAGCCGCTCCCAGGCTCAGG + Intergenic
1144692948 17:17280876-17280898 GAGCCCCCTCCCCCCGGCCTGGG - Intronic
1144891001 17:18494375-18494397 CAGCCCCCGGCCCCAGGGCCAGG - Exonic
1145141222 17:20449943-20449965 CAGCCCCCGGCCCCAGGGCCAGG + Exonic
1145275503 17:21426983-21427005 CAGAGCCCAGTCCCAGGCCTGGG + Intergenic
1145313355 17:21712877-21712899 CAGAGCCCAGTCCCAGGCCTGGG + Intergenic
1145711802 17:26984833-26984855 CAGAGCCCAGTCCCAGGCCTGGG + Intergenic
1145779775 17:27554743-27554765 CATCCCCCGCTCCCTGTCCCTGG + Intronic
1145794698 17:27648990-27649012 CAGCCCCCGGCCCCAGGGCCAGG - Exonic
1145910106 17:28537403-28537425 CAGCCCCAGCTCCAAGCCCGTGG + Exonic
1146787510 17:35732245-35732267 AAGCCCCCGCTCTCAGCCTTGGG + Intronic
1146884848 17:36464086-36464108 CAGCCGCCACTCCCCAGCCTGGG - Intergenic
1147440347 17:40443707-40443729 CCGCGCCCGCGCCCAGTCCTCGG + Exonic
1147495276 17:40909499-40909521 CAGCACCCTCTCCCAGGCTCCGG + Intergenic
1148060135 17:44830329-44830351 CGCCCCCCGCTCCCGGGCCGCGG - Intronic
1148183078 17:45620609-45620631 CAGCGCCCACTCGTAGGCCTGGG + Intergenic
1148265773 17:46225082-46225104 CAGCGCCCACTCGTAGGCCTGGG - Intronic
1148360633 17:47009687-47009709 CAGCCTCCGCCCCCACGCCCCGG + Intronic
1148480026 17:47953990-47954012 CAGACCCTGCTGCCAGGCATGGG + Intronic
1148566102 17:48633889-48633911 CAGCCCCAGCCCCCGGGACTTGG + Intergenic
1148701494 17:49589624-49589646 CCCCCTCCTCTCCCAGGCCTGGG - Intergenic
1148766981 17:50045267-50045289 CTGGCCCCACTCCCAGGCCATGG + Intergenic
1149449673 17:56739813-56739835 CATCCCCCACTCCCAAGCGTTGG + Intergenic
1149521596 17:57322079-57322101 GAGCCACCGCGCCCAGGCCTTGG + Intronic
1149610323 17:57954777-57954799 CAGCCTGCGCCCCCAGGCCCGGG + Intronic
1150202658 17:63373561-63373583 CAGACCCAGCTCGCATGCCTAGG - Intronic
1150770447 17:68036169-68036191 CAGCCCCTGCCCCCACGCCGGGG - Exonic
1151066628 17:71158474-71158496 CAGCCCCAGTTCAAAGGCCTAGG + Intergenic
1151139278 17:71976127-71976149 CACCCCCAGCCCCCAGGGCTTGG - Intergenic
1151671460 17:75573740-75573762 CAGCCCACCCTCCCAGGCTCCGG + Intronic
1152009541 17:77703290-77703312 CATTCCCCTCTCCCAGGCCCTGG + Intergenic
1152205730 17:78973542-78973564 GAGCCCCCACTCCCCAGCCTTGG + Intronic
1152267739 17:79306127-79306149 CAGCCGCCGCCTGCAGGCCTCGG - Intronic
1152344137 17:79741500-79741522 CAGACCCTTCTCCCAGGGCTGGG - Intronic
1152474783 17:80510847-80510869 CGGCCCCTGCACCCAGGGCTTGG - Intergenic
1152476547 17:80522126-80522148 CACCCACCGCCCCCAGGCCCTGG + Intergenic
1152591143 17:81212947-81212969 CACACCCAGCTCCCAGACCTTGG + Intronic
1152598848 17:81251424-81251446 CAGCCCCCTCCCCCAGCCCTGGG - Intronic
1152600448 17:81259584-81259606 CAGCCGCAGCTCCGTGGCCTGGG - Intronic
1152714422 17:81891646-81891668 CAGCAGCCGCTCCGAGGCCGTGG - Intronic
1152789666 17:82272609-82272631 CAGTCACCGCTCCAAGGCCAAGG + Intronic
1152854883 17:82659035-82659057 CAGCCGCCTCTCCCAGCTCTCGG - Intronic
1203162052 17_GL000205v2_random:62332-62354 CAGCCCTCGCTCACAGCCCCGGG - Intergenic
1153838047 18:8981904-8981926 CTGGTCCCCCTCCCAGGCCTAGG - Intergenic
1154338699 18:13485727-13485749 GAGCCACCGCTCCTAGGCCTGGG - Intronic
1154954352 18:21241172-21241194 CAGCCGCGGCGCCCAGGCCCGGG - Intergenic
1156267936 18:35505145-35505167 CTGCCCCTGTTCCCAGGGCTGGG - Intergenic
1157553927 18:48600207-48600229 CAGCCCCAGCTCCCCACCCTGGG - Intronic
1158435145 18:57430265-57430287 CAGTCCCAGCCCCCAGTCCTGGG + Intergenic
1158885073 18:61819325-61819347 CAGCCCCCAGTGCCAGGCCAAGG + Intronic
1159586759 18:70289308-70289330 CGGCCCCCGTTCCCCGGCCCTGG - Intronic
