ID: 900196936

View in Genome Browser
Species Human (GRCh38)
Location 1:1381250-1381272
Sequence GTTCGGCCTCTGCTCCGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900196936_900196950 28 Left 900196936 1:1381250-1381272 CCACTTCGGAGCAGAGGCCGAAC No data
Right 900196950 1:1381301-1381323 CACTTTCCGGATGCTGAACCAGG No data
900196936_900196947 15 Left 900196936 1:1381250-1381272 CCACTTCGGAGCAGAGGCCGAAC No data
Right 900196947 1:1381288-1381310 GGCTGGCGACCCTCACTTTCCGG No data
900196936_900196939 -2 Left 900196936 1:1381250-1381272 CCACTTCGGAGCAGAGGCCGAAC No data
Right 900196939 1:1381271-1381293 ACCCACCCCCACCTTGTGGCTGG No data
900196936_900196938 -6 Left 900196936 1:1381250-1381272 CCACTTCGGAGCAGAGGCCGAAC No data
Right 900196938 1:1381267-1381289 CCGAACCCACCCCCACCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900196936 Original CRISPR GTTCGGCCTCTGCTCCGAAG TGG (reversed) Intergenic