ID: 900196934

View in Genome Browser
Species Human (GRCh38)
Location 1:1381244-1381266
Sequence CCTCTGCTCCGAAGTGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900196934_900196938 0 Left 900196934 1:1381244-1381266 CCTGAGCCACTTCGGAGCAGAGG No data
Right 900196938 1:1381267-1381289 CCGAACCCACCCCCACCTTGTGG No data
900196934_900196939 4 Left 900196934 1:1381244-1381266 CCTGAGCCACTTCGGAGCAGAGG No data
Right 900196939 1:1381271-1381293 ACCCACCCCCACCTTGTGGCTGG No data
900196934_900196947 21 Left 900196934 1:1381244-1381266 CCTGAGCCACTTCGGAGCAGAGG No data
Right 900196947 1:1381288-1381310 GGCTGGCGACCCTCACTTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900196934 Original CRISPR CCTCTGCTCCGAAGTGGCTC AGG (reversed) Intergenic