1160228177 18:77027509-77027531 CAGACCCAGCTCCCCGCCCTCGG + Intronic
1160432445 18:78821051-78821073 CCGTCCCCACTTCCAGGCCTTGG - Intergenic
1160749104 19:725675-725697 CAGCCCCACCTCCCAAGCCTGGG - Intronic
1160823027 19:1067125-1067147 CAGGCCCCGCCCCCAGCCCCGGG - Intronic
1160902036 19:1433549-1433571 CTGCCCCCACGCCCAGGCCTTGG + Intronic
1160913269 19:1484531-1484553 GAGCCACCGCACCCAGCCCTTGG - Intronic
1160934135 19:1585254-1585276 CAGACCCCAAACCCAGGCCTCGG + Intronic
1161040577 19:2108930-2108952 CCGCACCAGCTCCCAGGCCTCGG + Intronic
1161076979 19:2290535-2290557 CAGCCGCCGCTCCCGGATCTTGG + Exonic
1161141317 19:2649860-2649882 CAGCCCCCGATCCCCAGCCCCGG + Intronic
1161292836 19:3504778-3504800 GATCCCCCTCTCCCAGCCCTTGG + Intergenic
1161316008 19:3618032-3618054 CTGCCCTCCCTCTCAGGCCTTGG - Intronic
1161337369 19:3721804-3721826 CAGCCCCCTCCCCCAGCCCGGGG + Exonic
1161339023 19:3730538-3730560 CGGCCCCGGCGACCAGGCCTCGG - Exonic
1161495401 19:4583557-4583579 GAGCCCCAGCTCCAAGGCTTGGG + Intergenic
1161526555 19:4759720-4759742 CAGCTCCCGCTCCCAGTCTCCGG - Intergenic
1162130121 19:8521335-8521357 CAGCCCCCGCCCCTGGGCCCTGG - Exonic
1162386366 19:10362521-10362543 CAGCCCCAGCCCCCAGCCCTGGG + Intronic
1162523405 19:11194680-11194702 CAGCCCCCCAACCCAGGTCTGGG + Intronic
1162869470 19:13574759-13574781 GAACCACCGCTCCCAGCCCTGGG + Intronic
1162893084 19:13747999-13748021 CAGCCGCCTCACCCTGGCCTCGG + Intronic
1162893923 19:13753287-13753309 GAGCCACCGCGCCCAGCCCTTGG - Intronic
1163129591 19:15264291-15264313 CAGCCACCGTTCCAGGGCCTGGG + Intronic
1163456010 19:17406021-17406043 CAGGCCCCGCCCCCAGACCCAGG - Intronic
1163466335 19:17470368-17470390 CAGACTCCGCCCCCAGGCCTGGG - Intronic
1163485768 19:17584616-17584638 CAGCCCCCTCTCCCTGGGGTGGG - Intergenic
1163513201 19:17748113-17748135 CAGCCCCAGAACCCAGACCTAGG - Intronic
1163612815 19:18309909-18309931 CCTCCCGCGCTCCCAGGGCTGGG - Intronic
1164398736 19:27888325-27888347 CAGCCTGCAATCCCAGGCCTGGG - Intergenic
1164564017 19:29313030-29313052 CACTCCCCTCTCCCAGTCCTAGG - Intergenic
1164647758 19:29872315-29872337 CAGCCCCTGCTCCCCGCCCGCGG + Intergenic
1164834707 19:31349722-31349744 CGGCCCCCGCCCCTAGGCCGGGG + Intergenic
1165243092 19:34482409-34482431 CAGCCTCGGCTCCCGGGGCTCGG + Exonic
1165349788 19:35269308-35269330 CCGCCCCCGGCCCCCGGCCTCGG + Intronic
1165421404 19:35723805-35723827 CAGCTCCCGCCCCCCGGCGTGGG - Exonic
1165454060 19:35900603-35900625 CAGGGCCCGCCCACAGGCCTGGG + Exonic
1165476803 19:36035343-36035365 CAGCCCCACCGCCCACGCCTGGG - Exonic
1165591129 19:36970956-36970978 GAGCCACCGTGCCCAGGCCTGGG - Intronic
1165795330 19:38516071-38516093 CAGCCCCGTCTTCCAGGCTTCGG + Exonic
1166840007 19:45691653-45691675 GAGCCCCCGCGCCCAGCCCAGGG + Intronic
1167342018 19:48921941-48921963 CAGCCCCTCCTCCCTGGACTAGG - Intronic
1167674802 19:50877537-50877559 CGGCCCCTCCTCCCAGGCCTGGG - Intronic
1167684879 19:50950027-50950049 CGGCCCCAGCTCCCAGGTCCTGG + Exonic
1167694521 19:51006966-51006988 AAGCCCCCGCTCCTAGTCCCAGG + Intronic
1167740290 19:51320486-51320508 CAGCCCCCACTCCCTGGCCCTGG + Intronic
1167796751 19:51714263-51714285 GAGCCACCGCGTCCAGGCCTAGG - Intronic
1168144977 19:54415692-54415714 CAGCCCTGGCCCCCAGGCCCTGG - Intronic
1168429266 19:56264835-56264857 GAGCCACCGCGCCCAGCCCTAGG - Intronic
925462476 2:4075355-4075377 CAGGGCCCTCTCCCTGGCCTGGG + Intergenic
925869124 2:8253957-8253979 CACCCCCCACCCCCAGGCCTGGG + Intergenic
925905091 2:8535418-8535440 TCTCCTCCGCTCCCAGGCCTGGG + Intergenic
926116614 2:10217610-10217632 CAGACCACTCACCCAGGCCTGGG - Intergenic
927181075 2:20447197-20447219 AAGCCGCCGATCCCCGGCCTGGG + Exonic
927502882 2:23593933-23593955 CAGACCCTTCTCCCAGGCCCGGG - Intronic
927725039 2:25415614-25415636 CAGCCCCTTCCACCAGGCCTTGG + Intronic
927846322 2:26474352-26474374 CAGCCCCAGCCCCCAGCCCCAGG + Intronic
928364683 2:30691889-30691911 CAGCCCCCACTCAGAGGCCTTGG + Intergenic
929599323 2:43195042-43195064 CAGTCCCCGCCCCCAGCGCTCGG - Intergenic
929770215 2:44885571-44885593 CATCCCCAGCTTCCAGTCCTGGG + Intergenic
931012160 2:57929503-57929525 CAGTCCCTGATTCCAGGCCTTGG - Intronic
932566916 2:72916452-72916474 AAGGCGCCGCTCCGAGGCCTAGG - Intronic
934619004 2:95792726-95792748 CACCCAACTCTCCCAGGCCTGGG - Intergenic
934641887 2:96031831-96031853 CACCCAACTCTCCCAGGCCTGGG + Intronic
935570800 2:104658908-104658930 GAGCCACTGCACCCAGGCCTGGG - Intergenic
937026260 2:118700075-118700097 CAGCCCCCGCTTCAAGGGCAAGG + Intergenic
937225799 2:120368043-120368065 CAGCCCCCAATCCCAGCCATGGG - Intergenic
937232420 2:120405881-120405903 CAGTCCCCTTTGCCAGGCCTGGG - Intergenic
937287526 2:120762687-120762709 CAGCACCAGCCCCCAGGCCCTGG + Intronic
937288462 2:120767675-120767697 CAGCCCCCACTGCCTCGCCTGGG + Intronic
937418660 2:121737227-121737249 CAGACCCCGCTGCCGCGCCTCGG - Intronic
938796132 2:134719214-134719236 CGGCTCCCGCGCCCGGGCCTTGG - Intergenic
940597677 2:155815766-155815788 CTGCCCCAGCTCCAAGGCCTAGG - Intergenic
940789460 2:158016621-158016643 CAGCCACTGCACCCAGCCCTGGG + Intronic
940981355 2:160007341-160007363 CAGCCTCTGCCCCCAGACCTAGG + Intronic
941962675 2:171269246-171269268 GAGCCACCGCTCCCAGCCCGAGG - Intergenic
946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG + Intronic
947525762 2:230875819-230875841 CACCCCCCACCCCCAGGCCCTGG - Intronic
947536130 2:230941413-230941435 CTGCCCCCGCTCCCAGACCCAGG + Intronic
947761454 2:232606506-232606528 CATCCTCCGCTCCCAGTCGTGGG + Intronic
948139387 2:235661495-235661517 CAGCCCCCTTTCCCATTCCTAGG - Intronic
948552907 2:238786532-238786554 CAGCTCCCACTGCCAGGCTTCGG - Intergenic
948805612 2:240452532-240452554 GAGCCCCTGCACCAAGGCCTGGG + Intronic
1168762131 20:356476-356498 CAGCCCCCTCTCCCACACCCTGG - Intronic
1169076090 20:2760535-2760557 CGGCCCCCACCCCCAGGCCTAGG + Intergenic
1170562765 20:17570567-17570589 CGCCCCCCACTCCCCGGCCTCGG - Intronic
1171011366 20:21510947-21510969 CGGGCCCGGCTCCCAGGCCCAGG + Intergenic
1171413834 20:24964174-24964196 CAGCTCCCACTCCCAGCCCAGGG + Intronic
1171529567 20:25843899-25843921 GAGCCACCGCACCCAGGCTTTGG - Intronic
1171547259 20:26011981-26012003 GAGCCACCGCACCCAGGCTTTGG + Intergenic
1171951143 20:31423726-31423748 CAGCCCATCCTCCCAGGCCCTGG + Intergenic
1172037110 20:32018517-32018539 CAGGCCCCGCCCCCAGCCCAAGG - Intronic
1172312577 20:33929915-33929937 CAGACCCAGCTCCCTTGCCTGGG + Intergenic
1172421878 20:34825239-34825261 GCGCCCCCGCCCGCAGGCCTGGG + Intronic
1172778121 20:37419957-37419979 CAGCCCACTCGCCCAGGCCAGGG + Intergenic
1172793623 20:37522759-37522781 AGGCCCCAGCTCCCAGCCCTGGG + Exonic
1172952463 20:38730789-38730811 CACCCCTCGGCCCCAGGCCTGGG - Intergenic
1173071764 20:39775042-39775064 CAGACCATGCTCCCAGGCCCTGG - Intergenic
1174441901 20:50562291-50562313 CAGCCACCACTCCCAGCCATGGG - Intronic
1174576587 20:51542068-51542090 CAGCACCCGCCCCCCAGCCTTGG + Intronic
1175402143 20:58707001-58707023 CTTCCCCAGCTCTCAGGCCTGGG - Intronic
1175515114 20:59564462-59564484 CAGCGTCCGCCCCCAGGCCAAGG + Intergenic
1175939882 20:62532989-62533011 CAGCCCCCACCTTCAGGCCTGGG - Intergenic
1175946709 20:62562323-62562345 CACCCCACGCTCTCCGGCCTTGG - Intronic
1175960155 20:62631760-62631782 CAGGACCCACTCCCAGGCCCAGG - Intergenic
1176101037 20:63364746-63364768 CAGCCCCCGCCCCCCACCCTGGG + Intronic
1176101114 20:63365025-63365047 CAGCCCCAGGTCCCAGTGCTGGG + Intronic
1176137290 20:63529823-63529845 CAGCCTCAGCTGCCATGCCTTGG + Intronic
1176239195 20:64068059-64068081 CCTCCCCCGCTCCCTGGCTTTGG - Exonic
1177619460 21:23568305-23568327 TAGACCCCTCTCCTAGGCCTAGG - Intergenic
1178495329 21:33081277-33081299 CACCCCCCTCGACCAGGCCTAGG + Intergenic
1178853654 21:36233317-36233339 CAGACCCCACTCCCAGGCAGGGG - Intronic
1178854154 21:36237068-36237090 GAGCCACCGCTCCCAGCCTTTGG + Intronic
1179068916 21:38053675-38053697 CAGCTCCAGCTCCATGGCCTGGG - Intronic
1179505530 21:41837523-41837545 CAGCCCCCTCCCCCAGCCCCTGG - Intronic
1179547212 21:42120839-42120861 CAGATCCCCCTCCCAGCCCTGGG + Intronic
1179641601 21:42751300-42751322 CAACCGCCCCTCCCAGCCCTGGG + Intronic
1179723727 21:43330399-43330421 CAACCCCAGGTCCCAGTCCTTGG + Intergenic
1179904147 21:44413577-44413599 CAGCACCAGGTCCCAAGCCTGGG - Intronic
1180054162 21:45348661-45348683 GAGCCCCCGCCCTCAGCCCTTGG - Intergenic
1180078145 21:45473553-45473575 CTGCCCGCCCTCCCAGGCCTTGG + Intronic
1180868111 22:19131198-19131220 CAGTCCCCGCCCCCACTCCTTGG + Exonic
1181023443 22:20114988-20115010 CAGCCGCCGCCACCAGGCCATGG - Exonic
1181363599 22:22357352-22357374 CTGCCCCCGCTCCCAAGTCCCGG - Intergenic
1181785473 22:25223673-25223695 TAGCCCTCTCTCCCAGGCCTGGG - Intronic
1181855338 22:25777498-25777520 CAGCGCCCCGCCCCAGGCCTAGG - Intronic
1182509611 22:30809569-30809591 CACTCCCCAGTCCCAGGCCTTGG - Intronic
1182857935 22:33534667-33534689 CAGCCCCGCCTCGGAGGCCTGGG - Intronic
1183396473 22:37574229-37574251 GAGCCACCGCTCCCAGCCCTGGG - Intronic
1183432623 22:37774836-37774858 CAGGCCTCTCTCTCAGGCCTGGG - Exonic
1183486316 22:38089297-38089319 CAGCCCCCACCCCCAGTCCCAGG + Intronic
1183488964 22:38106715-38106737 CAGCCCCTGCGCCCAAGCCCTGG + Intronic
1183493416 22:38128522-38128544 CTGTCCCAGCTCCCAGGCCCTGG + Intronic
1183528919 22:38341790-38341812 GAGCCACCGCACCCAGCCCTCGG + Intronic
1183581130 22:38727326-38727348 TAGCCCGCGCTACCAGGCCATGG + Exonic
1183581223 22:38727753-38727775 CATCCCCCACCCCCAGGCCCTGG - Intronic
1183700001 22:39445880-39445902 CAGCCACCCCTGCCAGGCGTTGG - Intergenic
1183949644 22:41345735-41345757 CACCCCCTGCTGCCAGGACTTGG - Intronic
1184177137 22:42794855-42794877 CAGGCCCCGCTCCCTGCCCCTGG + Intergenic
1184347817 22:43924146-43924168 GATCCCCCGCTCCCCGGCCTAGG - Intronic
1184478495 22:44734463-44734485 CAGCCTCATCTCCCGGGCCTTGG + Intronic
1184479620 22:44738862-44738884 CAGCCTCGGGACCCAGGCCTGGG + Intronic
1184653571 22:45930382-45930404 CGGCTCCGGCTCCGAGGCCTGGG - Intronic
1184783540 22:46660850-46660872 CTGCACCTGCTCACAGGCCTTGG + Intronic
1184789431 22:46690269-46690291 CAGCGCTCGCTGTCAGGCCTGGG - Intronic
1184797025 22:46738423-46738445 CGGCCCCAGCGCCCTGGCCTCGG - Intergenic
1184797296 22:46739542-46739564 CAGCTGCCGCTCTGAGGCCTGGG + Intergenic
1185105562 22:48867580-48867602 CACCCACCGTTCCCAGGCCCCGG - Intergenic
1185170163 22:49288760-49288782 CACCCCCAGCACCCAGGCCTTGG + Intergenic
1185409318 22:50674145-50674167 CTCCCCCCGCACCGAGGCCTAGG + Intergenic
949890541 3:8730620-8730642 GAGCCCCCTCTCTGAGGCCTGGG - Intronic
950178057 3:10889875-10889897 CTGCCCTCGCTCCCATGCCAGGG + Intronic
950217304 3:11168734-11168756 CAGCCCGCACCCCCAGCCCTGGG - Intronic
950333838 3:12178132-12178154 CAGGCCCCGCTCCCTGGTCTAGG - Intronic
950443542 3:13023338-13023360 AAGCCCCAGCTGCCTGGCCTGGG - Intronic
950669713 3:14518714-14518736 CAGCCCCCCTCCCCAGGGCTTGG + Intronic
950946130 3:16948348-16948370 CAACCCCCGACCCCAGCCCTAGG - Intronic
952334967 3:32396120-32396142 CAACCCCTGCTCCCTGACCTAGG - Intronic
952347514 3:32502559-32502581 CAGACCCCGCTCCCCAGCCCGGG + Intronic
952884368 3:38003470-38003492 CACGCTTCGCTCCCAGGCCTGGG + Intronic
952886648 3:38016544-38016566 CAGCCCCAGCACCCAGTGCTGGG + Exonic
953454450 3:43030700-43030722 AAGCCCATGCTCCCAGGGCTGGG + Intronic
953493652 3:43369194-43369216 CAGCCCCTTCTCTCAGGCCCAGG + Intronic
953993459 3:47501700-47501722 CAGCCACCGCCCCCATGCCCAGG + Exonic
954631767 3:52051650-52051672 CAGCCCCCAGTCCCAGGTCATGG - Intronic
954663475 3:52238120-52238142 CACCCCCAGCCCCCAGCCCTAGG - Intronic
954685356 3:52367200-52367222 GGGCCCCTGCTCCCAGGCCGGGG + Intronic
958771760 3:98434030-98434052 CAGTCCCCTGGCCCAGGCCTTGG + Intergenic
960576287 3:119233090-119233112 GAGCCACCGCACCCAGCCCTGGG + Intronic
960704512 3:120469065-120469087 CAGCCACCATTCCCAGGGCTAGG - Intergenic
962367495 3:134795961-134795983 CAGCCCCCGCTCGGAGAGCTCGG + Intronic
962745497 3:138394875-138394897 CAGCACCCACTCCCCGCCCTCGG + Intronic
963091416 3:141486970-141486992 CTGGCCCCGCCCCCGGGCCTCGG - Intergenic
963290730 3:143484573-143484595 CAACACCCGCTCCCAGCCCTAGG - Intronic
965030951 3:163367342-163367364 CAGGCCCCACTTCCAGGCATGGG - Intergenic
967036169 3:185649678-185649700 CAGCCTCCGCTCACAGACCTGGG + Intronic
967318985 3:188177279-188177301 CAGCCCTCCTTCCCAGGCCTGGG - Intronic
967685291 3:192409925-192409947 GAGCGCCCCCTCCCGGGCCTGGG - Intronic
968084429 3:195868057-195868079 CGGCCCCCTCTCCCAGCCCGGGG - Exonic
968353224 3:198080303-198080325 GAGCCCCCGCTACCTGTCCTGGG + Intergenic
968631770 4:1655573-1655595 CAGTCCCCGCGCCCAGGCGCAGG - Exonic
968658057 4:1787115-1787137 CCGACCCCACTCCCAGGCCAAGG + Intergenic
968779643 4:2570773-2570795 CAGGCCCCACTCCCCGGCCTGGG + Intronic
969423080 4:7108493-7108515 CAGCCACCCCTACCATGCCTCGG + Intergenic
969459659 4:7322242-7322264 CTGCTCCCACTCTCAGGCCTGGG - Intronic
969582296 4:8072402-8072424 CTGCCCCCGACCCCAGGCCAGGG + Intronic
969660335 4:8523624-8523646 CAGCCCCAGCTCCTATGCCCAGG + Intergenic
969848002 4:9934811-9934833 CAGCCCCTGCCCACAGGCCCTGG + Intronic
969858585 4:10018941-10018963 CAGCGCCCTCTGCCGGGCCTTGG + Intronic
969961776 4:10952010-10952032 CCGCCCCACCTCCCAGGCCATGG + Intergenic
972282186 4:37613049-37613071 CAGCCCCTAATCCCAGGCCTTGG - Exonic
972400989 4:38703521-38703543 CAGAGACCGCTCCCATGCCTTGG - Intergenic
973155605 4:46947965-46947987 CAGCCTCAACTGCCAGGCCTGGG - Intronic
973228956 4:47820004-47820026 CAGCCCCATCTCCCAGGGTTTGG + Intronic
973310980 4:48709202-48709224 GAGCCACCGCACCCAGCCCTAGG + Intronic
975147269 4:70982154-70982176 AAGCCCCCGCCCCCAAACCTAGG - Exonic
975898421 4:79122032-79122054 CAGCCAACCCTCCCAGCCCTGGG + Intergenic
978257053 4:106704862-106704884 AAGCCCCTGCTCCAAGGGCTTGG + Intergenic
978393538 4:108253031-108253053 CCCCCCCCGCCCCCAGGACTAGG - Intergenic
978503687 4:109434219-109434241 CGGCCCCCGCCCCCACGCCAGGG - Intronic
979540027 4:121870424-121870446 CAGCCCCAGCTACCGCGCCTAGG + Exonic
981449584 4:144880810-144880832 CAGCCTCGGCTCACAGGACTTGG - Intergenic
984314093 4:178103678-178103700 GAGCCCCCACACCCAGCCCTAGG + Intergenic
985432454 4:189894089-189894111 CAGCCCCTGCACTCCGGCCTAGG + Intergenic
985513707 5:326256-326278 CAGTCCCTGCTCCCAGGTCCTGG + Intronic
985778307 5:1856896-1856918 ACGCCCCCGCTCCCAGGGCCGGG + Intergenic
986009346 5:3698341-3698363 CCGACCCCACTCCCAGGGCTGGG + Intergenic
987079829 5:14416850-14416872 CAGCCCCCACTCCCAGACGCTGG - Intronic
987083246 5:14445230-14445252 CAGCCCCCACTGCCACTCCTTGG - Intronic
987317588 5:16738296-16738318 CCACCCCTGCTCCCAGGCCTGGG - Intronic
990304892 5:54484373-54484395 CAGGCCTCTCTCCCAGGCTTTGG - Intergenic
992741090 5:79774305-79774327 CAGCCCCCGCGCACAAGCCGGGG - Intronic
994024527 5:95067070-95067092 GAGTCCCCCATCCCAGGCCTTGG - Intronic
994367051 5:98928582-98928604 CCTCCCCCGCGCCCAGGCCCGGG + Exonic
995759866 5:115551751-115551773 CCACCTCCTCTCCCAGGCCTGGG + Intergenic
997210441 5:132073892-132073914 CAGCCCCAGCACGCAGCCCTGGG + Exonic
997733736 5:136198736-136198758 AAGCCCCCTCTCCCAGCCTTTGG + Intergenic
998039795 5:138944917-138944939 CAGTCCCACCTCCCAGGCCTCGG + Intergenic
999126403 5:149249496-149249518 CAGACCCCGCAGCCAGGGCTTGG - Intronic
999389898 5:151182385-151182407 CTGCCCCTGATCCCAGGCCCAGG - Exonic
1001009652 5:168086206-168086228 CAGCCCCCGCTCCACGGTCTAGG + Intronic
1001470049 5:172005963-172005985 CAGCACCCACTCCCCAGCCTAGG - Intronic
1002046202 5:176543087-176543109 CAGCTCCCGCTGCCGGGCCCGGG + Intronic
1002104658 5:176874184-176874206 CTGCCCCAGCTCCCACGCCAAGG + Intronic
1003397472 6:5765453-5765475 CAGCCCACGCTCCCTGCCATTGG - Intronic
1003405642 6:5825006-5825028 CAGCCCCCACCACCATGCCTGGG + Intergenic
1004113966 6:12749272-12749294 CAGCCCCAGTTTCCAGCCCTTGG - Intronic
1004597097 6:17110333-17110355 TAGCCCCTGCTCCCCAGCCTGGG + Intronic
1005844039 6:29763537-29763559 GAGCCCGCCCTTCCAGGCCTGGG + Intergenic
1006416064 6:33904574-33904596 CAGCCACCCCTCCCGGGGCTTGG + Intergenic
1006455781 6:34131004-34131026 CTGCCTCAGCTCCCAGGCCAGGG + Intronic
1007073069 6:39050195-39050217 CAGCGCCCCCAGCCAGGCCTTGG + Intronic
1007224459 6:40303097-40303119 CAGCACCTGCAGCCAGGCCTGGG + Intergenic
1007264821 6:40588069-40588091 CAGCCCCCACTCCCAGCCTAGGG - Intergenic
1007369062 6:41414204-41414226 CAGCCCCTGCTGCAGGGCCTGGG + Intergenic
1007392539 6:41558354-41558376 CACCCCCCTCTCCCAGCCCTTGG - Intronic
1007584202 6:42978866-42978888 CCGCGCCCGCACCCAGGCCCCGG + Exonic
1007889106 6:45269944-45269966 CACTCCCTGCTCCCAGCCCTAGG + Intronic
1008096200 6:47342251-47342273 AGGCCCCCTCTCCCAGACCTTGG - Intergenic
1010393177 6:75359858-75359880 CAGGCCCTGTTCCCAGGCCTAGG - Intronic
1011241282 6:85273921-85273943 CACCCCCCCTTCCCAGTCCTGGG + Intergenic
1015249503 6:131112423-131112445 CACACCCCTCTCCCAGCCCTAGG + Intergenic
1015785796 6:136921358-136921380 CAGCCTCCCCTCCCACGCTTCGG + Intergenic
1016023568 6:139260942-139260964 CAGGCCTCACTCCCAGACCTCGG - Intronic
1016061575 6:139636366-139636388 GAGTCCCCACTTCCAGGCCTTGG - Intergenic
1016904691 6:149137088-149137110 CAGCCCTCCCTCCCAAGGCTGGG - Intergenic
1017016097 6:150100697-150100719 CACCCCCAGCTTCCAGGCCCCGG - Intergenic
1017297978 6:152821511-152821533 CAGGCTACGTTCCCAGGCCTAGG - Intergenic
1017811878 6:157989678-157989700 CAGCCTCTGCTCCCAGTGCTGGG - Intronic
1017971470 6:159315739-159315761 CAGCGCCCGCGCCCTGTCCTAGG + Intergenic
1018331060 6:162727777-162727799 CCGCCCCCGCGCCCGGCCCTAGG + Intronic
1018682012 6:166272125-166272147 CAGCCTGCGCTCCAAGGGCTGGG + Intergenic
1018730882 6:166649646-166649668 CAACCCCCACTCCCAGGGCAAGG + Intronic
1018753756 6:166830738-166830760 CAGCCCCCGCTTTCAGATCTGGG - Intronic
1018794052 6:167172201-167172223 CAGCCCCAGCTCCCGGGCACGGG - Exonic
1018822283 6:167382876-167382898 CAGCCCCAGCTCCCGGGCACGGG + Exonic
1018895533 6:168013755-168013777 CAGCCCCATCTCCCCTGCCTGGG - Intronic
1019688890 7:2398676-2398698 CAGCCTCAGCACCCAGCCCTGGG + Intergenic
1019937569 7:4266513-4266535 CTGCCCCCTCTCCCAGTCCGAGG + Exonic
1020013975 7:4820555-4820577 CAGCCCCGATTCCCAGGACTGGG + Intronic
1020105570 7:5420913-5420935 CAGACTCGGCTCCCAGGGCTGGG - Intronic
1020137384 7:5594585-5594607 CCGCCCCCGGGCCCAGGGCTCGG + Intronic
1020257664 7:6510926-6510948 CAGCCTCCGGTCCCAGGGCCTGG - Exonic
1020761051 7:12269056-12269078 CAGGACCCGCTCACAGGCCCAGG + Intergenic
1021451215 7:20785173-20785195 AAGCCCTCGCACCCGGGCCTGGG - Exonic
1021653654 7:22854365-22854387 CTGCCCCCACGCCGAGGCCTCGG + Intergenic
1022511700 7:30938820-30938842 AAGCCCCCGGCCCCAGGTCTGGG + Intronic
1023822178 7:43986426-43986448 CACCCCCTTCCCCCAGGCCTGGG - Intergenic
1023872492 7:44270298-44270320 CAGCCACTGCTTCCAGGCCAGGG - Intronic
1023997742 7:45172238-45172260 CTACCCCAGCTCCCAGTCCTGGG - Intronic
1024977568 7:55127870-55127892 CAGGCCCCGCTCTCAGCCCCGGG + Intronic
1025806458 7:64838234-64838256 CAGCGGCCGCTCCGAGGCCGGGG + Intergenic
1026433380 7:70370336-70370358 CTGCCCCAGCTCTCAGCCCTAGG + Intronic
1029246511 7:99205949-99205971 CACCCCCCGTCCCCAGCCCTTGG + Intronic
1029633156 7:101765921-101765943 GAGCCACCGCTCCCAGGCTCAGG + Intergenic
1029750444 7:102539840-102539862 CACCCCCTTCCCCCAGGCCTGGG - Intronic
1029768396 7:102638948-102638970 CACCCCCTTCCCCCAGGCCTGGG - Intronic
1032125406 7:129189266-129189288 CCGCCCGCGCTCCGAGGCCCAGG - Exonic
1032130720 7:129225251-129225273 CGGCCCCCGGTCCCCGGCCCGGG + Exonic
1032223333 7:130010602-130010624 CAGCACCCGCACTCAGGGCTGGG - Intergenic
1032504316 7:132424251-132424273 TGCCCCCCGCTCCCTGGCCTGGG + Intronic
1033223630 7:139544471-139544493 CAGGCCCCTCTCCCAGGCCCTGG + Exonic
1034255128 7:149720624-149720646 CAGGCCCCGCCCCCATGCCCTGG + Intronic
1034273015 7:149812355-149812377 CAGCCCCCACCCCAGGGCCTGGG + Intergenic
1035153206 7:156892622-156892644 CCGCCCCCGCCCCGCGGCCTCGG - Intronic
1035168184 7:157003767-157003789 CAGCAGCCGCGCCCCGGCCTTGG + Intronic
1035209017 7:157314123-157314145 CAGAGCCCGCTCCCAGGGCTGGG - Intergenic
1035772058 8:2155592-2155614 CAGCCCCCGGTCACACCCCTCGG + Intronic
1035772070 8:2155631-2155653 CAGCCCCCGGTCACACCCCTTGG + Intronic
1036165557 8:6429500-6429522 CCGCCCCAGCTGCCAGGCTTGGG + Intronic
1036824609 8:11966427-11966449 AACCCCCGGCTCCCAGACCTGGG + Intergenic
1037835685 8:22213621-22213643 CAGTCCCAGCTCACAGGCCAGGG + Intergenic
1037994652 8:23343437-23343459 CAGCCCCACCTCCCAGTCCCTGG - Intronic
1038432277 8:27509970-27509992 CCGGCCCTGCTCACAGGCCTTGG + Intronic
1039509369 8:38078592-38078614 AAGCCACCGCACCCTGGCCTGGG + Intergenic
1040031065 8:42824198-42824220 CATCCCCCACTCCCAGTCCATGG - Intergenic
1040572229 8:48621233-48621255 CAGCCCCCTCTCTGAGGCCGAGG - Intergenic
1042082529 8:65071016-65071038 GGGCCCCCGATTCCAGGCCTTGG - Intergenic
1042723002 8:71844299-71844321 CACCCCGCGCTTCCCGGCCTGGG - Exonic
1044229398 8:89757587-89757609 CAGCCGCCCGTCCCAGCCCTCGG + Intergenic
1045468817 8:102492876-102492898 GAGCCACCGCGCCCAGCCCTAGG + Intergenic
1045649045 8:104326009-104326031 CAGCCGCCGCTCCAAAGCCTGGG - Intergenic
1047074242 8:121382039-121382061 GAGCCACCGCACCCAGCCCTGGG - Intergenic
1047510745 8:125513454-125513476 CAGCCCCCGCTCCCAGGTCCAGG - Intergenic
1048406350 8:134126574-134126596 CAGCTCCCTCTCCCACACCTGGG + Intergenic
1049324617 8:142015562-142015584 CAGCCCTCCCTCCCAGGCCGGGG + Intergenic
1049444150 8:142622376-142622398 CATCCCCTGCTCCCAGGCCCTGG + Intergenic
1049591362 8:143464427-143464449 CAGCCCCTGCTGCCGGGCCAAGG - Intronic
1049592645 8:143469575-143469597 CAGGCCGCCCTCCCAGGCCGTGG - Intronic
1049653946 8:143789599-143789621 AGCTCCCCGCTCCCAGGCCTGGG + Intergenic
1049654512 8:143791819-143791841 CAGACCCCACCCCCATGCCTCGG + Intronic
1049782202 8:144434202-144434224 CAGCGCCTGCTCCCTGGCCCTGG - Exonic
1049790983 8:144472633-144472655 CAGCTCCCGCTCGCATGCCCTGG + Exonic
1049850427 8:144827452-144827474 CAGCCCCGCCTCCCAGGCTCCGG - Intronic
1052192681 9:25677706-25677728 CGGCCTCCGCTCCCGGGACTCGG - Exonic
1053014722 9:34655286-34655308 CTCCCCCTGCCCCCAGGCCTGGG + Exonic
1053200533 9:36148916-36148938 CAACCCCCACTCCTCGGCCTGGG - Intronic
1053313854 9:37035891-37035913 CACCCCCCGCCCCCAGCCCGGGG - Intergenic
1053721644 9:40952300-40952322 CAGCCCCTGCACTCCGGCCTGGG + Intergenic
1055085044 9:72305274-72305296 CAGCCCACACTGACAGGCCTAGG - Intergenic
1055640521 9:78315733-78315755 GAGCCACTGCACCCAGGCCTTGG + Intronic
1056256374 9:84803445-84803467 CAGCTCCTGCTCCCAGACCAAGG - Intronic
1056643218 9:88388420-88388442 CCGCCCCCGCTCCCTCGCCGCGG - Exonic
1056972331 9:91216752-91216774 CACCCCCTCCTCCCAGGCCTGGG + Intronic
1057820110 9:98323645-98323667 CATCCCTCCCACCCAGGCCTTGG + Intronic
1060506024 9:124199047-124199069 GAGCCACCGCACCCAGGCCCTGG + Intergenic
1060553306 9:124495771-124495793 CAGAGCCTGCTCCCAGGGCTGGG - Intronic
1060731495 9:126039702-126039724 CAGCCTCAGCTCCCCGGGCTGGG + Intergenic
1060978226 9:127777605-127777627 CATCCCCTGCCCGCAGGCCTGGG - Intronic
1060979805 9:127785643-127785665 CAGCCCCCGAGCCGCGGCCTGGG - Intergenic
1061225721 9:129279769-129279791 CACCACCCCCTCCCAGGCCATGG - Intergenic
1061392575 9:130325985-130326007 GAGCCCCCTCTCCCAGGACAGGG - Intronic
1061449489 9:130660680-130660702 CCTCCCCCGCACCCAGGCCCGGG + Intergenic
1061557265 9:131378580-131378602 CAGCTCACCCTCCCAGGGCTGGG - Intergenic
1061646241 9:132004498-132004520 CAGCCCCTGCTCACAAGCCCCGG + Intronic
1061808481 9:133149219-133149241 CCGCCCCGGCTCCCCGGGCTCGG + Intronic
1061878218 9:133555499-133555521 CAGCCCTTGCCCCCAGGGCTCGG + Intronic
1062140717 9:134957321-134957343 CAGCCACCGAGCCCAGCCCTCGG + Intergenic
1062290593 9:135792626-135792648 CAGCCCTGGCCCCCAGCCCTTGG - Exonic
1062391467 9:136335655-136335677 CAGCCCCCTGCCCCAGGCCCAGG + Intronic
1062456169 9:136640221-136640243 TAGCCACCGCACCCAGCCCTGGG + Intergenic
1062551495 9:137089538-137089560 CTGCTCCCTCTCCCAGCCCTGGG - Intronic
1188005008 X:25011167-25011189 CAACCCCAGGTCCCAGGCTTCGG - Intronic
1188242455 X:27808830-27808852 CAGCCTCTGCTCTCAAGCCTGGG + Intronic
1192174411 X:68876853-68876875 CAACCCCCACTCCCAGTCCCAGG - Intergenic
1192261060 X:69505981-69506003 CAGCCCGGGCTCCGGGGCCTGGG + Exonic
1192656833 X:73002367-73002389 CAGGCCCTGTTCCCAGTCCTGGG + Intergenic
1192665287 X:73080634-73080656 CAGGCCCTGTTCCCAGTCCTGGG - Intergenic
1194339170 X:92688325-92688347 GAGCCACCGCGCCCAGCCCTAGG - Intergenic
1196747776 X:119086940-119086962 CAGCCCCTGCTACCAAACCTGGG - Exonic
1197533573 X:127661911-127661933 CAGCCTCTGCTGCCAAGCCTGGG + Intergenic
1198277797 X:135112829-135112851 CAGCCTCAGCTGCCTGGCCTGGG - Intergenic
1198618408 X:138481932-138481954 CAGCCCCTGCTATCAGCCCTAGG + Intergenic
1198960092 X:142174517-142174539 CAGCCCCAGCTGTCAGCCCTGGG - Intergenic
1200073124 X:153538688-153538710 CAGCCCCTGCCCCCATGCCCTGG + Intronic
1202584540 Y:26409312-26409334 CAGGCCCTGCACCCAGGCCAGGG + Intergenic